Starting /dee2/code/volunteer_pipeline.sh SRR7170451 current disk space = 3050870775808 free memory = 1503414368 SRR7170451 SRAfilesize e71911856b7bfa489a7fb559cde59ee6 SRR7170451.sra SRR7170451.sra file validated SRR7170451 is paired end SRR7170451 is conventional basespace SRR7170451 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170451_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.74125 18.0 18.0 28.0 18.0 32.0 2 30.4675 31.0 29.0 33.0 27.0 33.0 3 31.714 33.0 31.0 33.0 29.0 33.0 4 32.123 33.0 33.0 33.0 31.0 33.0 5 32.72725 33.0 33.0 34.0 31.0 34.0 6 36.87575 38.0 37.0 38.0 35.0 38.0 7 37.164 38.0 38.0 38.0 36.0 38.0 8 37.45325 38.0 38.0 38.0 37.0 38.0 9 37.555 38.0 38.0 38.0 38.0 38.0 10-14 37.52855 38.0 38.0 38.0 37.6 38.0 15-19 37.559349999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.57 38.0 38.0 38.0 38.0 38.0 25-29 37.4635 38.0 38.0 38.0 37.0 38.0 30-34 37.4997 38.0 38.0 38.0 38.0 38.0 35-39 37.5036 38.0 38.0 38.0 37.6 38.0 40-44 36.86225 38.0 37.4 38.0 33.2 38.0 45-49 36.42485 38.0 37.4 38.0 31.0 38.0 50-54 37.23285 38.0 38.0 38.0 36.6 38.0 55-59 37.24294999999999 38.0 38.0 38.0 36.2 38.0 60-64 37.2342 38.0 38.0 38.0 36.6 38.0 65-69 37.1392 38.0 38.0 38.0 36.0 38.0 70-74 36.99765 38.0 38.0 38.0 35.8 38.0 75-79 36.94754999999999 38.0 38.0 38.0 36.0 38.0 80-84 36.87065 38.0 38.0 38.0 35.8 38.0 85-89 36.603750000000005 38.0 37.8 38.0 34.4 38.0 90-94 36.3848 38.0 38.0 38.0 33.8 38.0 95-99 36.53025 38.0 38.0 38.0 34.2 38.0 100-104 36.402499999999996 38.0 38.0 38.0 34.0 38.0 105-109 36.30385 38.0 37.8 38.0 33.8 38.0 110-114 36.03869999999999 38.0 37.2 38.0 33.0 38.0 115-119 35.7641 38.0 37.0 38.0 31.4 38.0 120-124 35.7432 38.0 36.6 38.0 31.8 38.0 125-129 35.41250000000001 38.0 36.0 38.0 30.2 38.0 130-134 35.07065 38.0 35.6 38.0 28.8 38.0 135-139 34.69690000000001 38.0 34.8 38.0 27.2 38.0 140-144 34.0529 38.0 33.8 38.0 24.2 38.0 145-149 33.2902 38.0 33.0 38.0 20.6 38.0 150-151 28.083125000000003 34.5 17.5 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 2.0 13 0.0 14 1.0 15 2.0 16 2.0 17 1.0 18 5.0 19 6.0 20 3.0 21 3.0 22 3.0 23 4.0 24 9.0 25 4.0 26 13.0 27 22.0 28 25.0 29 26.0 30 44.0 31 65.0 32 74.0 33 112.0 34 190.0 35 324.0 36 1043.0 37 2015.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.99379524301965 11.297828335056877 9.565667011375387 36.142709410548086 2 21.360680340170084 15.832916458229116 33.59179589794897 29.214607303651825 3 20.175 20.95 25.650000000000002 33.225 4 23.225 26.35 23.549999999999997 26.875 5 21.9 31.7 24.65 21.75 6 19.025 36.1 24.725 20.150000000000002 7 14.85 25.324999999999996 41.575 18.25 8 16.325 25.4 32.175 26.1 9 16.875 24.15 34.775 24.2 10-14 19.3 29.959999999999997 27.26 23.48 15-19 19.21 28.76 27.82 24.21 20-24 19.665 28.599999999999998 27.975 23.76 25-29 19.71 28.925 27.839999999999996 23.525 30-34 19.165 28.904999999999998 27.834999999999997 24.095 35-39 19.425 29.13 27.68 23.765 40-44 19.555977798889945 28.941447072353615 27.636381819090953 23.866193309665483 45-49 19.24 28.71 27.775 24.275 50-54 19.400000000000002 28.935 27.305 24.36 55-59 19.64 29.2 27.474999999999998 23.685000000000002 60-64 19.585 28.915000000000003 27.589999999999996 23.91 65-69 19.49 28.96 27.755000000000003 23.794999999999998 70-74 19.869999999999997 29.020000000000003 27.49 23.62 75-79 19.41 28.71 28.310000000000002 23.57 80-84 19.8 28.499999999999996 27.905 23.794999999999998 85-89 19.865 28.599999999999998 27.495000000000005 24.04 90-94 19.93599679983999 28.826441322066103 27.38136906845342 23.85619280964048 95-99 19.53 28.549999999999997 28.000000000000004 23.919999999999998 100-104 20.115 28.189999999999998 27.68 24.015 105-109 19.685 28.225 27.595 24.495 110-114 20.25 27.805000000000003 27.97 23.974999999999998 115-119 20.49 28.025 27.515 23.97 120-124 20.405 28.235 27.125 24.235 125-129 20.375 28.799999999999997 26.71 24.115000000000002 130-134 20.205000000000002 28.544999999999998 27.029999999999998 24.22 135-139 20.349999999999998 28.27 27.205000000000002 24.175 140-144 20.395 27.92 27.525 24.16 145-149 20.5 28.410000000000004 26.845000000000002 24.245 150-151 20.3 27.987499999999997 26.724999999999998 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 1.0 17 1.0 18 0.5 19 0.5 20 0.5 21 2.5 22 3.0 23 2.5 24 4.0 25 4.0 26 3.0 27 3.5 28 8.0 29 13.0 30 16.5 31 25.0 32 38.5 33 48.5 34 60.0 35 85.0 36 103.0 37 114.5 38 145.0 39 175.5 40 186.5 41 203.5 42 232.5 43 254.5 44 265.5 45 267.0 46 269.5 47 266.0 48 225.0 49 195.5 50 175.0 51 127.5 52 106.0 53 89.5 54 72.5 55 65.0 56 42.0 57 31.0 58 27.5 59 17.0 60 10.0 61 4.0 62 2.0 63 2.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.3000000000000003 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.0 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14141414141415 98.15 2 0.7575757575757576 1.5 3 0.050505050505050504 0.15 4 0.050505050505050504 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.48750000000000004 0.0 0.0 0.0 0.0 86-87 0.6 0.0 0.0 0.0 0.0 88-89 0.6875 0.0 0.0 0.0 0.0 90-91 0.8375 0.0 0.0 0.0 0.0 92-93 1.0499999999999998 0.0 0.0 0.0 0.0 94-95 1.2375 0.0 0.0 0.0 0.0 96-97 1.475 0.0 0.0 0.0 0.0 98-99 1.625 0.0 0.0 0.0 0.0 100-101 1.725 0.0 0.0 0.0 0.0 102-103 1.8875 0.0 0.0 0.0 0.0 104-105 2.1500000000000004 0.0 0.0 0.0 0.0 106-107 2.375 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.8375 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.5875000000000004 0.0 0.0 0.0 0.0 116-117 4.0375 0.0 0.0 0.0 0.0 118-119 4.4125 0.0 0.0 0.0 0.0 120-121 4.8 0.0 0.0 0.0 0.0 122-123 5.0875 0.0 0.0 0.0 0.0 124-125 5.4625 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.4125 0.0 0.0 0.0 0.0 130-131 6.8625 0.0 0.0 0.0 0.0 132-133 7.35 0.0 0.0 0.0 0.0 134-135 7.625 0.0 0.0 0.0 0.0 136-137 7.987500000000001 0.0 0.0 0.0 0.0 138-139 8.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170451 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170451_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.555 33.0 33.0 34.0 32.0 34.0 2 32.93625 33.0 33.0 34.0 32.0 34.0 3 30.85725 33.0 32.0 34.0 18.0 34.0 4 32.311 33.0 32.0 34.0 28.0 34.0 5 32.82025 33.0 33.0 34.0 32.0 34.0 6 37.219 38.0 38.0 38.0 37.0 38.0 7 36.905 38.0 38.0 38.0 36.0 38.0 8 37.25975 38.0 38.0 38.0 37.0 38.0 9 37.325 38.0 38.0 38.0 37.0 38.0 10-14 37.22430000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.2779 38.0 38.0 38.0 37.8 38.0 20-24 37.0938 38.0 38.0 38.0 37.0 38.0 25-29 37.015499999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.0952 38.0 38.0 38.0 37.0 38.0 35-39 37.155950000000004 38.0 38.0 38.0 37.0 38.0 40-44 36.42334999999999 38.0 37.4 38.0 33.6 38.0 45-49 37.106049999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.05285 38.0 38.0 38.0 37.0 38.0 55-59 36.011449999999996 38.0 37.0 38.0 30.6 38.0 60-64 36.50405 38.0 38.0 38.0 34.2 38.0 65-69 36.327600000000004 38.0 37.6 38.0 31.8 38.0 70-74 36.09255 38.0 37.2 38.0 32.2 38.0 75-79 36.7132 38.0 38.0 38.0 35.4 38.0 80-84 36.75565 38.0 38.0 38.0 36.0 38.0 85-89 36.64945 38.0 38.0 38.0 35.4 38.0 90-94 36.67865 38.0 38.0 38.0 35.8 38.0 95-99 36.521950000000004 38.0 38.0 38.0 34.8 38.0 100-104 36.3 38.0 38.0 38.0 34.0 38.0 105-109 36.06265 38.0 38.0 38.0 33.8 38.0 110-114 36.05585 38.0 37.8 38.0 33.8 38.0 115-119 35.624649999999995 38.0 36.8 38.0 31.8 38.0 120-124 35.46315 38.0 36.6 38.0 31.0 38.0 125-129 35.029 38.0 36.2 38.0 29.4 38.0 130-134 34.7598 38.0 35.8 38.0 28.2 38.0 135-139 34.26369999999999 38.0 34.2 38.0 26.4 38.0 140-144 33.33945 38.0 33.0 38.0 20.6 38.0 145-149 32.65885000000001 38.0 33.0 38.0 12.4 38.0 150-151 26.91475 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 4.0 5 2.0 6 2.0 7 3.0 8 1.0 9 0.0 10 2.0 11 2.0 12 3.0 13 1.0 14 3.0 15 5.0 16 2.0 17 5.0 18 9.0 19 5.0 20 7.0 21 5.0 22 3.0 23 10.0 24 8.0 25 10.0 26 23.0 27 17.0 28 23.0 29 33.0 30 41.0 31 47.0 32 68.0 33 114.0 34 189.0 35 295.0 36 820.0 37 2225.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.125 21.8 13.55 24.525 2 26.775 26.75 29.125 17.349999999999998 3 21.099999999999998 27.250000000000004 32.300000000000004 19.35 4 24.425 33.074999999999996 24.25 18.25 5 24.125 37.375 21.349999999999998 17.150000000000002 6 20.599999999999998 39.475 23.075000000000003 16.85 7 20.0 20.75 39.15 20.1 8 22.375 24.875 27.975 24.775 9 22.3 26.150000000000002 28.599999999999998 22.95 10-14 23.39 29.075 26.795 20.74 15-19 23.580000000000002 28.215 27.694999999999997 20.51 20-24 23.56 28.105000000000004 27.36 20.974999999999998 25-29 23.9 28.235 27.46 20.405 30-34 23.985 27.985 27.77 20.26 35-39 23.465 27.655 27.839999999999996 21.04 40-44 23.905 27.79 27.77 20.535 45-49 23.75 27.43 28.144999999999996 20.674999999999997 50-54 23.419999999999998 27.825 28.07 20.685000000000002 55-59 23.369999999999997 27.935 28.415000000000003 20.28 60-64 23.65 27.555000000000003 27.975 20.82 65-69 24.065 27.694999999999997 27.87 20.369999999999997 70-74 23.355 28.1 27.875 20.669999999999998 75-79 24.04 28.02 27.38 20.560000000000002 80-84 23.65 28.235 27.505000000000003 20.61 85-89 23.535 27.884999999999998 28.435 20.145 90-94 24.060000000000002 28.015 27.71 20.215 95-99 24.305 27.900000000000002 27.92 19.875 100-104 24.675 28.000000000000004 27.38 19.945 105-109 24.3 28.42 27.35 19.93 110-114 24.68 28.485 27.195000000000004 19.64 115-119 24.42 28.439999999999998 27.189999999999998 19.950000000000003 120-124 24.555 28.415000000000003 27.195000000000004 19.835 125-129 24.529999999999998 28.38 27.74 19.35 130-134 24.425 28.799999999999997 27.189999999999998 19.585 135-139 25.180000000000003 28.384999999999998 27.355 19.08 140-144 25.3 28.345 27.334999999999997 19.02 145-149 25.509999999999998 28.33 27.54 18.62 150-151 25.2375 28.3625 27.1625 19.2375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 2.0 20 1.5 21 0.5 22 1.5 23 1.5 24 2.0 25 2.0 26 1.5 27 5.0 28 8.5 29 10.5 30 12.0 31 19.0 32 29.0 33 35.0 34 51.0 35 68.0 36 88.0 37 110.0 38 132.0 39 158.5 40 197.0 41 224.0 42 224.0 43 245.5 44 269.0 45 264.0 46 260.5 47 261.5 48 245.0 49 211.5 50 172.5 51 142.0 52 122.5 53 100.5 54 89.5 55 75.0 56 46.0 57 31.5 58 23.0 59 17.5 60 12.0 61 6.5 62 6.5 63 5.0 64 2.0 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54728370221329 98.95 2 0.4024144869215292 0.8 3 0.0 0.0 4 0.0 0.0 5 0.05030181086519115 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTAAGATTAGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.0625 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.625 0.0 0.0 0.0 0.0 88-89 0.7124999999999999 0.0 0.0 0.0 0.0 90-91 0.8625 0.0 0.0 0.0 0.0 92-93 1.0750000000000002 0.0 0.0 0.0 0.0 94-95 1.2625 0.0 0.0 0.0 0.0 96-97 1.4874999999999998 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.75 0.0 0.0 0.0 0.0 102-103 1.9125 0.0 0.0 0.0 0.0 104-105 2.175 0.0 0.0 0.0 0.0 106-107 2.4000000000000004 0.0 0.0 0.0 0.0 108-109 2.625 0.0 0.0 0.0 0.0 110-111 2.8625 0.0 0.0 0.0 0.0 112-113 3.2 0.0 0.0 0.0 0.0 114-115 3.6875 0.0 0.0 0.0 0.0 116-117 4.112500000000001 0.0 0.0 0.0 0.0 118-119 4.5125 0.0 0.0 0.0 0.0 120-121 4.9 0.0 0.0 0.0 0.0 122-123 5.175 0.0 0.0 0.0 0.0 124-125 5.5375 0.0 0.0 0.0 0.0 126-127 5.925000000000001 0.0 0.0 0.0 0.0 128-129 6.4875 0.0 0.0 0.0 0.0 130-131 6.9375 0.0 0.0 0.0 0.0 132-133 7.4375 0.0 0.0 0.0 0.0 134-135 7.7375 0.0 0.0 0.0 0.0 136-137 8.1125 0.0 0.0 0.0 0.0 138-139 8.412500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TAACCTA 10 0.006830828 145.0 8 AAGATTC 10 0.006830828 145.0 5 CAGAAAT 10 0.006830828 145.0 1 AAAAAAA 40 0.0076550315 18.125 135-139 >>END_MODULE Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666037 spots for SRR7170451.sra Written 666037 spots for SRR7170451.sra Read 666044 spots for SRR7170451.sra Written 666044 spots for SRR7170451.sra SRR ids: ['SRR7170451.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_9j26d772 SRR7170451.sra spots: 13320747 blocks: [[1, 666037], [666038, 1332074], [1332075, 1998111], [1998112, 2664148], [2664149, 3330185], [3330186, 3996222], [3996223, 4662259], [4662260, 5328296], [5328297, 5994333], [5994334, 6660370], [6660371, 7326407], [7326408, 7992444], [7992445, 8658481], [8658482, 9324518], [9324519, 9990555], [9990556, 10656592], [10656593, 11322629], [11322630, 11988666], [11988667, 12654703], [12654704, 13320747]] SRR7170451 file size 4492263 SRR7170451 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170451 SRR7170451_1.fastq SRR7170451_2.fastq Input file: SRR7170451_1.fastq Paired file: SRR7170451_2.fastq trimmed: SRR7170451-trimmed-pair1.fastq, SRR7170451-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:39:36 2025 >> started Wed Feb 12 20:39:51 2025 >> done (14.747s) 13320747 read pairs processed; of these: 19195 ( 0.14%) short read pairs filtered out after trimming by size control 32969 ( 0.25%) empty read pairs filtered out after trimming by size control 13268583 (99.61%) read pairs available; of these: 7162052 (53.98%) trimmed read pairs available after processing 6106531 (46.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 7 0.00% 20 5 0.00% 21 6 0.00% 22 3 0.00% 23 5 0.00% 24 3 0.00% 25 5 0.00% 26 9 0.00% 27 5 0.00% 28 4 0.00% 29 8 0.00% 30 13 0.00% 31 10 0.00% 32 16 0.00% 33 14 0.00% 34 19 0.00% 35 16 0.00% 36 20 0.00% 37 26 0.00% 38 35 0.00% 39 54 0.00% 40 54 0.00% 41 51 0.00% 42 70 0.00% 43 47 0.00% 44 74 0.00% 45 77 0.00% 46 102 0.00% 47 101 0.00% 48 156 0.00% 49 167 0.00% 50 195 0.00% 51 198 0.00% 52 241 0.00% 53 267 0.00% 54 289 0.00% 55 280 0.00% 56 334 0.00% 57 392 0.00% 58 419 0.00% 59 556 0.00% 60 588 0.00% 61 682 0.01% 62 825 0.01% 63 823 0.01% 64 934 0.01% 65 1081 0.01% 66 1190 0.01% 67 1295 0.01% 68 1421 0.01% 69 1592 0.01% 70 1892 0.01% 71 2140 0.02% 72 2451 0.02% 73 2806 0.02% 74 3150 0.02% 75 3450 0.03% 76 4211 0.03% 77 4987 0.04% 78 4415 0.03% 79 4873 0.04% 80 5052 0.04% 81 5843 0.04% 82 6422 0.05% 83 7201 0.05% 84 8731 0.07% 85 9683 0.07% 86 9942 0.07% 87 10333 0.08% 88 10876 0.08% 89 11292 0.09% 90 11998 0.09% 91 12762 0.10% 92 13692 0.10% 93 14811 0.11% 94 15927 0.12% 95 16884 0.13% 96 17135 0.13% 97 17605 0.13% 98 17802 0.13% 99 18139 0.14% 100 19136 0.14% 101 19717 0.15% 102 20811 0.16% 103 22071 0.17% 104 22752 0.17% 105 23711 0.18% 106 24536 0.18% 107 24832 0.19% 108 24712 0.19% 109 25391 0.19% 110 25694 0.19% 111 26363 0.20% 112 27061 0.20% 113 27661 0.21% 114 28773 0.22% 115 29835 0.22% 116 30500 0.23% 117 31116 0.23% 118 30980 0.23% 119 30893 0.23% 120 31749 0.24% 121 32188 0.24% 122 32860 0.25% 123 34422 0.26% 124 35251 0.27% 125 35630 0.27% 126 37126 0.28% 127 37606 0.28% 128 38313 0.29% 129 39289 0.30% 130 40711 0.31% 131 40840 0.31% 132 42940 0.32% 133 44735 0.34% 134 46660 0.35% 135 49382 0.37% 136 52069 0.39% 137 54429 0.41% 138 57727 0.44% 139 62609 0.47% 140 67181 0.51% 141 73458 0.55% 142 82567 0.62% 143 95397 0.72% 144 112846 0.85% 145 137634 1.04% 146 174677 1.32% 147 241559 1.82% 148 375636 2.83% 149 756582 5.70% 150 3390141 25.55% 151 6106531 46.02% 13268583 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=2.35 fanout-score-rank=17 prefix-density=0.71 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=29.52 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=9.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.63 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=25 prefix-density=0.63 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=32.25 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170451 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:40:53 Started mapping on | Feb 12 20:40:54 Finished on | Feb 12 20:42:51 Mapping speed, Million of reads per hour | 408.26 Number of input reads | 13268583 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12278795 Uniquely mapped reads % | 92.54% Average mapped length | 291.09 Number of splices: Total | 12420306 Number of splices: Annotated (sjdb) | 12157897 Number of splices: GT/AG | 12192748 Number of splices: GC/AG | 186366 Number of splices: AT/AC | 6972 Number of splices: Non-canonical | 34220 Mismatch rate per base, % | 0.34% Deletion rate per base | 0.03% Deletion average length | 2.60 Insertion rate per base | 0.02% Insertion average length | 2.06 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304742 % of reads mapped to multiple loci | 2.30% Number of reads mapped to too many loci | 17590 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.00% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 699244 699244 699244 N_multimapping 304742 304742 304742 N_noFeature 373959 12066864 442577 N_ambiguous 226734 744 83024 UnstrandedReadsAssigned:11678102 PositiveStrandReadsAssigned:211187 NegativeStrandReadsAssigned:11753194 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170451 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170451-trimmed-pair1.fastq SRR7170451-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,268,583 reads, 11,720,694 reads pseudoaligned [quant] estimated average fragment length: 241.079 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7170451.ke.tsv 34699 SRR7170451.se.tsv 87100 total ==> SRR7170451.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1777.92 416 17.0773 Potri.005G024800.1.v4.1 1035 794.921 195 17.9039 Potri.004G059700.1.v4.1 961 720.935 24 2.4297 Potri.007G009000.2.v4.1 1416 1175.92 0 0 Potri.003G141000.2.v4.1 2943 2702.92 712.885 19.2497 Potri.016G087400.1.v4.1 270 85.2189 975 835.038 Potri.015G069301.1.v4.1 564 326.76 0 0 Potri.010G195200.1.v4.1 1773 1532.92 56 2.66628 Potri.012G127500.1.v4.1 977 736.931 63 6.23953 ==> SRR7170451.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 308 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 303 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 5 SRR7170451 completed mapping pipeline successfully