Starting /dee2/code/volunteer_pipeline.sh SRR7170452 current disk space = 3050907148288 free memory = 1581491592 SRR7170452 SRAfilesize 28250327773ed64378bf073c1431543e SRR7170452.sra SRR7170452.sra file validated SRR7170452 is paired end SRR7170452 is conventional basespace SRR7170452 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170452_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.3755 18.0 18.0 18.0 18.0 30.0 2 28.8195 29.0 27.0 31.0 27.0 31.0 3 30.1145 31.0 29.0 33.0 27.0 33.0 4 31.50025 33.0 31.0 33.0 29.0 33.0 5 32.42125 33.0 33.0 33.0 31.0 34.0 6 37.036 38.0 37.0 38.0 35.0 38.0 7 37.29675 38.0 38.0 38.0 36.0 38.0 8 37.47275 38.0 38.0 38.0 37.0 38.0 9 37.5045 38.0 38.0 38.0 37.0 38.0 10-14 37.49075 38.0 38.0 38.0 37.0 38.0 15-19 37.545950000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.449 38.0 38.0 38.0 37.0 38.0 25-29 37.344849999999994 38.0 38.0 38.0 37.0 38.0 30-34 37.4059 38.0 38.0 38.0 37.0 38.0 35-39 37.400099999999995 38.0 38.0 38.0 37.0 38.0 40-44 36.8507 38.0 37.6 38.0 32.8 38.0 45-49 36.370099999999994 38.0 37.2 38.0 32.0 38.0 50-54 36.98555 38.0 38.0 38.0 35.6 38.0 55-59 37.02535 38.0 38.0 38.0 36.0 38.0 60-64 36.98505 38.0 38.0 38.0 35.6 38.0 65-69 36.904450000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.72885 38.0 38.0 38.0 34.6 38.0 75-79 36.73715 38.0 38.0 38.0 34.8 38.0 80-84 36.622499999999995 38.0 38.0 38.0 34.4 38.0 85-89 36.342650000000006 38.0 37.4 38.0 33.6 38.0 90-94 36.081900000000005 38.0 37.0 38.0 33.0 38.0 95-99 36.19605 38.0 37.0 38.0 33.4 38.0 100-104 36.1238 38.0 37.0 38.0 33.0 38.0 105-109 35.9815 38.0 37.0 38.0 32.4 38.0 110-114 35.6958 38.0 36.4 38.0 30.8 38.0 115-119 35.2401 38.0 35.8 38.0 29.0 38.0 120-124 35.2702 38.0 35.6 38.0 29.0 38.0 125-129 35.02885 38.0 35.2 38.0 28.0 38.0 130-134 34.5993 38.0 34.8 38.0 26.6 38.0 135-139 34.1151 38.0 33.8 38.0 24.2 38.0 140-144 33.228300000000004 37.8 33.2 38.0 21.0 38.0 145-149 32.30055 37.6 32.2 38.0 16.2 38.0 150-151 26.379875 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 2.0 17 3.0 18 1.0 19 2.0 20 0.0 21 8.0 22 2.0 23 3.0 24 13.0 25 8.0 26 22.0 27 19.0 28 24.0 29 41.0 30 51.0 31 61.0 32 82.0 33 172.0 34 282.0 35 511.0 36 1301.0 37 1388.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.54474708171206 11.309987029831388 14.656290531776914 33.48897535667963 2 21.03551775887944 15.807903951975987 31.740870435217612 31.41570785392696 3 18.4 22.425 27.55 31.624999999999996 4 22.15 28.575 23.849999999999998 25.424999999999997 5 21.575 33.975 23.599999999999998 20.849999999999998 6 18.5 35.65 25.275 20.575 7 14.95 26.650000000000002 41.5 16.900000000000002 8 17.65 25.75 31.75 24.85 9 16.775000000000002 24.575 35.175 23.474999999999998 10-14 19.1 30.36 27.205000000000002 23.335 15-19 19.865 28.78 28.139999999999997 23.215 20-24 19.34 29.14 28.244999999999997 23.275000000000002 25-29 19.6 29.21 27.77 23.419999999999998 30-34 19.98 28.810000000000002 27.700000000000003 23.51 35-39 19.62 28.485 27.935 23.96 40-44 19.93 29.205 27.88 22.985 45-49 20.435 28.955 27.11 23.5 50-54 20.349999999999998 28.71 27.450000000000003 23.49 55-59 19.725 29.125 27.534999999999997 23.615 60-64 20.72 28.494999999999997 27.500000000000004 23.285 65-69 19.8 28.999999999999996 27.355 23.845 70-74 19.945 28.255000000000003 28.29 23.51 75-79 19.830000000000002 28.694999999999997 27.52 23.955000000000002 80-84 19.75 29.065 27.01 24.175 85-89 20.145 28.970000000000002 27.275 23.61 90-94 20.474999999999998 28.34 27.389999999999997 23.794999999999998 95-99 20.43 28.38 27.045 24.145 100-104 20.365 28.42 27.27 23.945 105-109 20.665 28.485 26.91 23.94 110-114 20.265 28.79 27.529999999999998 23.415 115-119 20.565 28.000000000000004 27.41 24.025 120-124 20.625 27.900000000000002 27.62 23.855 125-129 20.45 28.575 26.69 24.285 130-134 21.075 27.985 26.605 24.335 135-139 20.810000000000002 28.22 26.855 24.115000000000002 140-144 20.705000000000002 27.839999999999996 27.74 23.715 145-149 20.86 27.189999999999998 27.169999999999998 24.779999999999998 150-151 20.3 28.787499999999998 26.900000000000002 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.5 24 3.0 25 2.0 26 3.5 27 5.0 28 9.5 29 14.0 30 14.5 31 25.0 32 41.0 33 49.5 34 67.0 35 95.0 36 117.0 37 140.0 38 147.5 39 158.5 40 190.5 41 207.5 42 237.0 43 264.0 44 256.0 45 250.0 46 250.0 47 239.0 48 213.5 49 185.0 50 157.5 51 134.0 52 111.0 53 92.0 54 80.5 55 61.5 56 48.0 57 39.0 58 26.5 59 21.0 60 16.5 61 9.5 62 5.5 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6249999999999996 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44681921046015 98.875 2 0.5280362081971335 1.05 3 0.025144581342720643 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.675 0.0 0.0 0.0 0.0 88-89 0.7749999999999999 0.0 0.0 0.0 0.0 90-91 0.9625 0.0 0.0 0.0 0.0 92-93 1.125 0.0 0.0 0.0 0.0 94-95 1.4 0.0 0.0 0.0 0.0 96-97 1.5125000000000002 0.0 0.0 0.0 0.0 98-99 1.7 0.0 0.0 0.0 0.0 100-101 1.9500000000000002 0.0 0.0 0.0 0.0 102-103 2.1375 0.0 0.0 0.0 0.0 104-105 2.3 0.0 0.0 0.0 0.0 106-107 2.5 0.0 0.0 0.0 0.0 108-109 2.6375 0.0 0.0 0.0 0.0 110-111 2.85 0.0 0.0 0.0 0.0 112-113 3.1875 0.0 0.0 0.0 0.0 114-115 3.575 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.012499999999999 0.0 0.0 0.0 0.0 120-121 4.2875 0.0 0.0 0.0 0.0 122-123 4.6 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.6125 0.0 0.0 0.0 0.0 130-131 5.875 0.0 0.0 0.0 0.0 132-133 6.175 0.0 0.0 0.0 0.0 134-135 6.55 0.0 0.0 0.0 0.0 136-137 6.75 0.0 0.0 0.0 0.0 138-139 7.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170452 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170452_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.58875 33.0 33.0 34.0 32.0 34.0 2 32.92125 33.0 33.0 34.0 32.0 34.0 3 31.01475 33.0 32.0 34.0 18.0 34.0 4 32.3345 33.0 33.0 34.0 28.0 34.0 5 32.818 33.0 33.0 34.0 32.0 34.0 6 37.18775 38.0 38.0 38.0 37.0 38.0 7 37.02975 38.0 38.0 38.0 36.0 38.0 8 37.2685 38.0 38.0 38.0 37.0 38.0 9 37.25625 38.0 38.0 38.0 37.0 38.0 10-14 37.205749999999995 38.0 38.0 38.0 37.0 38.0 15-19 37.1819 38.0 38.0 38.0 37.0 38.0 20-24 37.0004 38.0 38.0 38.0 36.6 38.0 25-29 36.92569999999999 38.0 38.0 38.0 36.4 38.0 30-34 37.0527 38.0 38.0 38.0 37.0 38.0 35-39 37.1062 38.0 38.0 38.0 37.0 38.0 40-44 36.4136 38.0 37.6 38.0 33.6 38.0 45-49 37.081900000000005 38.0 38.0 38.0 36.8 38.0 50-54 37.08415 38.0 38.0 38.0 37.0 38.0 55-59 36.12405 38.0 37.4 38.0 30.6 38.0 60-64 36.342 38.0 37.8 38.0 33.6 38.0 65-69 36.293850000000006 38.0 37.6 38.0 31.8 38.0 70-74 35.87665 38.0 37.2 38.0 31.2 38.0 75-79 36.591750000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.733549999999994 38.0 38.0 38.0 35.6 38.0 85-89 36.63940000000001 38.0 38.0 38.0 35.4 38.0 90-94 36.6266 38.0 38.0 38.0 35.0 38.0 95-99 36.48695 38.0 38.0 38.0 34.4 38.0 100-104 36.31245 38.0 38.0 38.0 34.0 38.0 105-109 36.0994 38.0 37.8 38.0 33.8 38.0 110-114 36.032149999999994 38.0 37.4 38.0 33.6 38.0 115-119 35.74345 38.0 37.0 38.0 32.2 38.0 120-124 35.536750000000005 38.0 36.6 38.0 31.2 38.0 125-129 35.04795 38.0 36.0 38.0 29.6 38.0 130-134 34.78314999999999 38.0 35.8 38.0 28.2 38.0 135-139 34.3373 38.0 34.2 38.0 26.2 38.0 140-144 33.356550000000006 38.0 33.0 38.0 20.8 38.0 145-149 32.62865 38.0 33.0 38.0 14.8 38.0 150-151 26.88675 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 3.0 5 3.0 6 3.0 7 2.0 8 1.0 9 1.0 10 0.0 11 2.0 12 6.0 13 4.0 14 2.0 15 1.0 16 5.0 17 2.0 18 2.0 19 5.0 20 6.0 21 4.0 22 8.0 23 7.0 24 5.0 25 11.0 26 14.0 27 13.0 28 34.0 29 35.0 30 35.0 31 40.0 32 81.0 33 120.0 34 185.0 35 328.0 36 897.0 37 2120.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.225 21.575 13.825000000000001 24.375 2 26.424999999999997 26.575 29.849999999999998 17.150000000000002 3 21.575 27.800000000000004 31.374999999999996 19.25 4 23.575 34.55 23.05 18.825 5 23.65 37.675 21.95 16.725 6 20.775 37.75 24.05 17.424999999999997 7 20.349999999999998 21.7 37.525 20.424999999999997 8 22.05 26.724999999999998 26.424999999999997 24.8 9 23.1 26.25 28.799999999999997 21.85 10-14 23.724999999999998 29.035 26.240000000000002 21.0 15-19 23.355 27.994999999999997 27.750000000000004 20.9 20-24 23.21 28.225 27.384999999999998 21.18 25-29 23.445 27.529999999999998 28.134999999999998 20.89 30-34 23.255 27.815 28.105000000000004 20.825 35-39 22.875 28.435 27.76 20.93 40-44 23.465 28.625 27.084999999999997 20.825 45-49 23.055 27.994999999999997 27.810000000000002 21.14 50-54 23.595 28.075 27.205000000000002 21.125 55-59 23.255 27.334999999999997 28.275 21.135 60-64 23.07 27.810000000000002 27.694999999999997 21.425 65-69 23.635 28.555000000000003 27.139999999999997 20.669999999999998 70-74 23.87 27.605 27.51 21.015 75-79 23.31 28.17 27.47 21.05 80-84 23.46 28.134999999999998 27.29 21.115000000000002 85-89 23.580000000000002 28.355000000000004 27.35 20.715 90-94 23.61 27.589999999999996 27.715 21.085 95-99 23.955000000000002 28.62 26.490000000000002 20.935000000000002 100-104 24.355 27.339999999999996 27.685 20.62 105-109 24.525 27.67 27.395000000000003 20.41 110-114 24.375 27.455000000000002 27.3 20.87 115-119 24.79 27.79 26.974999999999998 20.445 120-124 24.104999999999997 28.13 27.555000000000003 20.21 125-129 24.490000000000002 28.225 26.83 20.455000000000002 130-134 24.7 27.584999999999997 27.665 20.05 135-139 25.040000000000003 27.500000000000004 27.744999999999997 19.715 140-144 24.555 27.250000000000004 27.689999999999998 20.505000000000003 145-149 24.685000000000002 27.71 27.450000000000003 20.155 150-151 24.9875 28.237499999999997 27.0 19.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 1.0 25 1.5 26 2.5 27 4.0 28 6.0 29 10.0 30 17.0 31 18.0 32 21.5 33 29.0 34 39.0 35 59.0 36 71.0 37 95.5 38 131.5 39 159.5 40 192.0 41 230.5 42 259.0 43 286.0 44 300.5 45 275.0 46 264.5 47 241.0 48 220.5 49 211.0 50 168.5 51 134.0 52 115.0 53 100.5 54 84.0 55 76.0 56 51.5 57 27.5 58 26.5 59 28.0 60 18.5 61 6.0 62 4.0 63 2.5 64 2.0 65 2.0 66 1.0 67 0.5 68 1.5 69 1.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11504424778761 98.0 2 0.7332490518331226 1.4500000000000002 3 0.1011378002528445 0.3 4 0.025284450063211124 0.1 5 0.0 0.0 6 0.025284450063211124 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GAAAGCTTTAGTGATAGCTATTCTTATAGCTACCATTGCCTTCTCTCCCT 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.35 0.0 0.0 0.0 0.0 84-85 0.4875 0.0 0.0 0.0 0.0 86-87 0.65 0.0 0.0 0.0 0.0 88-89 0.75 0.0 0.0 0.0 0.0 90-91 0.9375 0.0 0.0 0.0 0.0 92-93 1.1 0.0 0.0 0.0 0.0 94-95 1.3624999999999998 0.0 0.0 0.0 0.0 96-97 1.4625 0.0 0.0 0.0 0.0 98-99 1.65 0.0 0.0 0.0 0.0 100-101 1.9 0.0 0.0 0.0 0.0 102-103 2.0875 0.0 0.0 0.0 0.0 104-105 2.25 0.0 0.0 0.0 0.0 106-107 2.45 0.0 0.0 0.0 0.0 108-109 2.6 0.0 0.0 0.0 0.0 110-111 2.8 0.0 0.0 0.0 0.0 112-113 3.1375 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 3.775 0.0 0.0 0.0 0.0 118-119 3.9875 0.0 0.0 0.0 0.0 120-121 4.2625 0.0 0.0 0.0 0.0 122-123 4.575 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.5625 0.0 0.0 0.0 0.0 130-131 5.800000000000001 0.0 0.0 0.0 0.0 132-133 6.0875 0.0 0.0 0.0 0.0 134-135 6.475 0.0 0.0 0.0 0.0 136-137 6.7 0.0 0.0 0.0 0.0 138-139 7.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAACATA 10 0.006830828 145.0 4 AAAGACC 10 0.006830828 145.0 3 GAAAGAC 10 0.006830828 145.0 2 AACATAA 10 0.006830828 145.0 5 AAAAAAA 60 0.004491891 14.500001 15-19 >>END_MODULE Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra Read 577989 spots for SRR7170452.sra Written 577989 spots for SRR7170452.sra Read 577973 spots for SRR7170452.sra Written 577973 spots for SRR7170452.sra SRR ids: ['SRR7170452.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nf10yxds SRR7170452.sra spots: 11559476 blocks: [[1, 577973], [577974, 1155946], [1155947, 1733919], [1733920, 2311892], [2311893, 2889865], [2889866, 3467838], [3467839, 4045811], [4045812, 4623784], [4623785, 5201757], [5201758, 5779730], [5779731, 6357703], [6357704, 6935676], [6935677, 7513649], [7513650, 8091622], [8091623, 8669595], [8669596, 9247568], [9247569, 9825541], [9825542, 10403514], [10403515, 10981487], [10981488, 11559476]] SRR7170452 file size 3895426 SRR7170452 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170452 SRR7170452_1.fastq SRR7170452_2.fastq Input file: SRR7170452_1.fastq Paired file: SRR7170452_2.fastq trimmed: SRR7170452-trimmed-pair1.fastq, SRR7170452-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:16 2025 >> started Wed Feb 12 20:37:30 2025 >> done (13.916s) 11559476 read pairs processed; of these: 17936 ( 0.16%) short read pairs filtered out after trimming by size control 21186 ( 0.18%) empty read pairs filtered out after trimming by size control 11520354 (99.66%) read pairs available; of these: 6384388 (55.42%) trimmed read pairs available after processing 5135966 (44.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 1 0.00% 26 11 0.00% 27 1 0.00% 28 8 0.00% 29 5 0.00% 30 8 0.00% 31 14 0.00% 32 9 0.00% 33 10 0.00% 34 12 0.00% 35 12 0.00% 36 14 0.00% 37 11 0.00% 38 22 0.00% 39 31 0.00% 40 19 0.00% 41 36 0.00% 42 44 0.00% 43 41 0.00% 44 53 0.00% 45 52 0.00% 46 73 0.00% 47 71 0.00% 48 84 0.00% 49 111 0.00% 50 147 0.00% 51 163 0.00% 52 145 0.00% 53 146 0.00% 54 188 0.00% 55 210 0.00% 56 205 0.00% 57 280 0.00% 58 282 0.00% 59 339 0.00% 60 406 0.00% 61 506 0.00% 62 604 0.01% 63 647 0.01% 64 632 0.01% 65 687 0.01% 66 816 0.01% 67 910 0.01% 68 998 0.01% 69 1103 0.01% 70 1242 0.01% 71 1509 0.01% 72 1754 0.02% 73 1919 0.02% 74 2191 0.02% 75 2319 0.02% 76 2665 0.02% 77 2911 0.03% 78 2910 0.03% 79 3236 0.03% 80 3479 0.03% 81 4149 0.04% 82 4699 0.04% 83 5093 0.04% 84 6358 0.06% 85 7107 0.06% 86 7342 0.06% 87 7715 0.07% 88 7910 0.07% 89 8385 0.07% 90 8761 0.08% 91 9426 0.08% 92 9928 0.09% 93 10961 0.10% 94 11592 0.10% 95 12145 0.11% 96 12188 0.11% 97 12817 0.11% 98 12754 0.11% 99 13136 0.11% 100 14181 0.12% 101 14320 0.12% 102 15350 0.13% 103 15756 0.14% 104 16300 0.14% 105 16928 0.15% 106 17655 0.15% 107 17921 0.16% 108 17931 0.16% 109 18678 0.16% 110 19036 0.17% 111 19205 0.17% 112 19811 0.17% 113 20685 0.18% 114 21247 0.18% 115 21940 0.19% 116 22454 0.19% 117 22532 0.20% 118 23256 0.20% 119 23538 0.20% 120 23991 0.21% 121 24189 0.21% 122 24989 0.22% 123 25741 0.22% 124 26779 0.23% 125 27047 0.23% 126 28374 0.25% 127 28875 0.25% 128 29771 0.26% 129 30773 0.27% 130 31927 0.28% 131 32513 0.28% 132 33977 0.29% 133 35456 0.31% 134 37592 0.33% 135 40122 0.35% 136 42856 0.37% 137 45622 0.40% 138 49378 0.43% 139 53129 0.46% 140 58347 0.51% 141 65711 0.57% 142 74572 0.65% 143 88057 0.76% 144 105227 0.91% 145 130405 1.13% 146 169364 1.47% 147 238057 2.07% 148 374979 3.25% 149 749694 6.51% 150 3069357 26.64% 151 5135966 44.58% 11520354 reads passed initial QC criterion=sequence-density sequence-density=0.92 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=29 prefix-density=0.92 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=31 fanout-score=29.60 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=7.0 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.85 sequence-density-rank=1 fanout-score=2.51 fanout-score-rank=23 prefix-density=0.91 prefix-fanout=2.3 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=17.75 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170452 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:30 Started mapping on | Feb 12 20:38:31 Finished on | Feb 12 20:40:15 Mapping speed, Million of reads per hour | 398.78 Number of input reads | 11520354 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10466017 Uniquely mapped reads % | 90.85% Average mapped length | 291.84 Number of splices: Total | 9739916 Number of splices: Annotated (sjdb) | 9498455 Number of splices: GT/AG | 9553946 Number of splices: GC/AG | 144093 Number of splices: AT/AC | 6235 Number of splices: Non-canonical | 35642 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.68 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 329815 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 30266 % of reads mapped to too many loci | 0.26% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.97% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 737773 737773 737773 N_multimapping 329815 329815 329815 N_noFeature 339097 10233269 407545 N_ambiguous 260493 983 95763 UnstrandedReadsAssigned:9866427 PositiveStrandReadsAssigned:231765 NegativeStrandReadsAssigned:9962709 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170452 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170452-trimmed-pair1.fastq SRR7170452-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,520,354 reads, 9,927,411 reads pseudoaligned [quant] estimated average fragment length: 256.818 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7170452.ke.tsv 34699 SRR7170452.se.tsv 87100 total ==> SRR7170452.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1762.18 1007 45.4052 Potri.005G024800.1.v4.1 1035 779.182 166 16.9276 Potri.004G059700.1.v4.1 961 705.193 7 0.78871 Potri.007G009000.2.v4.1 1416 1160.18 0 0 Potri.003G141000.2.v4.1 2943 2687.18 391 11.5613 Potri.016G087400.1.v4.1 270 81.672 775 753.972 Potri.015G069301.1.v4.1 564 312.034 0 0 Potri.010G195200.1.v4.1 1773 1517.18 76 3.98018 Potri.012G127500.1.v4.1 977 721.188 355 39.1118 ==> SRR7170452.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 315 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 264 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 56 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170452 completed mapping pipeline successfully