Starting /dee2/code/volunteer_pipeline.sh SRR7170453 current disk space = 3050859282432 free memory = 1515765144 SRR7170453 SRAfilesize d95b3d0e6fbcf20489c2b0c844b935fe SRR7170453.sra SRR7170453.sra file validated SRR7170453 is paired end SRR7170453 is conventional basespace SRR7170453 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170453_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.1405 18.0 18.0 18.0 18.0 32.0 2 25.77475 27.0 25.0 28.0 18.0 30.0 3 27.31 29.0 25.0 30.0 18.0 31.0 4 30.6035 31.0 29.0 33.0 27.0 33.0 5 31.74025 33.0 32.0 33.0 30.0 33.0 6 35.905 37.0 36.0 38.0 33.0 38.0 7 36.96125 38.0 37.0 38.0 35.0 38.0 8 37.36025 38.0 38.0 38.0 36.0 38.0 9 37.47975 38.0 38.0 38.0 37.0 38.0 10-14 37.5437 38.0 38.0 38.0 37.2 38.0 15-19 37.584849999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.658249999999995 38.0 38.0 38.0 38.0 38.0 25-29 37.595299999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.56660000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.574200000000005 38.0 38.0 38.0 38.0 38.0 40-44 37.52175 38.0 38.0 38.0 37.6 38.0 45-49 37.50335 38.0 38.0 38.0 37.2 38.0 50-54 37.38275 38.0 38.0 38.0 37.0 38.0 55-59 37.282599999999995 38.0 38.0 38.0 36.4 38.0 60-64 37.22315 38.0 38.0 38.0 36.0 38.0 65-69 37.16455 38.0 38.0 38.0 36.0 38.0 70-74 37.078950000000006 38.0 38.0 38.0 35.8 38.0 75-79 36.93285 38.0 38.0 38.0 35.2 38.0 80-84 36.85875 38.0 38.0 38.0 35.2 38.0 85-89 36.742200000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.696799999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.59405 38.0 38.0 38.0 34.0 38.0 100-104 36.2928 38.0 37.4 38.0 33.4 38.0 105-109 36.22025 38.0 37.0 38.0 33.4 38.0 110-114 36.023 38.0 37.0 38.0 32.8 38.0 115-119 35.67505 38.0 36.2 38.0 31.0 38.0 120-124 35.5764 38.0 36.0 38.0 31.0 38.0 125-129 35.22085 38.0 35.8 38.0 29.8 38.0 130-134 34.8786 38.0 34.8 38.0 28.2 38.0 135-139 34.42095 38.0 33.4 38.0 27.0 38.0 140-144 33.692750000000004 38.0 33.0 38.0 23.0 38.0 145-149 32.67435 38.0 33.0 38.0 17.8 38.0 150-151 26.878625 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 2.0 15 2.0 16 2.0 17 0.0 18 0.0 19 3.0 20 3.0 21 4.0 22 2.0 23 2.0 24 8.0 25 12.0 26 9.0 27 10.0 28 18.0 29 31.0 30 38.0 31 45.0 32 78.0 33 121.0 34 238.0 35 507.0 36 1319.0 37 1544.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.729701414353062 30.172865374541647 8.87899423782085 37.21843897328444 2 20.95 15.2 36.325 27.525 3 18.825 20.9 25.874999999999996 34.4 4 22.05 29.075 23.0 25.874999999999996 5 22.175 33.75 25.0 19.075 6 19.875 35.55 23.799999999999997 20.775 7 14.2 26.5 42.375 16.925 8 17.2 25.025 31.75 26.025 9 16.175 24.224999999999998 34.375 25.224999999999998 10-14 18.970000000000002 30.240000000000002 27.465 23.325000000000003 15-19 19.66 28.535 28.175 23.630000000000003 20-24 19.345000000000002 28.9 28.355000000000004 23.400000000000002 25-29 19.33 29.555 27.224999999999998 23.89 30-34 19.851985198519852 29.0979097909791 27.917791779177918 23.13231323132313 35-39 19.621962196219624 28.782878287828783 28.107810781078108 23.487348734873486 40-44 19.89 29.205 27.950000000000003 22.955000000000002 45-49 19.415 28.845 27.435 24.305 50-54 19.24 29.065 27.595 24.099999999999998 55-59 19.759999999999998 29.035 28.09 23.115 60-64 19.72 28.235 27.905 24.14 65-69 20.119999999999997 29.285 27.18 23.415 70-74 19.42 29.385 27.515 23.68 75-79 19.408881776355273 29.385877175435088 27.575515103020603 23.629725945189037 80-84 19.913982796559313 28.735747149429887 27.515503100620126 23.83476695339068 85-89 20.185 29.09 27.334999999999997 23.39 90-94 20.630000000000003 28.215 27.725 23.43 95-99 19.61 28.615000000000002 27.68 24.095 100-104 20.369999999999997 29.335 26.8 23.494999999999997 105-109 20.61 28.535 27.105 23.75 110-114 20.535 28.64 27.61 23.215 115-119 20.335 28.575 27.224999999999998 23.865 120-124 19.785 29.175 27.36 23.68 125-129 19.759999999999998 28.720000000000002 27.525 23.995 130-134 20.445 28.24 27.68 23.635 135-139 20.330000000000002 28.32 27.715 23.635 140-144 20.52 28.285 27.345000000000002 23.849999999999998 145-149 20.145 28.83 27.315 23.71 150-151 19.675 29.3875 26.174999999999997 24.762500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 1.5 21 1.5 22 0.0 23 1.5 24 3.5 25 4.0 26 5.5 27 7.5 28 11.5 29 20.0 30 27.0 31 36.0 32 36.0 33 52.5 34 81.5 35 91.0 36 102.5 37 120.5 38 142.0 39 163.0 40 182.5 41 213.5 42 242.0 43 252.5 44 257.5 45 274.5 46 274.0 47 251.5 48 223.0 49 194.0 50 172.0 51 136.0 52 104.0 53 81.5 54 65.0 55 51.0 56 36.5 57 24.0 58 12.5 59 7.5 60 10.0 61 10.0 62 5.5 63 3.5 64 1.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54762503141494 99.02499999999999 2 0.4021110831867303 0.8 3 0.025131942699170642 0.075 4 0.025131942699170642 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.4875 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9375 0.0 0.0 0.0 0.0 112-113 2.1624999999999996 0.0 0.0 0.0 0.0 114-115 2.55 0.0 0.0 0.0 0.0 116-117 2.8125 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5125 0.0 0.0 0.0 0.0 122-123 3.7750000000000004 0.0 0.0 0.0 0.0 124-125 4.0875 0.0 0.0 0.0 0.0 126-127 4.3125 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 4.825 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.45 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 5.875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTTA 10 0.006836113 144.9625 6 TATTTAA 10 0.006836113 144.9625 7 >>END_MODULE SRR7170453 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170453_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92 33.0 33.0 34.0 32.0 34.0 2 33.05725 34.0 33.0 34.0 32.0 34.0 3 33.15125 34.0 33.0 34.0 33.0 34.0 4 33.01375 34.0 33.0 34.0 32.0 34.0 5 33.04025 34.0 33.0 34.0 33.0 34.0 6 37.27225 38.0 38.0 38.0 37.0 38.0 7 37.2995 38.0 38.0 38.0 37.0 38.0 8 37.375 38.0 38.0 38.0 37.0 38.0 9 37.3635 38.0 38.0 38.0 37.0 38.0 10-14 37.38485 38.0 38.0 38.0 37.2 38.0 15-19 37.3398 38.0 38.0 38.0 37.2 38.0 20-24 37.32770000000001 38.0 38.0 38.0 37.0 38.0 25-29 37.247 38.0 38.0 38.0 37.0 38.0 30-34 37.171949999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.19834999999999 38.0 38.0 38.0 37.0 38.0 40-44 37.201499999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.189800000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.18384999999999 38.0 38.0 38.0 37.0 38.0 55-59 37.0941 38.0 38.0 38.0 36.8 38.0 60-64 37.04415 38.0 38.0 38.0 36.2 38.0 65-69 37.01129999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.97425 38.0 38.0 38.0 36.0 38.0 75-79 36.904450000000004 38.0 38.0 38.0 35.8 38.0 80-84 36.79495 38.0 38.0 38.0 35.8 38.0 85-89 36.74805 38.0 38.0 38.0 35.2 38.0 90-94 36.5559 38.0 38.0 38.0 35.0 38.0 95-99 36.52485 38.0 38.0 38.0 34.4 38.0 100-104 36.4188 38.0 38.0 38.0 34.0 38.0 105-109 36.296299999999995 38.0 37.8 38.0 34.0 38.0 110-114 36.01005 38.0 37.2 38.0 33.2 38.0 115-119 35.813900000000004 38.0 37.0 38.0 32.0 38.0 120-124 35.54185 38.0 36.6 38.0 31.4 38.0 125-129 35.13935 38.0 36.0 38.0 29.8 38.0 130-134 34.48505 38.0 34.2 38.0 27.0 38.0 135-139 33.59955 38.0 33.0 38.0 22.4 38.0 140-144 33.1036 38.0 33.0 38.0 19.2 38.0 145-149 32.0291 38.0 33.0 38.0 10.8 38.0 150-151 26.028624999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 2.0 4 2.0 5 4.0 6 4.0 7 1.0 8 2.0 9 1.0 10 0.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 1.0 17 3.0 18 3.0 19 5.0 20 7.0 21 4.0 22 8.0 23 5.0 24 12.0 25 14.0 26 18.0 27 23.0 28 22.0 29 28.0 30 38.0 31 52.0 32 55.0 33 105.0 34 180.0 35 315.0 36 871.0 37 2206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.86086086086086 21.096096096096094 14.914914914914915 28.128128128128125 2 26.326326326326328 26.176176176176174 31.38138138138138 16.116116116116117 3 19.76976976976977 28.178178178178175 33.08308308308308 18.96896896896897 4 23.4984984984985 33.533533533533536 24.44944944944945 18.51851851851852 5 22.972972972972975 36.211211211211214 23.373373373373376 17.442442442442445 6 19.775000000000002 40.025 23.425 16.775000000000002 7 20.625 20.974999999999998 38.05 20.349999999999998 8 21.175 26.625 28.000000000000004 24.2 9 21.375 24.45 30.375000000000004 23.799999999999997 10-14 22.925 29.459999999999997 26.935 20.68 15-19 22.845 28.060000000000002 28.52 20.575 20-24 22.793419012851928 27.944191628744314 28.52427864179627 20.73811071660749 25-29 23.058446757405925 28.527822257806246 28.0724579663731 20.341273018414732 30-34 23.24824824824825 27.887887887887885 28.803803803803802 20.06006006006006 35-39 22.77549794815334 28.59073165849264 27.855069562606342 20.778700830747674 40-44 23.173173173173172 27.86786786786787 28.623623623623622 20.335335335335337 45-49 23.713042173195255 27.640202111161138 28.40562309270099 20.24113262294262 50-54 23.20276151883536 27.500125068787835 28.045424983741057 21.251688428635752 55-59 23.199279711884753 27.81112444977991 28.51640656262505 20.473189275710286 60-64 22.77366419851911 27.476485891534917 28.85731438863318 20.892535521312787 65-69 23.65865865865866 27.72772772772773 27.962962962962962 20.65065065065065 70-74 22.98798798798799 27.98798798798799 27.932932932932935 21.09109109109109 75-79 23.41841841841842 27.027027027027028 28.51851851851852 21.036036036036034 80-84 23.33833833833834 27.54254254254254 28.24824824824825 20.87087087087087 85-89 23.6986986986987 27.44744744744745 28.223223223223222 20.63063063063063 90-94 23.123123123123122 28.153153153153156 27.677677677677675 21.046046046046047 95-99 23.20820820820821 28.203203203203202 27.87787787787788 20.71071071071071 100-104 23.403403403403402 27.94794794794795 27.967967967967965 20.68068068068068 105-109 23.86886886886887 28.23823823823824 27.45745745745746 20.435435435435437 110-114 24.024024024024023 27.3973973973974 28.218218218218215 20.36036036036036 115-119 24.234234234234233 27.442442442442445 28.02802802802803 20.295295295295297 120-124 24.1991991991992 28.07807807807808 27.572572572572575 20.15015015015015 125-129 23.806186805486035 27.840624687155874 27.83061367504255 20.522574832315545 130-134 24.015018773466835 27.804755944931163 28.010012515644554 20.170212765957444 135-139 24.862348583441786 27.63539893883272 27.94574031434578 19.55651216337972 140-144 24.683385893777846 27.751914701907193 27.646793812884816 19.917905591430145 145-149 24.434434434434436 27.352352352352355 28.298298298298295 19.914914914914917 150-151 25.13763763763764 27.43993993993994 28.290790790790794 19.13163163163163 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.5 9 1.0 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 1.0 17 1.0 18 0.5 19 1.5 20 1.0 21 1.0 22 2.5 23 1.5 24 1.0 25 3.0 26 2.5 27 5.5 28 10.5 29 11.5 30 16.0 31 23.5 32 31.5 33 39.0 34 48.0 35 73.0 36 86.5 37 105.5 38 136.0 39 167.0 40 201.5 41 226.5 42 254.0 43 277.5 44 288.0 45 283.0 46 270.5 47 242.0 48 216.5 49 203.5 50 176.0 51 133.5 52 110.5 53 100.0 54 76.0 55 52.5 56 38.0 57 27.5 58 18.0 59 12.5 60 8.0 61 3.5 62 1.5 63 1.5 64 1.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.015 25-29 0.08 30-34 0.1 35-39 0.09 40-44 0.1 45-49 0.055 50-54 0.055 55-59 0.04 60-64 0.06 65-69 0.1 70-74 0.1 75-79 0.1 80-84 0.1 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.11 130-134 0.125 135-139 0.11 140-144 0.11499999999999999 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.36948297604036 98.5 2 0.5548549810844893 1.0999999999999999 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.0 0.0 6 0.025220680958385876 0.15 7 0.025220680958385876 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.3625 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8125 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.1875 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5125 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 3.1875 0.0 0.0 0.0 0.0 120-121 3.4625000000000004 0.0 0.0 0.0 0.0 122-123 3.7249999999999996 0.0 0.0 0.0 0.0 124-125 4.05 0.0 0.0 0.0 0.0 126-127 4.2875 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.325 0.0 0.0 0.0 0.0 136-137 5.525 0.0 0.0 0.0 0.0 138-139 5.737500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATCTGG 10 0.006830828 145.0 4 CTCTTGT 10 0.006830828 145.0 1 TCATCTG 10 0.006830828 145.0 3 >>END_MODULE Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704792 spots for SRR7170453.sra Written 704792 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra Read 704787 spots for SRR7170453.sra Written 704787 spots for SRR7170453.sra SRR ids: ['SRR7170453.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_at82rm4l SRR7170453.sra spots: 14095745 blocks: [[1, 704787], [704788, 1409574], [1409575, 2114361], [2114362, 2819148], [2819149, 3523935], [3523936, 4228722], [4228723, 4933509], [4933510, 5638296], [5638297, 6343083], [6343084, 7047870], [7047871, 7752657], [7752658, 8457444], [8457445, 9162231], [9162232, 9867018], [9867019, 10571805], [10571806, 11276592], [11276593, 11981379], [11981380, 12686166], [12686167, 13390953], [13390954, 14095745]] SRR7170453 file size 4754885 SRR7170453 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170453 SRR7170453_1.fastq SRR7170453_2.fastq Input file: SRR7170453_1.fastq Paired file: SRR7170453_2.fastq trimmed: SRR7170453-trimmed-pair1.fastq, SRR7170453-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:00 2025 >> started Wed Feb 12 20:37:18 2025 >> done (17.745s) 14095745 read pairs processed; of these: 13370 ( 0.09%) short read pairs filtered out after trimming by size control 20464 ( 0.15%) empty read pairs filtered out after trimming by size control 14061911 (99.76%) read pairs available; of these: 8964750 (63.75%) trimmed read pairs available after processing 5097161 (36.25%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 2 0.00% 24 6 0.00% 25 2 0.00% 26 3 0.00% 27 3 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 13 0.00% 32 10 0.00% 33 8 0.00% 34 16 0.00% 35 15 0.00% 36 26 0.00% 37 23 0.00% 38 41 0.00% 39 36 0.00% 40 40 0.00% 41 53 0.00% 42 56 0.00% 43 65 0.00% 44 71 0.00% 45 67 0.00% 46 72 0.00% 47 93 0.00% 48 131 0.00% 49 124 0.00% 50 158 0.00% 51 221 0.00% 52 204 0.00% 53 250 0.00% 54 239 0.00% 55 276 0.00% 56 314 0.00% 57 329 0.00% 58 404 0.00% 59 447 0.00% 60 522 0.00% 61 616 0.00% 62 611 0.00% 63 773 0.01% 64 906 0.01% 65 859 0.01% 66 884 0.01% 67 1063 0.01% 68 1096 0.01% 69 1305 0.01% 70 1418 0.01% 71 1628 0.01% 72 1851 0.01% 73 2068 0.01% 74 2453 0.02% 75 2582 0.02% 76 2868 0.02% 77 3072 0.02% 78 3308 0.02% 79 3576 0.03% 80 4023 0.03% 81 4328 0.03% 82 4816 0.03% 83 5574 0.04% 84 6674 0.05% 85 7024 0.05% 86 7260 0.05% 87 7554 0.05% 88 7833 0.06% 89 8187 0.06% 90 8911 0.06% 91 9422 0.07% 92 10049 0.07% 93 10945 0.08% 94 11707 0.08% 95 12221 0.09% 96 12712 0.09% 97 13329 0.09% 98 13578 0.10% 99 13836 0.10% 100 14657 0.10% 101 14810 0.11% 102 15778 0.11% 103 16901 0.12% 104 17610 0.13% 105 18228 0.13% 106 18699 0.13% 107 19144 0.14% 108 19230 0.14% 109 19988 0.14% 110 20322 0.14% 111 20645 0.15% 112 21359 0.15% 113 22208 0.16% 114 22816 0.16% 115 23984 0.17% 116 24429 0.17% 117 24936 0.18% 118 25872 0.18% 119 25983 0.18% 120 26642 0.19% 121 27495 0.20% 122 28422 0.20% 123 29756 0.21% 124 31116 0.22% 125 32487 0.23% 126 34169 0.24% 127 35250 0.25% 128 37090 0.26% 129 38559 0.27% 130 40694 0.29% 131 42350 0.30% 132 46429 0.33% 133 48902 0.35% 134 52422 0.37% 135 56364 0.40% 136 61700 0.44% 137 67521 0.48% 138 73849 0.53% 139 81024 0.58% 140 91007 0.65% 141 105167 0.75% 142 120788 0.86% 143 142246 1.01% 144 173940 1.24% 145 217410 1.55% 146 289031 2.06% 147 414170 2.95% 148 646275 4.60% 149 1237206 8.80% 150 4010389 28.52% 151 5097161 36.25% 14061911 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.29 fanout-score-rank=17 prefix-density=0.41 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.03 sequence-density-rank=28 fanout-score=43.21 fanout-score-rank=1 prefix-density=0.13 prefix-fanout=8.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGTTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGGGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.32 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=22 prefix-density=0.32 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.07 sequence-density-rank=23 fanout-score=36.85 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=10.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170453 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:05 Started mapping on | Feb 12 20:38:06 Finished on | Feb 12 20:40:09 Mapping speed, Million of reads per hour | 411.57 Number of input reads | 14061911 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13197569 Uniquely mapped reads % | 93.85% Average mapped length | 291.72 Number of splices: Total | 12778752 Number of splices: Annotated (sjdb) | 12461488 Number of splices: GT/AG | 12543239 Number of splices: GC/AG | 187338 Number of splices: AT/AC | 7359 Number of splices: Non-canonical | 40816 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.78 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371257 % of reads mapped to multiple loci | 2.64% Number of reads mapped to too many loci | 18000 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 501822 501822 501822 N_multimapping 371257 371257 371257 N_noFeature 528631 12944446 605657 N_ambiguous 283797 1133 107063 UnstrandedReadsAssigned:12385141 PositiveStrandReadsAssigned:251990 NegativeStrandReadsAssigned:12484849 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170453 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170453-trimmed-pair1.fastq SRR7170453-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,061,911 reads, 12,398,841 reads pseudoaligned [quant] estimated average fragment length: 267.042 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7170453.ke.tsv 34699 SRR7170453.se.tsv 87100 total ==> SRR7170453.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1751.96 1049 42.7213 Potri.005G024800.1.v4.1 1035 768.958 221 20.5061 Potri.004G059700.1.v4.1 961 694.974 4 0.410662 Potri.007G009000.2.v4.1 1416 1149.96 0 0 Potri.003G141000.2.v4.1 2943 2676.96 626.716 16.7041 Potri.016G087400.1.v4.1 270 80.7295 709.964 627.476 Potri.015G069301.1.v4.1 564 303.322 0 0 Potri.010G195200.1.v4.1 1773 1506.96 129 6.10775 Potri.012G127500.1.v4.1 977 710.974 78 7.82769 ==> SRR7170453.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 409 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 262 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 108 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170453 completed mapping pipeline successfully