Starting /dee2/code/volunteer_pipeline.sh SRR7170454 current disk space = 3050867048448 free memory = 1580484124 SRR7170454 SRAfilesize 2c5e6aab7dfe701cfa6ad5600cf423bc SRR7170454.sra SRR7170454.sra file validated SRR7170454 is paired end SRR7170454 is conventional basespace SRR7170454 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170454_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.0045 18.0 18.0 18.0 18.0 28.0 2 25.49225 27.0 25.0 28.0 18.0 30.0 3 26.105 27.0 25.0 29.0 18.0 31.0 4 30.168 31.0 29.0 31.0 27.0 33.0 5 31.7975 33.0 32.0 33.0 30.0 33.0 6 35.6085 37.0 35.0 38.0 31.0 38.0 7 36.77625 38.0 37.0 38.0 34.0 38.0 8 37.33575 38.0 38.0 38.0 36.0 38.0 9 37.38075 38.0 38.0 38.0 37.0 38.0 10-14 37.4822 38.0 38.0 38.0 36.8 38.0 15-19 37.53295000000001 38.0 38.0 38.0 37.2 38.0 20-24 37.6476 38.0 38.0 38.0 38.0 38.0 25-29 37.58255 38.0 38.0 38.0 38.0 38.0 30-34 37.58205 38.0 38.0 38.0 38.0 38.0 35-39 37.4781 38.0 38.0 38.0 37.2 38.0 40-44 37.4885 38.0 38.0 38.0 37.2 38.0 45-49 37.31909999999999 38.0 38.0 38.0 36.8 38.0 50-54 37.267999999999994 38.0 38.0 38.0 36.6 38.0 55-59 37.094049999999996 38.0 38.0 38.0 35.8 38.0 60-64 37.1061 38.0 38.0 38.0 35.8 38.0 65-69 36.9816 38.0 38.0 38.0 35.4 38.0 70-74 36.90220000000001 38.0 38.0 38.0 35.0 38.0 75-79 36.6541 38.0 37.8 38.0 34.4 38.0 80-84 36.44825 38.0 37.6 38.0 34.0 38.0 85-89 36.3713 38.0 37.0 38.0 33.6 38.0 90-94 36.255700000000004 38.0 37.0 38.0 33.4 38.0 95-99 35.769400000000005 38.0 36.6 38.0 31.4 38.0 100-104 36.04935 38.0 37.0 38.0 33.0 38.0 105-109 35.7084 38.0 36.4 38.0 31.0 38.0 110-114 35.39905 38.0 35.8 38.0 29.4 38.0 115-119 34.91 38.0 35.2 38.0 27.6 38.0 120-124 34.6414 38.0 34.8 38.0 26.8 38.0 125-129 34.1374 38.0 34.0 38.0 23.8 38.0 130-134 33.0423 37.4 32.0 38.0 16.6 38.0 135-139 32.34054999999999 36.2 31.0 38.0 16.2 38.0 140-144 31.202549999999995 36.0 29.8 38.0 13.0 38.0 145-149 30.07715 36.0 28.2 38.0 6.2 38.0 150-151 24.19125 31.5 13.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 2.0 16 0.0 17 0.0 18 2.0 19 4.0 20 4.0 21 4.0 22 6.0 23 16.0 24 16.0 25 9.0 26 16.0 27 31.0 28 37.0 29 53.0 30 45.0 31 85.0 32 118.0 33 186.0 34 337.0 35 685.0 36 1442.0 37 900.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 13.430504945340967 52.420614263404474 6.376887038001041 27.771993753253515 2 19.950000000000003 16.0 36.95 27.1 3 19.375 21.675 26.700000000000003 32.25 4 24.2 28.499999999999996 22.75 24.55 5 21.85 34.325 24.075 19.75 6 19.575 34.975 25.474999999999998 19.975 7 14.274999999999999 26.025 41.85 17.849999999999998 8 18.125 25.1 30.3 26.474999999999998 9 17.1 24.275 34.65 23.974999999999998 10-14 20.02 29.42 27.26 23.3 15-19 19.55 28.144999999999996 28.15 24.154999999999998 20-24 19.88 28.49 27.88 23.75 25-29 19.43 28.910000000000004 28.075 23.585 30-34 19.38 29.705 27.650000000000002 23.265 35-39 19.63 28.73 28.63 23.01 40-44 20.115 28.815 27.61 23.46 45-49 19.875 28.42 27.950000000000003 23.755000000000003 50-54 19.68 28.915000000000003 27.500000000000004 23.905 55-59 19.665 28.945 28.04 23.35 60-64 20.055 28.22 28.349999999999998 23.375 65-69 19.805 28.610000000000003 27.99 23.595 70-74 19.994999999999997 28.470000000000002 27.500000000000004 24.035 75-79 20.405 28.110000000000003 27.905 23.580000000000002 80-84 20.175 28.794999999999998 27.634999999999998 23.395 85-89 20.155 28.494999999999997 27.634999999999998 23.715 90-94 20.165 28.525 27.63 23.68 95-99 20.044999999999998 28.405 28.084999999999997 23.465 100-104 19.900000000000002 28.51 27.634999999999998 23.955000000000002 105-109 19.835 28.144999999999996 28.384999999999998 23.635 110-114 20.395 28.52 28.115000000000002 22.97 115-119 20.474999999999998 28.689999999999998 27.775 23.06 120-124 20.18 27.88 28.134999999999998 23.805 125-129 21.025 27.67 27.82 23.485 130-134 19.985 28.59 27.57 23.855 135-139 21.235 28.044999999999998 27.96 22.759999999999998 140-144 20.31 28.294999999999998 27.815 23.580000000000002 145-149 20.25 28.349999999999998 27.58 23.82 150-151 20.775 28.8625 27.5125 22.85 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.0 24 2.0 25 2.0 26 4.5 27 12.0 28 14.0 29 14.5 30 21.0 31 23.0 32 33.5 33 56.0 34 67.5 35 76.5 36 104.5 37 131.5 38 159.5 39 181.5 40 191.0 41 225.0 42 259.0 43 266.0 44 270.0 45 269.0 46 266.5 47 259.0 48 221.0 49 184.0 50 162.5 51 125.0 52 94.5 53 81.0 54 62.0 55 42.5 56 32.0 57 25.0 58 15.5 59 9.5 60 10.0 61 9.0 62 3.5 63 1.0 64 0.0 65 0.5 66 0.5 67 2.0 68 2.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49748743718592 99.0 2 0.5025125628140703 1.0 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7124999999999999 0.0 0.0 0.0 0.0 100-101 0.725 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.725 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.7875 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.25 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.8125 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 4.9125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170454 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170454_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05275 33.0 33.0 34.0 32.0 34.0 2 33.1915 34.0 33.0 34.0 33.0 34.0 3 33.16775 34.0 33.0 34.0 33.0 34.0 4 33.1665 34.0 33.0 34.0 33.0 34.0 5 33.2095 34.0 33.0 34.0 33.0 34.0 6 37.43925 38.0 38.0 38.0 38.0 38.0 7 37.48575 38.0 38.0 38.0 38.0 38.0 8 37.44075 38.0 38.0 38.0 38.0 38.0 9 37.47525 38.0 38.0 38.0 38.0 38.0 10-14 37.44045 38.0 38.0 38.0 38.0 38.0 15-19 37.3929 38.0 38.0 38.0 37.6 38.0 20-24 37.401300000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.378699999999995 38.0 38.0 38.0 37.8 38.0 30-34 37.34075 38.0 38.0 38.0 37.2 38.0 35-39 37.3154 38.0 38.0 38.0 37.4 38.0 40-44 37.29775 38.0 38.0 38.0 37.0 38.0 45-49 37.257400000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.237300000000005 38.0 38.0 38.0 37.0 38.0 55-59 37.1947 38.0 38.0 38.0 37.0 38.0 60-64 37.19185 38.0 38.0 38.0 37.0 38.0 65-69 37.1214 38.0 38.0 38.0 37.0 38.0 70-74 36.99265 38.0 38.0 38.0 36.0 38.0 75-79 36.998549999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.89295 38.0 38.0 38.0 36.0 38.0 85-89 36.86895 38.0 38.0 38.0 36.0 38.0 90-94 36.7688 38.0 38.0 38.0 35.4 38.0 95-99 36.60615 38.0 38.0 38.0 34.6 38.0 100-104 36.5145 38.0 38.0 38.0 34.4 38.0 105-109 36.4287 38.0 38.0 38.0 34.0 38.0 110-114 36.25279999999999 38.0 37.6 38.0 33.8 38.0 115-119 36.004999999999995 38.0 37.0 38.0 33.2 38.0 120-124 35.6849 38.0 36.6 38.0 31.4 38.0 125-129 34.93849999999999 38.0 35.6 38.0 28.8 38.0 130-134 34.81695 38.0 35.6 38.0 28.2 38.0 135-139 34.2999 38.0 33.8 38.0 26.4 38.0 140-144 33.71645 38.0 33.0 38.0 22.8 38.0 145-149 32.8626 38.0 33.0 38.0 17.8 38.0 150-151 26.902250000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 6.0 4 2.0 5 0.0 6 0.0 7 1.0 8 0.0 9 1.0 10 0.0 11 0.0 12 2.0 13 0.0 14 3.0 15 0.0 16 2.0 17 0.0 18 5.0 19 5.0 20 4.0 21 6.0 22 3.0 23 7.0 24 6.0 25 13.0 26 15.0 27 16.0 28 25.0 29 17.0 30 37.0 31 37.0 32 48.0 33 95.0 34 157.0 35 276.0 36 862.0 37 2342.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.63863863863864 22.02202202202202 13.138138138138139 26.2012012012012 2 26.176176176176174 26.176176176176174 31.181181181181184 16.466466466466468 3 20.52052052052052 29.154154154154156 30.755755755755754 19.56956956956957 4 22.772772772772772 35.26026026026026 23.473473473473476 18.493493493493492 5 23.998998998999 37.93793793793794 21.82182182182182 16.24124124124124 6 20.860430215107552 38.39419709854928 23.111555777888945 17.63381690845423 7 20.535267633816908 20.060030015007506 39.74487243621811 19.65982991495748 8 20.80520130032508 25.831457864466117 28.157039259814955 25.206301575393848 9 21.50537634408602 24.656164041010253 30.257564391097773 23.58089522380595 10-14 23.03190957287186 29.078723617085128 26.39291787536261 21.496448934680405 15-19 22.760932652857 27.994596217352147 28.75512859001301 20.489342539777844 20-24 22.4024024024024 28.06806806806807 28.3983983983984 21.13113113113113 25-29 22.84784784784785 28.133133133133132 27.872872872872872 21.146146146146148 30-34 22.882882882882882 28.048048048048045 28.463463463463462 20.605605605605607 35-39 22.37737737737738 28.593593593593592 28.753753753753752 20.275275275275277 40-44 22.85785785785786 28.3983983983984 27.797797797797795 20.945945945945947 45-49 22.62262262262262 28.643643643643646 28.428428428428425 20.305305305305303 50-54 22.71271271271271 28.01801801801802 28.353353353353356 20.915915915915917 55-59 22.867867867867865 28.023023023023026 28.283283283283282 20.825825825825824 60-64 22.71771771771772 28.32832832832833 28.403403403403406 20.55055055055055 65-69 23.02802802802803 27.7027027027027 28.463463463463462 20.805805805805804 70-74 23.428428428428425 28.123123123123122 27.892892892892895 20.555555555555554 75-79 22.80780780780781 28.31831831831832 27.772772772772775 21.1011011011011 80-84 22.733870564092296 27.919315281045098 28.164572801441512 21.18224135342109 85-89 23.02802802802803 27.967967967967965 27.522522522522525 21.48148148148148 90-94 23.503503503503502 27.45245245245245 28.183183183183186 20.86086086086086 95-99 22.65265265265265 29.14914914914915 27.67267267267267 20.525525525525527 100-104 24.234234234234233 27.922922922922922 27.482482482482485 20.36036036036036 105-109 23.293293293293292 28.083083083083082 27.927927927927925 20.695695695695697 110-114 22.98798798798799 28.32832832832833 27.5025025025025 21.18118118118118 115-119 23.493493493493496 28.343343343343342 27.53253253253253 20.63063063063063 120-124 23.5096851694279 28.369788277691576 27.904299514490216 20.21622703839031 125-129 23.513215859030836 28.07368842611133 28.233880656788145 20.179215058069683 130-134 23.939924906132664 27.8648310387985 28.185231539424283 20.010012515644558 135-139 24.435544430538172 28.20025031289111 26.753441802252816 20.610763454317897 140-144 23.939924906132664 28.28035043804756 27.88986232790989 19.88986232790989 145-149 24.108930716860232 27.89347216659992 27.462955546655987 20.53464156988386 150-151 24.515079464397445 28.331873357527222 27.230634463771743 19.92241271430359 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.5 4 0.5 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 2.0 21 2.0 22 0.5 23 1.0 24 2.5 25 6.0 26 7.0 27 8.5 28 12.0 29 14.5 30 19.0 31 22.5 32 25.0 33 40.0 34 48.5 35 61.0 36 95.5 37 120.0 38 145.0 39 180.0 40 206.0 41 226.0 42 255.0 43 277.5 44 272.0 45 274.0 46 279.0 47 245.5 48 211.5 49 194.0 50 166.0 51 130.0 52 106.0 53 86.0 54 71.5 55 57.0 56 38.0 57 29.0 58 18.0 59 9.5 60 7.0 61 5.0 62 5.5 63 4.5 64 2.0 65 1.5 66 1.0 67 1.0 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.5 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.05 7 0.05 8 0.025 9 0.025 10-14 0.03 15-19 0.06999999999999999 20-24 0.1 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.1 50-54 0.1 55-59 0.1 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.1 80-84 0.105 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.105 125-129 0.12 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.12 150-151 0.11249999999999999 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42007060010086 98.575 2 0.5042864346949066 1.0 3 0.02521432173474534 0.075 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02521432173474534 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 10 0.25 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.45 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.3375 0.0 0.0 0.0 0.0 110-111 1.5125 0.0 0.0 0.0 0.0 112-113 1.7374999999999998 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.075 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.625 0.0 0.0 0.0 0.0 122-123 2.8125 0.0 0.0 0.0 0.0 124-125 3.0375 0.0 0.0 0.0 0.0 126-127 3.3125 0.0 0.0 0.0 0.0 128-129 3.625 0.0 0.0 0.0 0.0 130-131 3.8875 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.550000000000001 0.0 0.0 0.0 0.0 136-137 4.7625 0.0 0.0 0.0 0.0 138-139 4.987500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGTTGCT 10 0.006830828 145.0 8 >>END_MODULE Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611344 spots for SRR7170454.sra Written 611344 spots for SRR7170454.sra Read 611354 spots for SRR7170454.sra Written 611354 spots for SRR7170454.sra SRR ids: ['SRR7170454.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_g_vfbmh3 SRR7170454.sra spots: 12226890 blocks: [[1, 611344], [611345, 1222688], [1222689, 1834032], [1834033, 2445376], [2445377, 3056720], [3056721, 3668064], [3668065, 4279408], [4279409, 4890752], [4890753, 5502096], [5502097, 6113440], [6113441, 6724784], [6724785, 7336128], [7336129, 7947472], [7947473, 8558816], [8558817, 9170160], [9170161, 9781504], [9781505, 10392848], [10392849, 11004192], [11004193, 11615536], [11615537, 12226890]] SRR7170454 file size 4121591 SRR7170454 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170454 SRR7170454_1.fastq SRR7170454_2.fastq Input file: SRR7170454_1.fastq Paired file: SRR7170454_2.fastq trimmed: SRR7170454-trimmed-pair1.fastq, SRR7170454-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:40:30 2025 >> started Wed Feb 12 20:40:49 2025 >> done (18.393s) 12226890 read pairs processed; of these: 9157 ( 0.07%) short read pairs filtered out after trimming by size control 11766 ( 0.10%) empty read pairs filtered out after trimming by size control 12205967 (99.83%) read pairs available; of these: 8257015 (67.65%) trimmed read pairs available after processing 3948952 (32.35%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 5 0.00% 23 6 0.00% 24 3 0.00% 25 3 0.00% 26 6 0.00% 27 1 0.00% 28 3 0.00% 29 0 0.00% 30 4 0.00% 31 8 0.00% 32 2 0.00% 33 6 0.00% 34 5 0.00% 35 7 0.00% 36 11 0.00% 37 18 0.00% 38 9 0.00% 39 18 0.00% 40 19 0.00% 41 24 0.00% 42 22 0.00% 43 22 0.00% 44 30 0.00% 45 29 0.00% 46 24 0.00% 47 33 0.00% 48 46 0.00% 49 47 0.00% 50 48 0.00% 51 60 0.00% 52 91 0.00% 53 77 0.00% 54 87 0.00% 55 86 0.00% 56 123 0.00% 57 146 0.00% 58 158 0.00% 59 160 0.00% 60 191 0.00% 61 259 0.00% 62 237 0.00% 63 288 0.00% 64 321 0.00% 65 371 0.00% 66 382 0.00% 67 451 0.00% 68 520 0.00% 69 607 0.00% 70 667 0.01% 71 758 0.01% 72 870 0.01% 73 1028 0.01% 74 1063 0.01% 75 1189 0.01% 76 1319 0.01% 77 1471 0.01% 78 1638 0.01% 79 1803 0.01% 80 2020 0.02% 81 2342 0.02% 82 2515 0.02% 83 3124 0.03% 84 3709 0.03% 85 3810 0.03% 86 4124 0.03% 87 4298 0.04% 88 4678 0.04% 89 4789 0.04% 90 5042 0.04% 91 5620 0.05% 92 6079 0.05% 93 6472 0.05% 94 6999 0.06% 95 7428 0.06% 96 7849 0.06% 97 8183 0.07% 98 8597 0.07% 99 9002 0.07% 100 9529 0.08% 101 9943 0.08% 102 10539 0.09% 103 11085 0.09% 104 11447 0.09% 105 12170 0.10% 106 12826 0.11% 107 13052 0.11% 108 13647 0.11% 109 14071 0.12% 110 14060 0.12% 111 14917 0.12% 112 15513 0.13% 113 16064 0.13% 114 17001 0.14% 115 18042 0.15% 116 18842 0.15% 117 19239 0.16% 118 20233 0.17% 119 20876 0.17% 120 21778 0.18% 121 22672 0.19% 122 23711 0.19% 123 24960 0.20% 124 26658 0.22% 125 28059 0.23% 126 29618 0.24% 127 31518 0.26% 128 33471 0.27% 129 35744 0.29% 130 38251 0.31% 131 40641 0.33% 132 44374 0.36% 133 47675 0.39% 134 52697 0.43% 135 57038 0.47% 136 62904 0.52% 137 69289 0.57% 138 76987 0.63% 139 86303 0.71% 140 97664 0.80% 141 110922 0.91% 142 129450 1.06% 143 152961 1.25% 144 187241 1.53% 145 234378 1.92% 146 309096 2.53% 147 429841 3.52% 148 651625 5.34% 149 1189392 9.74% 150 3493431 28.62% 151 3948952 32.35% 12205967 reads passed initial QC criterion=sequence-density sequence-density=0.49 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=12 prefix-density=0.50 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=22 fanout-score=320.83 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=16.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=1.01 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=23 prefix-density=1.00 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=33.22 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=6.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170454 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:41:47 Started mapping on | Feb 12 20:41:47 Finished on | Feb 12 20:43:06 Mapping speed, Million of reads per hour | 556.22 Number of input reads | 12205967 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11494744 Uniquely mapped reads % | 94.17% Average mapped length | 292.34 Number of splices: Total | 11449226 Number of splices: Annotated (sjdb) | 11169707 Number of splices: GT/AG | 11236402 Number of splices: GC/AG | 172489 Number of splices: AT/AC | 6538 Number of splices: Non-canonical | 33797 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 312201 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 7160 % of reads mapped to too many loci | 0.06% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.02% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406551 406551 406551 N_multimapping 312201 312201 312201 N_noFeature 459976 11300602 526360 N_ambiguous 223093 738 95012 UnstrandedReadsAssigned:10811675 PositiveStrandReadsAssigned:193404 NegativeStrandReadsAssigned:10873372 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170454 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170454-trimmed-pair1.fastq SRR7170454-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,205,967 reads, 10,818,171 reads pseudoaligned [quant] estimated average fragment length: 276.112 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,101 rounds 52401 SRR7170454.ke.tsv 34699 SRR7170454.se.tsv 87100 total ==> SRR7170454.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.89 842 41.1426 Potri.005G024800.1.v4.1 1035 759.888 168 18.8282 Potri.004G059700.1.v4.1 961 685.909 7 0.869121 Potri.007G009000.2.v4.1 1416 1140.89 0 0 Potri.003G141000.2.v4.1 2943 2667.89 495 15.8011 Potri.016G087400.1.v4.1 270 75.8573 476.74 535.221 Potri.015G069301.1.v4.1 564 294.804 0 0 Potri.010G195200.1.v4.1 1773 1497.89 57 3.24074 Potri.012G127500.1.v4.1 977 701.904 68 8.2505 ==> SRR7170454.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 309 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 184 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 1 SRR7170454 completed mapping pipeline successfully