Starting /dee2/code/volunteer_pipeline.sh SRR7170455 current disk space = 3050948612096 free memory = 1579820500 SRR7170455 SRAfilesize 0812982c699a7ed9ee11de6ceb3677be SRR7170455.sra SRR7170455.sra file validated SRR7170455 is paired end SRR7170455 is conventional basespace SRR7170455 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170455_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.68775 18.0 18.0 18.0 18.0 30.0 2 28.9335 29.0 27.0 31.0 27.0 31.0 3 30.95225 31.0 30.0 33.0 29.0 33.0 4 32.0325 33.0 31.0 33.0 31.0 33.0 5 32.88525 33.0 33.0 33.0 32.0 34.0 6 37.169 38.0 37.0 38.0 36.0 38.0 7 37.40975 38.0 38.0 38.0 37.0 38.0 8 37.42725 38.0 38.0 38.0 37.0 38.0 9 37.4655 38.0 38.0 38.0 37.0 38.0 10-14 37.556999999999995 38.0 38.0 38.0 37.4 38.0 15-19 37.5884 38.0 38.0 38.0 37.8 38.0 20-24 37.24855 38.0 38.0 38.0 36.4 38.0 25-29 36.669050000000006 38.0 37.8 38.0 34.2 38.0 30-34 37.3214 38.0 38.0 38.0 36.6 38.0 35-39 37.389799999999994 38.0 38.0 38.0 37.0 38.0 40-44 36.75134999999999 38.0 37.8 38.0 34.6 38.0 45-49 34.66395 37.8 34.0 38.0 24.8 38.0 50-54 36.940349999999995 38.0 37.8 38.0 35.4 38.0 55-59 37.0914 38.0 38.0 38.0 36.0 38.0 60-64 36.9342 38.0 38.0 38.0 35.6 38.0 65-69 36.87765 38.0 38.0 38.0 35.0 38.0 70-74 36.896699999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.73805 38.0 38.0 38.0 34.4 38.0 80-84 36.641099999999994 38.0 38.0 38.0 34.0 38.0 85-89 36.2564 38.0 37.0 38.0 33.6 38.0 90-94 36.09910000000001 38.0 37.0 38.0 32.6 38.0 95-99 36.24875 38.0 37.0 38.0 33.6 38.0 100-104 36.18044999999999 38.0 37.0 38.0 33.4 38.0 105-109 36.03215 38.0 37.0 38.0 32.8 38.0 110-114 35.5413 38.0 36.2 38.0 30.2 38.0 115-119 35.14445 38.0 35.4 38.0 28.8 38.0 120-124 34.9506 38.0 35.0 38.0 27.8 38.0 125-129 34.88869999999999 38.0 35.0 38.0 27.6 38.0 130-134 34.588300000000004 38.0 34.8 38.0 27.0 38.0 135-139 33.62675 38.0 33.2 38.0 22.2 38.0 140-144 28.289949999999997 32.6 23.0 37.0 9.0 38.0 145-149 25.08895 31.0 12.4 36.8 2.0 38.0 150-151 15.634374999999999 7.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 1.0 15 1.0 16 1.0 17 2.0 18 3.0 19 6.0 20 0.0 21 9.0 22 6.0 23 6.0 24 8.0 25 21.0 26 24.0 27 27.0 28 48.0 29 54.0 30 59.0 31 91.0 32 135.0 33 235.0 34 451.0 35 849.0 36 1418.0 37 544.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.00408267415157 11.252870630262821 15.386578208726718 37.35646848685889 2 20.895895895895897 15.765765765765765 35.26026026026026 28.07807807807808 3 19.075 19.75 27.125 34.050000000000004 4 21.4 28.299999999999997 23.95 26.35 5 22.15 34.2 23.425 20.225 6 19.225 35.65 24.85 20.275000000000002 7 14.549999999999999 25.35 41.475 18.625 8 15.775 27.025 30.975 26.224999999999998 9 16.775000000000002 24.8 33.2 25.224999999999998 10-14 19.39 30.25 27.515 22.845 15-19 19.335 29.03 27.77 23.865 20-24 19.755 28.585 27.935 23.724999999999998 25-29 19.470000000000002 28.82 28.310000000000002 23.400000000000002 30-34 19.134999999999998 29.14 27.555000000000003 24.169999999999998 35-39 19.765 28.860000000000003 27.85 23.525 40-44 19.77 28.754999999999995 28.34 23.135 45-49 19.34 29.215000000000003 27.415 24.03 50-54 19.634999999999998 29.104999999999997 28.110000000000003 23.150000000000002 55-59 19.435 28.99 28.33 23.244999999999997 60-64 20.415 28.485 27.935 23.165 65-69 19.645000000000003 28.675 27.700000000000003 23.98 70-74 19.410970548527427 28.521426071303562 28.001400070003502 24.066203310165506 75-79 19.830000000000002 28.92 27.765 23.485 80-84 19.875 28.76 27.62 23.745 85-89 19.73 28.375 28.03 23.865 90-94 20.192019201920193 29.062906290629066 27.2977297729773 23.447344734473447 95-99 20.46102305115256 28.41142057102855 27.971398569928496 23.156157807890395 100-104 20.349999999999998 29.099999999999998 27.49 23.06 105-109 19.98 28.235 28.050000000000004 23.735 110-114 20.27 28.410000000000004 28.275 23.044999999999998 115-119 20.465 28.23 27.72 23.585 120-124 19.845 28.544999999999998 27.82 23.79 125-129 19.89 28.235 27.825 24.05 130-134 20.18 28.65 28.305000000000003 22.865 135-139 20.59 27.900000000000002 27.63 23.880000000000003 140-144 20.28 28.675 26.945000000000004 24.099999999999998 145-149 20.43 28.405 27.41 23.755000000000003 150-151 19.7375 28.487499999999997 28.4 23.375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.0 22 1.0 23 1.0 24 2.5 25 6.0 26 7.5 27 10.5 28 11.0 29 12.0 30 20.5 31 26.0 32 36.5 33 57.0 34 66.5 35 77.0 36 93.5 37 114.5 38 144.5 39 169.5 40 203.0 41 231.0 42 254.5 43 285.0 44 275.5 45 250.5 46 256.5 47 245.5 48 217.5 49 183.0 50 146.0 51 131.0 52 103.5 53 87.5 54 79.5 55 53.0 56 39.0 57 30.5 58 22.0 59 14.5 60 10.0 61 6.5 62 3.5 63 2.5 64 1.0 65 2.0 66 1.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.025 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.005 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.35149384885764495 0.7000000000000001 3 0.0 0.0 4 0.025106703489831784 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.2999999999999998 0.0 0.0 0.0 0.0 110-111 1.4500000000000002 0.0 0.0 0.0 0.0 112-113 1.5625 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6 0.0 0.0 0.0 0.0 124-125 2.8875 0.0 0.0 0.0 0.0 126-127 3.0875 0.0 0.0 0.0 0.0 128-129 3.3 0.0 0.0 0.0 0.0 130-131 3.5875 0.0 0.0 0.0 0.0 132-133 3.7625 0.0 0.0 0.0 0.0 134-135 4.05 0.0 0.0 0.0 0.0 136-137 4.2125 0.0 0.0 0.0 0.0 138-139 4.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACTTGAG 10 0.0068343505 144.975 6 CCTCTTG 10 0.0068343505 144.975 8 TAATTAA 10 0.0068343505 144.975 4 CTTGAGA 10 0.0068343505 144.975 7 AATGAAT 10 0.0068343505 144.975 6 >>END_MODULE SRR7170455 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170455_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.137 33.0 33.0 34.0 33.0 34.0 2 33.18075 34.0 33.0 34.0 32.0 34.0 3 33.16825 34.0 33.0 34.0 33.0 34.0 4 33.11575 34.0 33.0 34.0 32.0 34.0 5 33.115 34.0 33.0 34.0 33.0 34.0 6 37.2645 38.0 38.0 38.0 37.0 38.0 7 37.3995 38.0 38.0 38.0 37.0 38.0 8 37.35525 38.0 38.0 38.0 37.0 38.0 9 37.331 38.0 38.0 38.0 37.0 38.0 10-14 36.6046 38.0 37.0 38.0 33.0 38.0 15-19 36.96205 38.0 37.8 38.0 35.4 38.0 20-24 36.9465 38.0 38.0 38.0 36.2 38.0 25-29 36.9835 38.0 38.0 38.0 36.0 38.0 30-34 37.20345 38.0 38.0 38.0 37.0 38.0 35-39 37.14255000000001 38.0 38.0 38.0 36.8 38.0 40-44 37.21634999999999 38.0 38.0 38.0 37.0 38.0 45-49 35.99765 38.0 35.8 38.0 31.2 38.0 50-54 36.2038 38.0 37.2 38.0 32.0 38.0 55-59 37.164300000000004 38.0 38.0 38.0 36.8 38.0 60-64 36.971500000000006 38.0 38.0 38.0 36.0 38.0 65-69 36.900549999999996 38.0 38.0 38.0 35.8 38.0 70-74 36.844350000000006 38.0 38.0 38.0 35.4 38.0 75-79 36.85325 38.0 38.0 38.0 35.8 38.0 80-84 36.744749999999996 38.0 38.0 38.0 35.4 38.0 85-89 36.74225 38.0 38.0 38.0 35.2 38.0 90-94 36.67685 38.0 38.0 38.0 34.8 38.0 95-99 36.523700000000005 38.0 38.0 38.0 34.4 38.0 100-104 36.2667 38.0 37.8 38.0 33.6 38.0 105-109 36.14985 38.0 37.4 38.0 33.4 38.0 110-114 36.17385 38.0 37.6 38.0 33.6 38.0 115-119 35.8573 38.0 37.0 38.0 32.2 38.0 120-124 35.463300000000004 38.0 36.6 38.0 29.8 38.0 125-129 34.96284999999999 38.0 35.8 38.0 28.2 38.0 130-134 34.721 38.0 35.0 38.0 27.0 38.0 135-139 34.165499999999994 38.0 33.6 38.0 25.4 38.0 140-144 33.48435 38.0 33.0 38.0 21.2 38.0 145-149 32.65 38.0 33.0 38.0 13.8 38.0 150-151 26.602625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 2.0 5 0.0 6 1.0 7 1.0 8 3.0 9 0.0 10 3.0 11 1.0 12 1.0 13 1.0 14 1.0 15 1.0 16 3.0 17 4.0 18 3.0 19 4.0 20 6.0 21 7.0 22 1.0 23 7.0 24 16.0 25 9.0 26 32.0 27 19.0 28 20.0 29 35.0 30 54.0 31 60.0 32 67.0 33 133.0 34 185.0 35 346.0 36 844.0 37 2127.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.65 22.875 10.85 25.624999999999996 2 25.8 27.224999999999998 31.874999999999996 15.1 3 19.175 29.975 31.225 19.625 4 22.35 35.825 24.375 17.45 5 22.325 38.574999999999996 22.425 16.675 6 18.75 39.275 23.400000000000002 18.575 7 19.85 21.275 39.475 19.400000000000002 8 19.6 26.950000000000003 28.175 25.275 9 21.575 25.0 30.599999999999998 22.825 10-14 23.185 29.044999999999998 26.76 21.01 15-19 22.439999999999998 28.49 28.225 20.845 20-24 22.41 28.389999999999997 28.115000000000002 21.085 25-29 22.93 28.675 27.744999999999997 20.65 30-34 22.575 28.215 28.544999999999998 20.665 35-39 22.040000000000003 28.265 28.29 21.404999999999998 40-44 22.685 27.685 28.43 21.2 45-49 22.61 28.925 27.955000000000002 20.51 50-54 23.09 28.48 27.87 20.560000000000002 55-59 22.905 27.87 27.985 21.240000000000002 60-64 22.27 28.715000000000003 27.93 21.085 65-69 23.419999999999998 27.85 28.444999999999997 20.285 70-74 23.47 28.28 27.71 20.54 75-79 22.78 28.465 28.665000000000003 20.09 80-84 23.255 28.515 27.815 20.415 85-89 23.53 28.055000000000003 27.805000000000003 20.61 90-94 22.88 28.299999999999997 28.115000000000002 20.705000000000002 95-99 23.1 28.494999999999997 27.284999999999997 21.12 100-104 24.265 28.12 27.68 19.935 105-109 23.265 28.660000000000004 27.35 20.724999999999998 110-114 23.82 27.735 28.08 20.365 115-119 23.990000000000002 28.34 27.96 19.71 120-124 23.69 28.310000000000002 27.55 20.45 125-129 24.22 27.950000000000003 27.284999999999997 20.544999999999998 130-134 23.974999999999998 27.88 27.800000000000004 20.345 135-139 24.104999999999997 28.544999999999998 27.195000000000004 20.155 140-144 24.63 27.939999999999998 26.75 20.68 145-149 24.279999999999998 28.18 27.944999999999997 19.595000000000002 150-151 24.575 26.8375 29.4 19.1875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 1.0 15 1.0 16 0.5 17 0.0 18 0.0 19 0.0 20 1.0 21 2.0 22 3.5 23 3.5 24 2.0 25 4.5 26 4.5 27 5.5 28 8.0 29 14.5 30 22.5 31 28.0 32 32.0 33 38.0 34 51.5 35 67.0 36 78.5 37 106.5 38 141.0 39 171.5 40 227.5 41 255.5 42 256.5 43 286.5 44 298.5 45 292.5 46 265.0 47 235.5 48 217.0 49 176.0 50 152.0 51 128.0 52 95.5 53 79.5 54 68.0 55 53.5 56 39.5 57 24.5 58 13.5 59 10.5 60 12.0 61 12.0 62 6.0 63 1.5 64 2.0 65 1.0 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59778783308195 99.05000000000001 2 0.301659125188537 0.6 3 0.050276520864756154 0.15 4 0.050276520864756154 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3125 0.0 0.0 0.0 0.0 110-111 1.4249999999999998 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.7000000000000002 0.0 0.0 0.0 0.0 116-117 1.925 0.0 0.0 0.0 0.0 118-119 2.1875 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.05 0.0 0.0 0.0 0.0 128-129 3.25 0.0 0.0 0.0 0.0 130-131 3.5375 0.0 0.0 0.0 0.0 132-133 3.75 0.0 0.0 0.0 0.0 134-135 4.112500000000001 0.0 0.0 0.0 0.0 136-137 4.35 0.0 0.0 0.0 0.0 138-139 4.625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714441 spots for SRR7170455.sra Written 714441 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra Read 714422 spots for SRR7170455.sra Written 714422 spots for SRR7170455.sra SRR ids: ['SRR7170455.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_co6p3cj0 SRR7170455.sra spots: 14288459 blocks: [[1, 714422], [714423, 1428844], [1428845, 2143266], [2143267, 2857688], [2857689, 3572110], [3572111, 4286532], [4286533, 5000954], [5000955, 5715376], [5715377, 6429798], [6429799, 7144220], [7144221, 7858642], [7858643, 8573064], [8573065, 9287486], [9287487, 10001908], [10001909, 10716330], [10716331, 11430752], [11430753, 12145174], [12145175, 12859596], [12859597, 13574018], [13574019, 14288459]] SRR7170455 file size 4820189 SRR7170455 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170455 SRR7170455_1.fastq SRR7170455_2.fastq Input file: SRR7170455_1.fastq Paired file: SRR7170455_2.fastq trimmed: SRR7170455-trimmed-pair1.fastq, SRR7170455-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:37:24 2025 >> started Wed Feb 12 20:37:39 2025 >> done (14.944s) 14288459 read pairs processed; of these: 9220 ( 0.06%) short read pairs filtered out after trimming by size control 8262 ( 0.06%) empty read pairs filtered out after trimming by size control 14270977 (99.88%) read pairs available; of these: 8152864 (57.13%) trimmed read pairs available after processing 6118113 (42.87%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 4 0.00% 20 2 0.00% 21 3 0.00% 22 6 0.00% 23 3 0.00% 24 0 0.00% 25 3 0.00% 26 7 0.00% 27 5 0.00% 28 9 0.00% 29 6 0.00% 30 2 0.00% 31 2 0.00% 32 3 0.00% 33 11 0.00% 34 8 0.00% 35 3 0.00% 36 8 0.00% 37 9 0.00% 38 10 0.00% 39 11 0.00% 40 21 0.00% 41 19 0.00% 42 19 0.00% 43 19 0.00% 44 21 0.00% 45 19 0.00% 46 22 0.00% 47 47 0.00% 48 53 0.00% 49 57 0.00% 50 73 0.00% 51 64 0.00% 52 77 0.00% 53 108 0.00% 54 91 0.00% 55 96 0.00% 56 123 0.00% 57 135 0.00% 58 178 0.00% 59 153 0.00% 60 236 0.00% 61 271 0.00% 62 296 0.00% 63 308 0.00% 64 357 0.00% 65 391 0.00% 66 403 0.00% 67 483 0.00% 68 508 0.00% 69 610 0.00% 70 774 0.01% 71 862 0.01% 72 975 0.01% 73 1133 0.01% 74 1271 0.01% 75 1363 0.01% 76 1527 0.01% 77 1654 0.01% 78 1812 0.01% 79 2110 0.01% 80 2272 0.02% 81 2650 0.02% 82 2906 0.02% 83 3159 0.02% 84 4023 0.03% 85 4607 0.03% 86 4692 0.03% 87 4953 0.03% 88 5331 0.04% 89 5633 0.04% 90 5990 0.04% 91 6429 0.05% 92 6829 0.05% 93 7442 0.05% 94 8036 0.06% 95 8565 0.06% 96 8784 0.06% 97 9277 0.07% 98 9630 0.07% 99 10009 0.07% 100 10547 0.07% 101 10971 0.08% 102 11337 0.08% 103 11798 0.08% 104 12363 0.09% 105 13366 0.09% 106 13515 0.09% 107 14026 0.10% 108 14270 0.10% 109 14830 0.10% 110 14927 0.10% 111 15638 0.11% 112 16352 0.11% 113 17009 0.12% 114 17645 0.12% 115 18331 0.13% 116 18940 0.13% 117 19557 0.14% 118 19980 0.14% 119 20131 0.14% 120 21113 0.15% 121 22046 0.15% 122 22562 0.16% 123 23774 0.17% 124 24568 0.17% 125 25475 0.18% 126 27085 0.19% 127 27980 0.20% 128 29558 0.21% 129 30712 0.22% 130 32410 0.23% 131 34305 0.24% 132 36458 0.26% 133 38713 0.27% 134 41503 0.29% 135 44742 0.31% 136 48254 0.34% 137 52940 0.37% 138 58830 0.41% 139 65246 0.46% 140 74136 0.52% 141 85155 0.60% 142 100294 0.70% 143 119131 0.83% 144 146218 1.02% 145 184614 1.29% 146 245552 1.72% 147 347398 2.43% 148 550501 3.86% 149 1088601 7.63% 150 4057381 28.43% 151 6118113 42.87% 14270977 reads passed initial QC criterion=sequence-density sequence-density=0.35 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=15 prefix-density=0.37 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=326.54 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=17.0 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.96 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=21 prefix-density=0.98 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=25 fanout-score=35.50 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=11.0 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170455 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:38:40 Started mapping on | Feb 12 20:38:40 Finished on | Feb 12 20:40:28 Mapping speed, Million of reads per hour | 475.70 Number of input reads | 14270977 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13382908 Uniquely mapped reads % | 93.78% Average mapped length | 294.07 Number of splices: Total | 13144822 Number of splices: Annotated (sjdb) | 12822605 Number of splices: GT/AG | 12910441 Number of splices: GC/AG | 188605 Number of splices: AT/AC | 7959 Number of splices: Non-canonical | 37817 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.71 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399500 % of reads mapped to multiple loci | 2.80% Number of reads mapped to too many loci | 31256 % of reads mapped to too many loci | 0.22% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.14% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 497711 497711 497711 N_multimapping 399500 399500 399500 N_noFeature 538368 13120824 628720 N_ambiguous 286685 998 114364 UnstrandedReadsAssigned:12557855 PositiveStrandReadsAssigned:261086 NegativeStrandReadsAssigned:12639824 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170455 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170455-trimmed-pair1.fastq SRR7170455-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,270,977 reads, 12,544,117 reads pseudoaligned [quant] estimated average fragment length: 282.384 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,102 rounds 52401 SRR7170455.ke.tsv 34699 SRR7170455.se.tsv 87100 total ==> SRR7170455.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.62 636 24.8849 Potri.005G024800.1.v4.1 1035 753.616 191 17.2213 Potri.004G059700.1.v4.1 961 679.643 6 0.599865 Potri.007G009000.2.v4.1 1416 1134.62 0 0 Potri.003G141000.2.v4.1 2943 2661.62 575.671 14.6964 Potri.016G087400.1.v4.1 270 74.8747 849 770.471 Potri.015G069301.1.v4.1 564 290.36 0 0 Potri.010G195200.1.v4.1 1773 1491.62 205 9.33856 Potri.012G127500.1.v4.1 977 695.627 394 38.486 ==> SRR7170455.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1017 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 305 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 11 SRR7170455 completed mapping pipeline successfully