Starting /dee2/code/volunteer_pipeline.sh SRR7170456 current disk space = 2818873671680 free memory = 1463965024 SRR7170456 SRAfilesize f55531190e8e7e65bd2d986490beab3c SRR7170456.sra SRR7170456.sra file validated SRR7170456 is paired end SRR7170456 is conventional basespace SRR7170456 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170456_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.13525 18.0 18.0 30.0 18.0 32.0 2 30.47325 31.0 29.0 33.0 27.0 33.0 3 31.756 33.0 31.0 33.0 29.0 33.0 4 32.28075 33.0 33.0 33.0 31.0 34.0 5 33.00975 33.0 33.0 34.0 32.0 34.0 6 36.7265 38.0 37.0 38.0 34.0 38.0 7 37.1475 38.0 38.0 38.0 36.0 38.0 8 37.32025 38.0 38.0 38.0 37.0 38.0 9 37.413 38.0 38.0 38.0 37.0 38.0 10-14 37.47345 38.0 38.0 38.0 37.0 38.0 15-19 37.4818 38.0 38.0 38.0 37.0 38.0 20-24 37.41315 38.0 38.0 38.0 37.0 38.0 25-29 37.503550000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.4422 38.0 38.0 38.0 37.0 38.0 35-39 37.43455 38.0 38.0 38.0 37.0 38.0 40-44 37.41385 38.0 38.0 38.0 37.0 38.0 45-49 37.33675 38.0 38.0 38.0 36.8 38.0 50-54 37.21695 38.0 38.0 38.0 36.0 38.0 55-59 37.1041 38.0 38.0 38.0 36.0 38.0 60-64 37.0483 38.0 38.0 38.0 36.0 38.0 65-69 36.97865 38.0 38.0 38.0 35.8 38.0 70-74 36.8663 38.0 38.0 38.0 35.2 38.0 75-79 36.70195 38.0 38.0 38.0 34.6 38.0 80-84 36.7505 38.0 38.0 38.0 34.8 38.0 85-89 36.3402 38.0 37.4 38.0 34.0 38.0 90-94 36.37375000000001 38.0 37.2 38.0 34.0 38.0 95-99 36.2534 38.0 37.0 38.0 33.6 38.0 100-104 36.25715 38.0 37.0 38.0 33.4 38.0 105-109 35.990899999999996 38.0 37.0 38.0 32.8 38.0 110-114 35.7729 38.0 36.6 38.0 31.4 38.0 115-119 35.326100000000004 38.0 35.8 38.0 29.0 38.0 120-124 35.34405 38.0 36.0 38.0 29.0 38.0 125-129 34.979099999999995 38.0 35.4 38.0 28.0 38.0 130-134 31.521800000000002 34.8 27.8 38.0 19.8 38.0 135-139 33.5375 37.8 33.2 38.0 22.2 38.0 140-144 29.70745 33.6 25.2 37.6 14.0 38.0 145-149 31.676899999999996 36.0 31.0 38.0 13.2 38.0 150-151 27.19625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 3.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 2.0 16 2.0 17 0.0 18 2.0 19 3.0 20 4.0 21 2.0 22 3.0 23 5.0 24 9.0 25 14.0 26 17.0 27 24.0 28 25.0 29 51.0 30 65.0 31 72.0 32 103.0 33 154.0 34 242.0 35 560.0 36 1495.0 37 1142.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.436619718309856 11.476264997391757 11.45018257694314 37.63693270735524 2 21.735867933966986 16.008004002001 32.96648324162081 29.289644822411205 3 18.775 21.725 26.924999999999997 32.574999999999996 4 20.925 30.225 23.974999999999998 24.875 5 20.95 33.800000000000004 25.124999999999996 20.125 6 18.8 35.05 25.35 20.8 7 14.924999999999999 25.324999999999996 41.55 18.2 8 17.025000000000002 26.375 30.775000000000002 25.825 9 16.650000000000002 24.4 34.025 24.925 10-14 19.075 30.654999999999998 26.669999999999998 23.599999999999998 15-19 19.265 29.080000000000002 27.839999999999996 23.815 20-24 19.855 28.475 28.09 23.580000000000002 25-29 19.655 29.125 27.339999999999996 23.880000000000003 30-34 19.605 29.035 27.810000000000002 23.549999999999997 35-39 19.415 28.83 27.73 24.025 40-44 19.885 28.925 28.439999999999998 22.75 45-49 19.400000000000002 29.205 27.265 24.13 50-54 19.705000000000002 28.875 27.21 24.21 55-59 19.365 29.799999999999997 27.839999999999996 22.994999999999997 60-64 19.665 28.98 27.500000000000004 23.855 65-69 19.78 28.565 28.299999999999997 23.355 70-74 19.84 28.88 27.705000000000002 23.575 75-79 20.21 28.67 27.72 23.400000000000002 80-84 20.34 28.775000000000002 27.305 23.580000000000002 85-89 20.255000000000003 29.134999999999998 27.415 23.195 90-94 20.25 28.139999999999997 28.165000000000003 23.445 95-99 20.41 28.785 27.11 23.695 100-104 20.015 28.775000000000002 27.16 24.05 105-109 20.195 28.660000000000004 27.534999999999997 23.61 110-114 20.095 28.199999999999996 28.189999999999998 23.515 115-119 20.36 28.89 27.705000000000002 23.044999999999998 120-124 20.495 28.04 27.74 23.724999999999998 125-129 20.46 28.155 27.505000000000003 23.880000000000003 130-134 20.07 28.494999999999997 27.384999999999998 24.05 135-139 20.0 28.82 27.169999999999998 24.01 140-144 20.09 28.465 27.565 23.880000000000003 145-149 20.175 27.77 27.650000000000002 24.404999999999998 150-151 20.3625 28.449999999999996 26.9625 24.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.5 22 1.0 23 1.5 24 4.0 25 7.0 26 6.5 27 6.0 28 10.0 29 15.0 30 22.0 31 30.0 32 35.5 33 42.5 34 68.5 35 95.5 36 111.0 37 127.0 38 145.0 39 173.0 40 200.5 41 218.5 42 228.0 43 245.5 44 256.5 45 251.5 46 243.0 47 227.0 48 223.0 49 214.0 50 175.0 51 134.5 52 110.5 53 94.0 54 76.5 55 57.5 56 42.5 57 33.0 58 20.5 59 13.0 60 11.5 61 6.5 62 3.0 63 2.5 64 2.5 65 1.5 66 0.5 67 0.0 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.15 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29453262786596 98.52499999999999 2 0.6298815822625347 1.25 3 0.07558578987150416 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.6375 0.0 0.0 0.0 0.0 98-99 0.7875000000000001 0.0 0.0 0.0 0.0 100-101 0.9125000000000001 0.0 0.0 0.0 0.0 102-103 1.0125 0.0 0.0 0.0 0.0 104-105 1.1124999999999998 0.0 0.0 0.0 0.0 106-107 1.2625000000000002 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6749999999999998 0.0 0.0 0.0 0.0 112-113 1.825 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.575 0.0 0.0 0.0 0.0 122-123 2.7249999999999996 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 2.9875 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.45 0.0 0.0 0.0 0.0 132-133 3.5875000000000004 0.0 0.0 0.0 0.0 134-135 3.7125 0.0 0.0 0.0 0.0 136-137 3.825 0.0 0.0 0.0 0.0 138-139 4.0875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170456 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170456_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0925 33.0 33.0 34.0 32.0 34.0 2 33.15075 34.0 33.0 34.0 32.0 34.0 3 33.1885 34.0 33.0 34.0 33.0 34.0 4 33.25675 34.0 33.0 34.0 33.0 34.0 5 33.1915 34.0 33.0 34.0 33.0 34.0 6 37.401 38.0 38.0 38.0 38.0 38.0 7 37.4125 38.0 38.0 38.0 38.0 38.0 8 37.43475 38.0 38.0 38.0 38.0 38.0 9 37.4675 38.0 38.0 38.0 38.0 38.0 10-14 37.32225 38.0 38.0 38.0 37.4 38.0 15-19 36.20285 38.0 36.8 38.0 31.0 38.0 20-24 37.149950000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.0707 38.0 38.0 38.0 36.8 38.0 30-34 37.24395 38.0 38.0 38.0 37.0 38.0 35-39 37.23635 38.0 38.0 38.0 37.0 38.0 40-44 37.188 38.0 38.0 38.0 37.0 38.0 45-49 37.112049999999996 38.0 38.0 38.0 36.8 38.0 50-54 37.11409999999999 38.0 38.0 38.0 36.4 38.0 55-59 37.098200000000006 38.0 38.0 38.0 36.8 38.0 60-64 37.02720000000001 38.0 38.0 38.0 36.2 38.0 65-69 37.0462 38.0 38.0 38.0 36.0 38.0 70-74 36.9336 38.0 38.0 38.0 36.0 38.0 75-79 36.87675 38.0 38.0 38.0 36.0 38.0 80-84 36.85095 38.0 38.0 38.0 36.0 38.0 85-89 36.440799999999996 38.0 37.8 38.0 34.0 38.0 90-94 34.34435 37.8 33.8 38.0 24.2 38.0 95-99 36.2928 38.0 37.8 38.0 33.8 38.0 100-104 36.35455 38.0 38.0 38.0 34.0 38.0 105-109 36.18835 38.0 37.6 38.0 34.0 38.0 110-114 36.056650000000005 38.0 37.0 38.0 33.6 38.0 115-119 35.8701 38.0 37.0 38.0 33.2 38.0 120-124 35.2448 38.0 36.2 38.0 30.0 38.0 125-129 35.02804999999999 38.0 36.0 38.0 29.0 38.0 130-134 34.73635 38.0 35.2 38.0 28.2 38.0 135-139 34.07435 38.0 33.6 38.0 24.6 38.0 140-144 33.27235 38.0 33.0 38.0 20.0 38.0 145-149 32.10355 38.0 32.6 38.0 10.8 38.0 150-151 26.37225 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 4.0 4 0.0 5 2.0 6 0.0 7 2.0 8 3.0 9 0.0 10 1.0 11 3.0 12 0.0 13 4.0 14 1.0 15 3.0 16 5.0 17 5.0 18 2.0 19 4.0 20 4.0 21 4.0 22 6.0 23 4.0 24 14.0 25 11.0 26 21.0 27 19.0 28 22.0 29 33.0 30 40.0 31 59.0 32 66.0 33 118.0 34 201.0 35 340.0 36 925.0 37 2068.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.875 20.8 15.525 25.8 2 27.325 25.624999999999996 30.075000000000003 16.975 3 20.3 28.050000000000004 33.0 18.65 4 23.95 33.825 22.6 19.625 5 23.5 37.275000000000006 22.375 16.85 6 20.575 37.375 24.2 17.849999999999998 7 19.925 20.95 39.15 19.975 8 21.8 26.1 28.525 23.575 9 20.7 25.15 30.5 23.65 10-14 23.435 28.599999999999998 26.41 21.555 15-19 23.31 28.005000000000003 27.845 20.84 20-24 23.305 28.435 27.57 20.69 25-29 22.235 29.095 28.139999999999997 20.53 30-34 22.935 28.005000000000003 27.97 21.09 35-39 23.14 27.905 28.535 20.419999999999998 40-44 23.189999999999998 28.12 28.110000000000003 20.580000000000002 45-49 23.105 28.185 27.68 21.029999999999998 50-54 23.75 27.54 27.994999999999997 20.715 55-59 23.235 27.79 27.900000000000002 21.075 60-64 23.669999999999998 27.525 28.15 20.655 65-69 23.375 28.315 27.779999999999998 20.53 70-74 23.3 28.175 28.105000000000004 20.419999999999998 75-79 23.095 27.71 28.249999999999996 20.945 80-84 23.335 28.389999999999997 27.96 20.315 85-89 23.53 28.005000000000003 27.644999999999996 20.82 90-94 23.77 28.444999999999997 27.37 20.415 95-99 23.76 27.985 27.584999999999997 20.669999999999998 100-104 24.035 28.125 27.77 20.07 105-109 23.91 27.83 27.935 20.325 110-114 23.82 28.249999999999996 28.060000000000002 19.869999999999997 115-119 24.36 28.194999999999997 27.875 19.57 120-124 23.51 28.49 27.755000000000003 20.244999999999997 125-129 24.305 28.065 27.66 19.97 130-134 24.605 28.084999999999997 27.939999999999998 19.37 135-139 24.54 27.68 27.700000000000003 20.080000000000002 140-144 24.34 28.110000000000003 28.005000000000003 19.545 145-149 24.515 27.93 27.72 19.835 150-151 24.4875 27.3625 28.3875 19.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.5 20 1.0 21 0.5 22 1.5 23 2.5 24 2.0 25 4.5 26 4.0 27 4.0 28 8.0 29 8.5 30 11.5 31 17.5 32 29.0 33 36.0 34 51.0 35 77.0 36 80.5 37 103.5 38 142.5 39 169.5 40 198.5 41 214.0 42 249.5 43 274.0 44 274.0 45 279.0 46 278.5 47 276.5 48 237.5 49 184.0 50 160.5 51 140.5 52 113.5 53 93.0 54 75.5 55 55.0 56 40.5 57 29.5 58 17.5 59 18.0 60 13.5 61 3.5 62 5.5 63 4.5 64 1.5 65 1.5 66 1.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.02499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31835395102246 98.35000000000001 2 0.555415299166877 1.0999999999999999 3 0.07573844988639232 0.22499999999999998 4 0.0 0.0 5 0.025246149962130777 0.125 6 0.0 0.0 7 0.0 0.0 8 0.025246149962130777 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 8 0.2 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2125 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.32499999999999996 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3625 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8875 0.0 0.0 0.0 0.0 102-103 0.9874999999999999 0.0 0.0 0.0 0.0 104-105 1.0750000000000002 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.3 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.075 0.0 0.0 0.0 0.0 128-129 3.425 0.0 0.0 0.0 0.0 130-131 3.7 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.112500000000001 0.0 0.0 0.0 0.0 136-137 4.3125 0.0 0.0 0.0 0.0 138-139 4.65 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734213 spots for SRR7170456.sra Written 734213 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra Read 734195 spots for SRR7170456.sra Written 734195 spots for SRR7170456.sra SRR ids: ['SRR7170456.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8h4sgmcj SRR7170456.sra spots: 14683918 blocks: [[1, 734195], [734196, 1468390], [1468391, 2202585], [2202586, 2936780], [2936781, 3670975], [3670976, 4405170], [4405171, 5139365], [5139366, 5873560], [5873561, 6607755], [6607756, 7341950], [7341951, 8076145], [8076146, 8810340], [8810341, 9544535], [9544536, 10278730], [10278731, 11012925], [11012926, 11747120], [11747121, 12481315], [12481316, 13215510], [13215511, 13949705], [13949706, 14683918]] SRR7170456 file size 4954197 SRR7170456 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170456 SRR7170456_1.fastq SRR7170456_2.fastq Input file: SRR7170456_1.fastq Paired file: SRR7170456_2.fastq trimmed: SRR7170456-trimmed-pair1.fastq, SRR7170456-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:50:33 2025 >> started Thu Apr 10 15:50:50 2025 >> done (16.843s) 14683918 read pairs processed; of these: 14017 ( 0.10%) short read pairs filtered out after trimming by size control 15700 ( 0.11%) empty read pairs filtered out after trimming by size control 14654201 (99.80%) read pairs available; of these: 8582557 (58.57%) trimmed read pairs available after processing 6071644 (41.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 6 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 6 0.00% 27 3 0.00% 28 4 0.00% 29 3 0.00% 30 7 0.00% 31 6 0.00% 32 8 0.00% 33 12 0.00% 34 10 0.00% 35 7 0.00% 36 9 0.00% 37 14 0.00% 38 17 0.00% 39 22 0.00% 40 13 0.00% 41 27 0.00% 42 20 0.00% 43 24 0.00% 44 24 0.00% 45 32 0.00% 46 48 0.00% 47 47 0.00% 48 59 0.00% 49 64 0.00% 50 61 0.00% 51 81 0.00% 52 100 0.00% 53 89 0.00% 54 138 0.00% 55 134 0.00% 56 144 0.00% 57 168 0.00% 58 196 0.00% 59 238 0.00% 60 270 0.00% 61 338 0.00% 62 320 0.00% 63 371 0.00% 64 455 0.00% 65 466 0.00% 66 464 0.00% 67 557 0.00% 68 615 0.00% 69 709 0.00% 70 797 0.01% 71 927 0.01% 72 1068 0.01% 73 1224 0.01% 74 1396 0.01% 75 1475 0.01% 76 1802 0.01% 77 1906 0.01% 78 1965 0.01% 79 2142 0.01% 80 2272 0.02% 81 2737 0.02% 82 3058 0.02% 83 3488 0.02% 84 4282 0.03% 85 5074 0.03% 86 5303 0.04% 87 5521 0.04% 88 5817 0.04% 89 5925 0.04% 90 6494 0.04% 91 7017 0.05% 92 7327 0.05% 93 8199 0.06% 94 8664 0.06% 95 9348 0.06% 96 9642 0.07% 97 10112 0.07% 98 10501 0.07% 99 10671 0.07% 100 11849 0.08% 101 12021 0.08% 102 12636 0.09% 103 13532 0.09% 104 14282 0.10% 105 14930 0.10% 106 15477 0.11% 107 15894 0.11% 108 16316 0.11% 109 16737 0.11% 110 17076 0.12% 111 17729 0.12% 112 18208 0.12% 113 19205 0.13% 114 20330 0.14% 115 21046 0.14% 116 21673 0.15% 117 22168 0.15% 118 22877 0.16% 119 23391 0.16% 120 23827 0.16% 121 24872 0.17% 122 25465 0.17% 123 26812 0.18% 124 28006 0.19% 125 29441 0.20% 126 30895 0.21% 127 32107 0.22% 128 33555 0.23% 129 34791 0.24% 130 36474 0.25% 131 38321 0.26% 132 40762 0.28% 133 43830 0.30% 134 46935 0.32% 135 51128 0.35% 136 55862 0.38% 137 61297 0.42% 138 67213 0.46% 139 75169 0.51% 140 84476 0.58% 141 95619 0.65% 142 110198 0.75% 143 129974 0.89% 144 157935 1.08% 145 199525 1.36% 146 259054 1.77% 147 366801 2.50% 148 571101 3.90% 149 1127874 7.70% 150 4173279 28.48% 151 6071644 41.43% 14654201 reads passed initial QC criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=28 prefix-density=0.50 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=37.44 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=7.2 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.23 fanout-score-rank=18 prefix-density=0.42 prefix-fanout=2.2 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.03 sequence-density-rank=23 fanout-score=33.54 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170456 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:51:33 Started mapping on | Apr 10 15:51:33 Finished on | Apr 10 15:52:56 Mapping speed, Million of reads per hour | 635.60 Number of input reads | 14654201 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13784652 Uniquely mapped reads % | 94.07% Average mapped length | 293.62 Number of splices: Total | 13364035 Number of splices: Annotated (sjdb) | 13059515 Number of splices: GT/AG | 13111302 Number of splices: GC/AG | 202233 Number of splices: AT/AC | 8194 Number of splices: Non-canonical | 42306 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 395857 % of reads mapped to multiple loci | 2.70% Number of reads mapped to too many loci | 51274 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.81% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 486243 486243 486243 N_multimapping 395857 395857 395857 N_noFeature 469065 13512712 543198 N_ambiguous 304809 1091 106460 UnstrandedReadsAssigned:13010778 PositiveStrandReadsAssigned:270849 NegativeStrandReadsAssigned:13134994 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170456 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170456-trimmed-pair1.fastq SRR7170456-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,654,201 reads, 13,038,980 reads pseudoaligned [quant] estimated average fragment length: 268.669 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7170456.ke.tsv 34699 SRR7170456.se.tsv 87100 total ==> SRR7170456.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.33 677 24.5711 Potri.005G024800.1.v4.1 1035 767.331 596 49.3423 Potri.004G059700.1.v4.1 961 693.352 7 0.641357 Potri.007G009000.2.v4.1 1416 1148.33 0 0 Potri.003G141000.2.v4.1 2943 2675.33 725.403 17.2249 Potri.016G087400.1.v4.1 270 75.8853 858.258 718.482 Potri.015G069301.1.v4.1 564 301.287 0 0 Potri.010G195200.1.v4.1 1773 1505.33 121 5.10633 Potri.012G127500.1.v4.1 977 709.346 146 13.0752 ==> SRR7170456.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 685 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 296 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 4 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 6 SRR7170456 completed mapping pipeline successfully