Starting /dee2/code/volunteer_pipeline.sh SRR7170457 current disk space = 3050853695488 free memory = 1518963940 SRR7170457 SRAfilesize 24762449210b10a0e37fb939f665430c SRR7170457.sra SRR7170457.sra file validated SRR7170457 is paired end SRR7170457 is conventional basespace SRR7170457 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170457_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.31675 18.0 18.0 30.0 18.0 32.0 2 30.51925 31.0 29.0 33.0 27.0 33.0 3 31.51475 33.0 31.0 33.0 29.0 33.0 4 31.87975 33.0 31.0 33.0 29.0 33.0 5 32.6785 33.0 33.0 33.0 31.0 34.0 6 36.377 38.0 36.0 38.0 34.0 38.0 7 36.85725 38.0 37.0 38.0 35.0 38.0 8 37.20325 38.0 38.0 38.0 36.0 38.0 9 37.3535 38.0 38.0 38.0 37.0 38.0 10-14 36.512649999999994 38.0 37.2 38.0 31.8 38.0 15-19 37.43535 38.0 38.0 38.0 36.8 38.0 20-24 37.4757 38.0 38.0 38.0 37.0 38.0 25-29 36.61105 38.0 37.4 38.0 32.0 38.0 30-34 37.17125 38.0 38.0 38.0 36.2 38.0 35-39 37.246399999999994 38.0 38.0 38.0 36.8 38.0 40-44 37.37335 38.0 38.0 38.0 37.0 38.0 45-49 37.319599999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.2539 38.0 38.0 38.0 37.0 38.0 55-59 37.203199999999995 38.0 38.0 38.0 36.0 38.0 60-64 37.1535 38.0 38.0 38.0 36.0 38.0 65-69 37.056749999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.4735 38.0 37.6 38.0 33.4 38.0 75-79 36.84665 38.0 38.0 38.0 35.0 38.0 80-84 36.80895 38.0 38.0 38.0 35.2 38.0 85-89 36.655100000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.560700000000004 38.0 38.0 38.0 34.2 38.0 95-99 36.4507 38.0 38.0 38.0 34.0 38.0 100-104 36.3918 38.0 38.0 38.0 34.0 38.0 105-109 36.32655 38.0 38.0 38.0 34.0 38.0 110-114 36.19395000000001 38.0 37.0 38.0 33.8 38.0 115-119 35.90875 38.0 37.0 38.0 32.2 38.0 120-124 35.76465 38.0 36.4 38.0 31.8 38.0 125-129 35.5328 38.0 36.2 38.0 30.6 38.0 130-134 35.30235 38.0 35.8 38.0 29.8 38.0 135-139 34.57595 38.0 35.0 38.0 24.6 38.0 140-144 34.610299999999995 38.0 35.0 38.0 27.4 38.0 145-149 34.00575 38.0 34.2 38.0 25.0 38.0 150-151 29.819375 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 4 1.0 5 0.0 6 0.0 7 0.0 8 0.0 9 2.0 10 2.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 1.0 18 2.0 19 3.0 20 4.0 21 4.0 22 4.0 23 1.0 24 11.0 25 12.0 26 8.0 27 21.0 28 22.0 29 28.0 30 40.0 31 52.0 32 81.0 33 97.0 34 184.0 35 359.0 36 1071.0 37 1983.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.71000258464719 10.028431119152236 12.432153011113984 39.82941328508659 2 21.780445111277817 15.378844711177795 32.283070767691925 30.55763940985246 3 20.025000000000002 19.725 25.825 34.425 4 23.1 27.175 22.475 27.250000000000004 5 23.45 32.65 23.724999999999998 20.175 6 19.3 35.375 24.275 21.05 7 15.325 25.75 41.699999999999996 17.224999999999998 8 17.775 26.85 30.85 24.525 9 16.475 24.075 34.25 25.2 10-14 19.7 30.945 26.75 22.605 15-19 19.705000000000002 28.785 27.905 23.605 20-24 20.155 28.64 27.165 24.04 25-29 19.495 29.175 27.800000000000004 23.53 30-34 19.655 29.915000000000003 27.195000000000004 23.235 35-39 20.0 29.265 27.224999999999998 23.51 40-44 19.775000000000002 28.93 27.295 24.0 45-49 20.375 29.04 27.450000000000003 23.135 50-54 20.064999999999998 29.185 26.840000000000003 23.91 55-59 20.09 29.494999999999997 27.025 23.39 60-64 20.48 28.645 26.735 24.14 65-69 20.03 28.73 26.955000000000002 24.285 70-74 20.03 29.005 27.26 23.705000000000002 75-79 20.585 28.634999999999998 26.76 24.02 80-84 19.715 29.375 27.075 23.835 85-89 20.169999999999998 28.58 26.545 24.705 90-94 20.255000000000003 28.345 26.715 24.685000000000002 95-99 19.79 28.860000000000003 27.365000000000002 23.985 100-104 19.875 28.794999999999998 27.139999999999997 24.19 105-109 21.025 28.01 27.61 23.355 110-114 20.369999999999997 28.28 27.21 24.14 115-119 20.515 28.38 27.295 23.810000000000002 120-124 20.805 27.689999999999998 27.265 24.240000000000002 125-129 20.82 28.139999999999997 26.584999999999997 24.455 130-134 20.395 28.494999999999997 26.63 24.48 135-139 20.565 28.000000000000004 26.55 24.884999999999998 140-144 20.580000000000002 27.825 26.765 24.83 145-149 20.41 28.12 27.045 24.425 150-151 21.425 27.0125 26.775 24.7875 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 4.5 27 5.0 28 6.0 29 11.0 30 19.0 31 31.5 32 41.0 33 51.0 34 72.0 35 83.5 36 93.5 37 127.0 38 148.0 39 161.5 40 179.5 41 203.5 42 215.0 43 219.5 44 234.5 45 230.0 46 233.5 47 246.5 48 244.5 49 231.0 50 203.5 51 156.0 52 109.5 53 97.0 54 94.0 55 66.0 56 42.0 57 34.0 58 27.5 59 17.5 60 13.0 61 11.5 62 7.5 63 5.0 64 4.5 65 4.0 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.2750000000000004 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24318869828456 98.35000000000001 2 0.6306760847628659 1.25 3 0.10090817356205853 0.3 4 0.025227043390514632 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.925 0.0 0.0 0.0 0.0 96-97 1.0375 0.0 0.0 0.0 0.0 98-99 1.225 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.375 0.0 0.0 0.0 0.0 110-111 2.8375000000000004 0.0 0.0 0.0 0.0 112-113 3.2125000000000004 0.0 0.0 0.0 0.0 114-115 3.55 0.0 0.0 0.0 0.0 116-117 3.875 0.0 0.0 0.0 0.0 118-119 4.4 0.0 0.0 0.0 0.0 120-121 4.85 0.0 0.0 0.0 0.0 122-123 5.1875 0.0 0.0 0.0 0.0 124-125 5.5375 0.0 0.0 0.0 0.0 126-127 5.85 0.0 0.0 0.0 0.0 128-129 6.2125 0.0 0.0 0.0 0.0 130-131 6.6625 0.0 0.0 0.0 0.0 132-133 7.0375 0.0 0.0 0.0 0.0 134-135 7.325 0.0 0.0 0.0 0.0 136-137 7.6625 0.0 0.0 0.0 0.0 138-139 7.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTCC 10 0.006577216 146.82278 1 ACCACTT 10 0.006832588 144.9875 3 GTTGTAA 10 0.006832588 144.9875 5 >>END_MODULE SRR7170457 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170457_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.941 33.0 33.0 34.0 32.0 34.0 2 32.9745 34.0 33.0 34.0 32.0 34.0 3 32.97425 34.0 33.0 34.0 32.0 34.0 4 33.0455 34.0 33.0 34.0 33.0 34.0 5 33.01875 34.0 33.0 34.0 33.0 34.0 6 37.184 38.0 38.0 38.0 37.0 38.0 7 37.1855 38.0 38.0 38.0 37.0 38.0 8 37.257 38.0 38.0 38.0 37.0 38.0 9 37.24225 38.0 38.0 38.0 37.0 38.0 10-14 37.106849999999994 38.0 38.0 38.0 36.8 38.0 15-19 37.057249999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.00789999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.0219 38.0 38.0 38.0 37.0 38.0 30-34 37.035799999999995 38.0 38.0 38.0 37.0 38.0 35-39 37.04135 38.0 38.0 38.0 37.0 38.0 40-44 36.9765 38.0 38.0 38.0 36.6 38.0 45-49 36.81375 38.0 38.0 38.0 36.0 38.0 50-54 36.61955 38.0 38.0 38.0 35.6 38.0 55-59 36.731750000000005 38.0 38.0 38.0 35.8 38.0 60-64 36.27805 38.0 37.6 38.0 33.6 38.0 65-69 36.694599999999994 38.0 38.0 38.0 35.8 38.0 70-74 36.1731 38.0 38.0 38.0 33.8 38.0 75-79 36.38965 38.0 38.0 38.0 34.2 38.0 80-84 35.79335 38.0 37.2 38.0 30.0 38.0 85-89 35.22195000000001 38.0 36.6 38.0 27.4 38.0 90-94 36.1528 38.0 37.8 38.0 33.8 38.0 95-99 36.09759999999999 38.0 38.0 38.0 34.0 38.0 100-104 35.89684999999999 38.0 37.6 38.0 31.8 38.0 105-109 35.53295 38.0 36.8 38.0 31.0 38.0 110-114 35.273849999999996 38.0 36.6 38.0 28.4 38.0 115-119 35.48049999999999 38.0 36.6 38.0 30.8 38.0 120-124 35.1823 38.0 36.0 38.0 30.0 38.0 125-129 34.97355 38.0 36.0 38.0 29.4 38.0 130-134 34.3799 38.0 34.4 38.0 25.8 38.0 135-139 34.22735 38.0 33.6 38.0 25.6 38.0 140-144 33.20385 38.0 32.6 38.0 19.8 38.0 145-149 32.45885 38.0 33.0 38.0 11.8 38.0 150-151 27.249375 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 18.0 3 5.0 4 5.0 5 1.0 6 1.0 7 2.0 8 3.0 9 3.0 10 3.0 11 1.0 12 3.0 13 4.0 14 5.0 15 1.0 16 4.0 17 3.0 18 5.0 19 8.0 20 3.0 21 2.0 22 7.0 23 5.0 24 13.0 25 8.0 26 14.0 27 20.0 28 32.0 29 43.0 30 34.0 31 56.0 32 86.0 33 123.0 34 185.0 35 349.0 36 858.0 37 2087.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.05 19.900000000000002 15.5 27.55 2 26.75 25.025 29.475 18.75 3 21.3 28.000000000000004 30.4 20.3 4 25.775 32.675 22.85 18.7 5 25.674999999999997 33.800000000000004 22.45 18.075 6 21.224999999999998 37.225 23.5 18.05 7 19.125 21.475 39.324999999999996 20.075000000000003 8 22.85 24.5 27.650000000000002 25.0 9 22.85 24.95 30.325000000000003 21.875 10-14 23.799999999999997 28.935 25.869999999999997 21.395 15-19 23.175 27.435 28.105000000000004 21.285 20-24 23.635 27.900000000000002 27.634999999999998 20.830000000000002 25-29 23.89 28.03 27.650000000000002 20.43 30-34 23.395 27.805000000000003 28.07 20.73 35-39 23.575 27.855 27.400000000000002 21.17 40-44 23.895 27.96 27.48 20.665 45-49 23.685000000000002 27.705000000000002 27.965 20.645 50-54 24.060000000000002 27.779999999999998 27.465 20.695 55-59 23.715 27.515 27.615000000000002 21.154999999999998 60-64 23.755000000000003 27.589999999999996 27.575 21.08 65-69 23.775 27.834999999999997 27.534999999999997 20.855 70-74 23.79 27.744999999999997 27.52 20.945 75-79 23.810000000000002 27.27 27.92 21.0 80-84 23.799999999999997 27.1 27.36 21.740000000000002 85-89 24.41 27.900000000000002 27.345000000000002 20.345 90-94 23.669999999999998 27.905 27.650000000000002 20.775 95-99 24.529999999999998 28.065 27.169999999999998 20.235 100-104 24.2 27.96 27.644999999999996 20.195 105-109 23.955000000000002 27.52 27.91 20.615 110-114 24.26 27.939999999999998 27.07 20.73 115-119 25.080000000000002 28.105000000000004 26.919999999999998 19.895 120-124 24.68 27.87 27.400000000000002 20.05 125-129 25.05 28.54 26.8 19.61 130-134 25.35 27.825 27.339999999999996 19.485 135-139 25.424999999999997 27.815 27.435 19.325 140-144 25.035 27.915 27.505000000000003 19.545 145-149 25.55 27.49 27.975 18.985 150-151 25.8625 27.3125 27.537499999999998 19.287499999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 1.5 23 1.5 24 2.0 25 3.0 26 2.0 27 2.0 28 4.0 29 10.0 30 15.5 31 20.0 32 27.5 33 34.5 34 42.0 35 54.5 36 72.5 37 100.0 38 124.5 39 138.5 40 178.5 41 197.0 42 215.0 43 248.0 44 273.5 45 281.5 46 267.5 47 275.0 48 251.0 49 212.5 50 189.0 51 163.0 52 134.5 53 101.5 54 79.0 55 70.5 56 58.5 57 39.0 58 24.0 59 21.5 60 17.5 61 11.0 62 10.0 63 7.0 64 5.0 65 3.5 66 1.5 67 0.5 68 0.0 69 1.0 70 1.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.5 83 0.5 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.7313997477931904 1.4500000000000002 3 0.025220680958385876 0.075 4 0.0 0.0 5 0.025220680958385876 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATAGGAGGTTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.125 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.25 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.38749999999999996 0.0 0.0 0.0 0.0 86-87 0.48750000000000004 0.0 0.0 0.0 0.0 88-89 0.5875 0.0 0.0 0.0 0.0 90-91 0.6875 0.0 0.0 0.0 0.0 92-93 0.7625 0.0 0.0 0.0 0.0 94-95 0.9625 0.0 0.0 0.0 0.0 96-97 1.0875 0.0 0.0 0.0 0.0 98-99 1.275 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.5375 0.0 0.0 0.0 0.0 104-105 1.8 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.3625 0.0 0.0 0.0 0.0 110-111 2.8125 0.0 0.0 0.0 0.0 112-113 3.175 0.0 0.0 0.0 0.0 114-115 3.525 0.0 0.0 0.0 0.0 116-117 3.825 0.0 0.0 0.0 0.0 118-119 4.325 0.0 0.0 0.0 0.0 120-121 4.775 0.0 0.0 0.0 0.0 122-123 5.074999999999999 0.0 0.0 0.0 0.0 124-125 5.4125 0.0 0.0 0.0 0.0 126-127 5.725 0.0 0.0 0.0 0.0 128-129 6.0875 0.0 0.0 0.0 0.0 130-131 6.5625 0.0 0.0 0.0 0.0 132-133 6.9625 0.0 0.0 0.0 0.0 134-135 7.25 0.0 0.0 0.0 0.0 136-137 7.5875 0.0 0.0 0.0 0.0 138-139 7.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGTTA 10 0.006830828 145.0 145 >>END_MODULE Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561391 spots for SRR7170457.sra Written 561391 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra Read 561372 spots for SRR7170457.sra Written 561372 spots for SRR7170457.sra SRR ids: ['SRR7170457.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_um7h_9zm SRR7170457.sra spots: 11227459 blocks: [[1, 561372], [561373, 1122744], [1122745, 1684116], [1684117, 2245488], [2245489, 2806860], [2806861, 3368232], [3368233, 3929604], [3929605, 4490976], [4490977, 5052348], [5052349, 5613720], [5613721, 6175092], [6175093, 6736464], [6736465, 7297836], [7297837, 7859208], [7859209, 8420580], [8420581, 8981952], [8981953, 9543324], [9543325, 10104696], [10104697, 10666068], [10666069, 11227459]] SRR7170457 file size 3782917 SRR7170457 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170457 SRR7170457_1.fastq SRR7170457_2.fastq Input file: SRR7170457_1.fastq Paired file: SRR7170457_2.fastq trimmed: SRR7170457-trimmed-pair1.fastq, SRR7170457-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:21:15 2025 >> started Wed Feb 12 21:21:27 2025 >> done (12.014s) 11227459 read pairs processed; of these: 14257 ( 0.13%) short read pairs filtered out after trimming by size control 17968 ( 0.16%) empty read pairs filtered out after trimming by size control 11195234 (99.71%) read pairs available; of these: 6307686 (56.34%) trimmed read pairs available after processing 4887548 (43.66%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 2 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 8 0.00% 27 2 0.00% 28 4 0.00% 29 4 0.00% 30 5 0.00% 31 8 0.00% 32 6 0.00% 33 10 0.00% 34 11 0.00% 35 15 0.00% 36 12 0.00% 37 18 0.00% 38 21 0.00% 39 17 0.00% 40 31 0.00% 41 37 0.00% 42 45 0.00% 43 45 0.00% 44 39 0.00% 45 40 0.00% 46 54 0.00% 47 66 0.00% 48 93 0.00% 49 120 0.00% 50 127 0.00% 51 175 0.00% 52 170 0.00% 53 172 0.00% 54 206 0.00% 55 194 0.00% 56 249 0.00% 57 289 0.00% 58 281 0.00% 59 376 0.00% 60 413 0.00% 61 469 0.00% 62 502 0.00% 63 569 0.01% 64 628 0.01% 65 747 0.01% 66 775 0.01% 67 878 0.01% 68 901 0.01% 69 1107 0.01% 70 1207 0.01% 71 1397 0.01% 72 1650 0.01% 73 1843 0.02% 74 2003 0.02% 75 2254 0.02% 76 2688 0.02% 77 2836 0.03% 78 2967 0.03% 79 3127 0.03% 80 3532 0.03% 81 3865 0.03% 82 4542 0.04% 83 4998 0.04% 84 6065 0.05% 85 6846 0.06% 86 7246 0.06% 87 7421 0.07% 88 7974 0.07% 89 8358 0.07% 90 8809 0.08% 91 9337 0.08% 92 10019 0.09% 93 10863 0.10% 94 11586 0.10% 95 12267 0.11% 96 12838 0.11% 97 13296 0.12% 98 13651 0.12% 99 14145 0.13% 100 14515 0.13% 101 15078 0.13% 102 15897 0.14% 103 16506 0.15% 104 17477 0.16% 105 18586 0.17% 106 18600 0.17% 107 19326 0.17% 108 19262 0.17% 109 19784 0.18% 110 20464 0.18% 111 20865 0.19% 112 21409 0.19% 113 21966 0.20% 114 22770 0.20% 115 23805 0.21% 116 24254 0.22% 117 24754 0.22% 118 25046 0.22% 119 25633 0.23% 120 25774 0.23% 121 26039 0.23% 122 27043 0.24% 123 27949 0.25% 124 28901 0.26% 125 29428 0.26% 126 30387 0.27% 127 31274 0.28% 128 32027 0.29% 129 32979 0.29% 130 34141 0.30% 131 34998 0.31% 132 36426 0.33% 133 38477 0.34% 134 40433 0.36% 135 42899 0.38% 136 46090 0.41% 137 48403 0.43% 138 51944 0.46% 139 56564 0.51% 140 61434 0.55% 141 68512 0.61% 142 78500 0.70% 143 91665 0.82% 144 110021 0.98% 145 142020 1.27% 146 172329 1.54% 147 242924 2.17% 148 369673 3.30% 149 715641 6.39% 150 2917204 26.06% 151 4887548 43.66% 11195234 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=34 prefix-density=0.60 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.02 sequence-density-rank=34 fanout-score=61.45 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.60 fanout-score-rank=20 prefix-density=0.71 prefix-fanout=2.4 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=10.00 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR7170457 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:22:14 Started mapping on | Feb 12 21:22:14 Finished on | Feb 12 21:24:05 Mapping speed, Million of reads per hour | 363.09 Number of input reads | 11195234 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 10136435 Uniquely mapped reads % | 90.54% Average mapped length | 291.40 Number of splices: Total | 9273671 Number of splices: Annotated (sjdb) | 9083653 Number of splices: GT/AG | 9093087 Number of splices: GC/AG | 148317 Number of splices: AT/AC | 6764 Number of splices: Non-canonical | 25503 Mismatch rate per base, % | 0.42% Deletion rate per base | 0.03% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 254085 % of reads mapped to multiple loci | 2.27% Number of reads mapped to too many loci | 44117 % of reads mapped to too many loci | 0.39% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.68% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 816236 816236 816236 N_multimapping 254085 254085 254085 N_noFeature 301142 9914437 355182 N_ambiguous 236095 694 67848 UnstrandedReadsAssigned:9599198 PositiveStrandReadsAssigned:221304 NegativeStrandReadsAssigned:9713405 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170457 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170457-trimmed-pair1.fastq SRR7170457-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,195,234 reads, 9,680,580 reads pseudoaligned [quant] estimated average fragment length: 242.789 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7170457.ke.tsv 34699 SRR7170457.se.tsv 87100 total ==> SRR7170457.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1776.21 416 19.9816 Potri.005G024800.1.v4.1 1035 793.211 135 14.5203 Potri.004G059700.1.v4.1 961 719.222 5 0.593114 Potri.007G009000.2.v4.1 1416 1174.21 0 0 Potri.003G141000.2.v4.1 2943 2701.21 484 15.2868 Potri.016G087400.1.v4.1 270 83.5293 344 351.359 Potri.015G069301.1.v4.1 564 324.71 0 0 Potri.010G195200.1.v4.1 1773 1531.21 15 0.835771 Potri.012G127500.1.v4.1 977 735.216 45 5.2219 ==> SRR7170457.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 376 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 362 Potri.001G212900.v4.1 10 Potri.001G182400.v4.1 5 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170457 completed mapping pipeline successfully