Starting /dee2/code/volunteer_pipeline.sh SRR7170458 current disk space = 3050665816064 free memory = 1579902040 SRR7170458 SRAfilesize 6540e4d674deb30ecc10e10ba658c39b SRR7170458.sra SRR7170458.sra file validated SRR7170458 is paired end SRR7170458 is conventional basespace SRR7170458 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170458_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.86575 30.0 18.0 33.0 18.0 33.0 2 26.41075 27.0 25.0 31.0 18.0 33.0 3 29.121 30.0 27.0 33.0 25.0 33.0 4 31.18825 33.0 31.0 33.0 29.0 33.0 5 32.265 33.0 32.0 33.0 32.0 33.0 6 36.51175 38.0 37.0 38.0 34.0 38.0 7 37.11325 38.0 38.0 38.0 35.0 38.0 8 37.398 38.0 38.0 38.0 37.0 38.0 9 37.52325 38.0 38.0 38.0 37.0 38.0 10-14 37.564350000000005 38.0 38.0 38.0 37.4 38.0 15-19 37.57280000000001 38.0 38.0 38.0 37.8 38.0 20-24 37.62845 38.0 38.0 38.0 38.0 38.0 25-29 37.59224999999999 38.0 38.0 38.0 38.0 38.0 30-34 37.56930000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.5143 38.0 38.0 38.0 37.4 38.0 40-44 37.47495 38.0 38.0 38.0 37.2 38.0 45-49 37.457 38.0 38.0 38.0 37.0 38.0 50-54 37.3349 38.0 38.0 38.0 37.0 38.0 55-59 37.2771 38.0 38.0 38.0 36.2 38.0 60-64 37.207499999999996 38.0 38.0 38.0 36.0 38.0 65-69 37.15185 38.0 38.0 38.0 36.0 38.0 70-74 37.07215000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.0066 38.0 38.0 38.0 35.8 38.0 80-84 36.836949999999995 38.0 38.0 38.0 35.0 38.0 85-89 36.714 38.0 38.0 38.0 34.6 38.0 90-94 36.6981 38.0 38.0 38.0 34.4 38.0 95-99 36.5167 38.0 38.0 38.0 34.2 38.0 100-104 36.2649 38.0 37.0 38.0 33.6 38.0 105-109 36.10905 38.0 37.0 38.0 33.0 38.0 110-114 35.977850000000004 38.0 37.0 38.0 32.6 38.0 115-119 35.786550000000005 38.0 36.6 38.0 31.2 38.0 120-124 35.509150000000005 38.0 36.0 38.0 30.6 38.0 125-129 35.1438 38.0 35.4 38.0 28.4 38.0 130-134 34.80775 38.0 34.8 38.0 28.0 38.0 135-139 34.3289 38.0 33.4 38.0 26.0 38.0 140-144 33.473499999999994 38.0 33.0 38.0 22.0 38.0 145-149 32.25495 38.0 32.8 38.0 12.8 38.0 150-151 26.381124999999997 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 4.0 21 4.0 22 2.0 23 7.0 24 4.0 25 7.0 26 21.0 27 25.0 28 25.0 29 33.0 30 39.0 31 56.0 32 75.0 33 131.0 34 223.0 35 435.0 36 1138.0 37 1766.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 49.86979166666667 10.338541666666666 7.135416666666666 32.65625 2 25.025 11.625 34.775 28.575 3 18.224999999999998 20.625 27.3 33.85 4 22.475 29.075 25.0 23.45 5 23.075000000000003 32.925 23.575 20.424999999999997 6 18.475 37.45 24.775 19.3 7 13.600000000000001 25.775 42.75 17.875 8 17.75 24.8 31.45 26.0 9 18.425 23.75 33.2 24.625 10-14 20.01 30.385 26.655 22.95 15-19 19.950000000000003 29.445 27.62 22.985 20-24 19.23 28.89 27.839999999999996 24.04 25-29 19.84 29.265 28.139999999999997 22.755 30-34 19.480974048702436 29.236461823091155 27.481374068703435 23.801190059502975 35-39 19.75098754937747 28.981449072453625 27.946397319865994 23.321166058302914 40-44 19.830000000000002 28.910000000000004 27.845 23.415 45-49 19.935 28.485 28.084999999999997 23.494999999999997 50-54 19.665 28.575 28.43 23.330000000000002 55-59 19.27 28.23 28.854999999999997 23.645 60-64 19.8 28.59 28.02 23.59 65-69 19.685 29.25 27.33 23.735 70-74 19.37 28.63 28.32 23.68 75-79 19.7929689453418 28.374256138420762 27.764164624693706 24.06861029154373 80-84 19.44291643746562 28.66930039505926 27.53413011951793 24.353653047957195 85-89 19.814999999999998 28.71 28.194999999999997 23.28 90-94 19.64 28.765 28.005000000000003 23.59 95-99 19.63 28.52 28.444999999999997 23.405 100-104 19.67 29.38 27.57 23.380000000000003 105-109 20.255000000000003 28.804999999999996 27.33 23.61 110-114 20.365 28.610000000000003 27.634999999999998 23.39 115-119 20.565 29.060000000000002 27.529999999999998 22.845 120-124 20.064999999999998 28.76 27.775 23.400000000000002 125-129 20.71 28.595 27.169999999999998 23.525 130-134 20.7 28.560000000000002 27.584999999999997 23.155 135-139 20.244999999999997 28.46 27.495000000000005 23.799999999999997 140-144 20.645 28.749999999999996 26.810000000000002 23.794999999999998 145-149 19.885 28.535 27.665 23.915 150-151 19.900000000000002 28.749999999999996 28.125 23.225 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 3.0 24 5.0 25 6.0 26 5.0 27 7.0 28 11.5 29 14.5 30 22.0 31 32.0 32 47.0 33 55.0 34 54.5 35 75.5 36 93.5 37 111.5 38 146.0 39 176.5 40 208.5 41 222.5 42 232.5 43 265.5 44 282.0 45 266.5 46 257.5 47 240.5 48 215.0 49 193.5 50 165.5 51 131.0 52 100.5 53 87.0 54 71.0 55 48.0 56 39.5 57 36.5 58 22.5 59 15.0 60 9.5 61 5.0 62 4.0 63 3.0 64 3.5 65 2.0 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.45 0.0 0.0 0.0 0.0 88-89 0.5375000000000001 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8500000000000001 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.4875 0.0 0.0 0.0 0.0 108-109 1.7375 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 3.0625 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.4875 0.0 0.0 0.0 0.0 126-127 3.775 0.0 0.0 0.0 0.0 128-129 3.975 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.2 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170458 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170458_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.75125 33.0 33.0 34.0 32.0 34.0 2 32.911 33.0 33.0 34.0 32.0 34.0 3 32.9815 34.0 33.0 34.0 32.0 34.0 4 32.8605 34.0 33.0 34.0 32.0 34.0 5 32.95575 34.0 33.0 34.0 32.0 34.0 6 37.12975 38.0 38.0 38.0 37.0 38.0 7 37.13975 38.0 38.0 38.0 37.0 38.0 8 37.11675 38.0 38.0 38.0 37.0 38.0 9 37.117 38.0 38.0 38.0 37.0 38.0 10-14 37.13275 38.0 38.0 38.0 36.8 38.0 15-19 37.17995 38.0 38.0 38.0 37.0 38.0 20-24 37.12415 38.0 38.0 38.0 37.0 38.0 25-29 37.064099999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.049350000000004 38.0 38.0 38.0 36.8 38.0 35-39 37.05445 38.0 38.0 38.0 36.8 38.0 40-44 37.03959999999999 38.0 38.0 38.0 36.8 38.0 45-49 36.98865 38.0 38.0 38.0 36.2 38.0 50-54 37.013549999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.9343 38.0 38.0 38.0 36.0 38.0 60-64 36.8584 38.0 38.0 38.0 35.8 38.0 65-69 36.85835 38.0 38.0 38.0 36.0 38.0 70-74 36.765100000000004 38.0 38.0 38.0 35.6 38.0 75-79 36.656200000000005 38.0 38.0 38.0 35.0 38.0 80-84 36.5584 38.0 38.0 38.0 34.6 38.0 85-89 36.4977 38.0 38.0 38.0 34.2 38.0 90-94 36.3438 38.0 38.0 38.0 34.0 38.0 95-99 36.221199999999996 38.0 38.0 38.0 34.0 38.0 100-104 36.062650000000005 38.0 37.4 38.0 33.4 38.0 105-109 35.90125 38.0 37.0 38.0 32.6 38.0 110-114 35.6799 38.0 37.0 38.0 31.8 38.0 115-119 35.4424 38.0 36.2 38.0 30.6 38.0 120-124 35.08605 38.0 36.0 38.0 28.8 38.0 125-129 34.626099999999994 38.0 35.4 38.0 27.2 38.0 130-134 34.067299999999996 38.0 33.6 38.0 23.8 38.0 135-139 33.1867 38.0 33.0 38.0 19.2 38.0 140-144 32.4987 38.0 33.0 38.0 13.6 38.0 145-149 31.37915 38.0 31.8 38.0 8.4 38.0 150-151 25.260875 32.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 3.0 5 2.0 6 0.0 7 0.0 8 3.0 9 2.0 10 0.0 11 1.0 12 0.0 13 4.0 14 5.0 15 0.0 16 3.0 17 6.0 18 3.0 19 11.0 20 10.0 21 8.0 22 15.0 23 11.0 24 7.0 25 22.0 26 19.0 27 38.0 28 26.0 29 41.0 30 41.0 31 67.0 32 95.0 33 94.0 34 190.0 35 316.0 36 818.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 42.038057085628445 20.806209313970957 11.742613920881322 25.41311967951928 2 25.275275275275277 26.076076076076077 31.256256256256254 17.39239239239239 3 20.72072072072072 28.403403403403406 31.681681681681685 19.194194194194196 4 23.773773773773772 34.134134134134136 23.423423423423422 18.66866866866867 5 23.83575363044567 37.73159739609414 22.25838758137206 16.174261392088134 6 19.779944986246562 38.68467116779195 24.031007751937985 17.504376094023506 7 20.40510127531883 20.905226306576644 39.95998999749937 18.72968242060515 8 20.005001250312578 26.106526631657918 28.832208052013 25.056264066016503 9 21.205301325331334 25.95648912228057 30.282570642660666 22.55563890972743 10-14 23.499699939987998 28.770754150830165 27.070414082816562 20.659131826365275 15-19 22.98534340453204 28.09264168875994 28.61287579410735 20.309139112600672 20-24 21.81354151028374 28.19896912375519 28.734424260621527 21.253065105339537 25-29 22.73273273273273 28.8988988988989 28.10810810810811 20.26026026026026 30-34 22.647176611934324 28.339006808169803 28.14377252703244 20.870044052863438 35-39 23.130069089816764 27.93131070391509 28.587163312305996 20.35145689396215 40-44 22.2972972972973 28.508508508508505 28.123123123123122 21.07107107107107 45-49 22.4012812171563 27.97657774886142 28.872428807367 20.749712226615287 50-54 22.50638106200891 28.0966918572644 28.56713878184275 20.82978829888394 55-59 22.801661578499573 27.56118312396777 28.762324207997597 20.87483108953506 60-64 22.682682682682685 28.31831831831832 28.643643643643646 20.355355355355357 65-69 23.550615800540704 27.851206568539098 27.761089416241113 20.837088214679085 70-74 22.899349023535304 28.292438657986978 28.02704056084126 20.781171757636454 75-79 23.10465698547822 27.73660490736104 28.237356034051075 20.921382073109665 80-84 23.505257886830243 27.74161241862794 28.327491236855284 20.425638457686528 85-89 23.745618427641464 27.896845267901853 27.846770155232846 20.510766149223837 90-94 23.400100150225338 28.092138207310967 28.217325988983475 20.29043565348022 95-99 23.03224514320048 29.070698978569997 27.79891848588023 20.098137392349287 100-104 24.304164997997596 27.748297957549056 28.063676411694033 19.883860632759312 105-109 23.305296885951737 28.972664463802943 27.63592670471613 20.08611194552919 110-114 23.978569997997194 28.169437212096938 27.914079711596234 19.937913078309634 115-119 23.910866299449175 28.162243365047573 27.766649974962444 20.16024036054081 120-124 23.620430645968955 28.5077616424637 27.39609414121182 20.475713570355534 125-129 24.032249987480593 28.073513946617258 27.702939556312284 20.191296509589865 130-134 23.84935142985927 27.750788801522514 27.675664846997545 20.724194921620672 135-139 23.866993840452704 27.59276879162702 28.278832189894338 20.26140517802594 140-144 24.292653613100306 27.888226751464774 27.442535930692575 20.37658370474235 145-149 24.046069103655483 28.12719078617927 28.10716074111167 19.71957936905358 150-151 24.54932398597897 27.265898848272407 28.70555833750626 19.479218828242363 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.5 6 1.0 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 2.0 21 2.5 22 1.5 23 1.5 24 2.5 25 5.0 26 5.0 27 10.0 28 12.0 29 8.5 30 16.5 31 26.0 32 34.0 33 44.5 34 59.0 35 70.5 36 90.5 37 121.5 38 153.5 39 185.0 40 199.0 41 232.0 42 267.5 43 267.0 44 267.0 45 280.5 46 274.0 47 238.5 48 220.0 49 193.0 50 147.0 51 119.0 52 99.5 53 81.5 54 71.5 55 61.0 56 38.5 57 24.0 58 19.0 59 14.5 60 8.5 61 4.0 62 5.0 63 5.0 64 3.5 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.1 3 0.1 4 0.1 5 0.15 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.02 15-19 0.045 20-24 0.08499999999999999 25-29 0.1 30-34 0.12 35-39 0.13 40-44 0.1 45-49 0.095 50-54 0.095 55-59 0.095 60-64 0.1 65-69 0.13 70-74 0.15 75-79 0.15 80-84 0.15 85-89 0.15 90-94 0.15 95-99 0.13999999999999999 100-104 0.12 105-109 0.13 110-114 0.13999999999999999 115-119 0.15 120-124 0.15 125-129 0.155 130-134 0.165 135-139 0.155 140-144 0.155 145-149 0.15 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42036290322581 98.625 2 0.4032258064516129 0.8 3 0.12600806451612903 0.375 4 0.05040322580645161 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.35 0.0 0.0 0.0 0.0 86-87 0.475 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.2000000000000002 0.0 0.0 0.0 0.0 104-105 1.35 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.8125 0.0 0.0 0.0 0.0 110-111 2.0375 0.0 0.0 0.0 0.0 112-113 2.1875 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.6500000000000004 0.0 0.0 0.0 0.0 118-119 2.825 0.0 0.0 0.0 0.0 120-121 3.1 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.5125 0.0 0.0 0.0 0.0 126-127 3.7875 0.0 0.0 0.0 0.0 128-129 3.975 0.0 0.0 0.0 0.0 130-131 4.275 0.0 0.0 0.0 0.0 132-133 4.65 0.0 0.0 0.0 0.0 134-135 4.9125 0.0 0.0 0.0 0.0 136-137 5.175 0.0 0.0 0.0 0.0 138-139 5.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCAGTGG 10 0.006830828 145.0 145 >>END_MODULE Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779865 spots for SRR7170458.sra Written 779865 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra Read 779848 spots for SRR7170458.sra Written 779848 spots for SRR7170458.sra SRR ids: ['SRR7170458.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_w8y_k80e SRR7170458.sra spots: 15596977 blocks: [[1, 779848], [779849, 1559696], [1559697, 2339544], [2339545, 3119392], [3119393, 3899240], [3899241, 4679088], [4679089, 5458936], [5458937, 6238784], [6238785, 7018632], [7018633, 7798480], [7798481, 8578328], [8578329, 9358176], [9358177, 10138024], [10138025, 10917872], [10917873, 11697720], [11697721, 12477568], [12477569, 13257416], [13257417, 14037264], [14037265, 14817112], [14817113, 15596977]] SRR7170458 file size 5263603 SRR7170458 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170458 SRR7170458_1.fastq SRR7170458_2.fastq Input file: SRR7170458_1.fastq Paired file: SRR7170458_2.fastq trimmed: SRR7170458-trimmed-pair1.fastq, SRR7170458-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:13 2025 >> started Wed Feb 12 21:41:38 2025 >> done (24.649s) 15596977 read pairs processed; of these: 21347 ( 0.14%) short read pairs filtered out after trimming by size control 25304 ( 0.16%) empty read pairs filtered out after trimming by size control 15550326 (99.70%) read pairs available; of these: 9929776 (63.86%) trimmed read pairs available after processing 5620550 (36.14%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 6 0.00% 20 5 0.00% 21 3 0.00% 22 6 0.00% 23 7 0.00% 24 11 0.00% 25 6 0.00% 26 7 0.00% 27 8 0.00% 28 1 0.00% 29 6 0.00% 30 7 0.00% 31 3 0.00% 32 8 0.00% 33 6 0.00% 34 12 0.00% 35 14 0.00% 36 18 0.00% 37 21 0.00% 38 11 0.00% 39 29 0.00% 40 26 0.00% 41 41 0.00% 42 45 0.00% 43 52 0.00% 44 55 0.00% 45 51 0.00% 46 62 0.00% 47 59 0.00% 48 85 0.00% 49 115 0.00% 50 112 0.00% 51 114 0.00% 52 150 0.00% 53 146 0.00% 54 174 0.00% 55 179 0.00% 56 208 0.00% 57 257 0.00% 58 266 0.00% 59 335 0.00% 60 368 0.00% 61 449 0.00% 62 511 0.00% 63 553 0.00% 64 620 0.00% 65 640 0.00% 66 709 0.00% 67 782 0.01% 68 889 0.01% 69 1051 0.01% 70 1179 0.01% 71 1285 0.01% 72 1518 0.01% 73 1694 0.01% 74 1918 0.01% 75 2044 0.01% 76 2337 0.02% 77 2561 0.02% 78 2861 0.02% 79 3183 0.02% 80 3466 0.02% 81 4013 0.03% 82 4517 0.03% 83 5229 0.03% 84 6478 0.04% 85 6668 0.04% 86 6818 0.04% 87 7153 0.05% 88 7375 0.05% 89 7615 0.05% 90 8274 0.05% 91 8675 0.06% 92 9331 0.06% 93 10115 0.07% 94 10795 0.07% 95 11494 0.07% 96 12008 0.08% 97 12481 0.08% 98 12879 0.08% 99 13451 0.09% 100 13985 0.09% 101 14598 0.09% 102 15452 0.10% 103 16045 0.10% 104 16685 0.11% 105 17748 0.11% 106 18407 0.12% 107 18657 0.12% 108 19008 0.12% 109 19726 0.13% 110 19880 0.13% 111 20360 0.13% 112 21397 0.14% 113 21985 0.14% 114 22876 0.15% 115 23900 0.15% 116 25023 0.16% 117 25664 0.17% 118 26204 0.17% 119 26689 0.17% 120 27780 0.18% 121 28998 0.19% 122 30160 0.19% 123 32094 0.21% 124 33883 0.22% 125 35043 0.23% 126 37265 0.24% 127 39407 0.25% 128 41621 0.27% 129 43985 0.28% 130 46532 0.30% 131 50128 0.32% 132 53717 0.35% 133 57797 0.37% 134 62234 0.40% 135 67908 0.44% 136 72730 0.47% 137 80545 0.52% 138 88382 0.57% 139 97216 0.63% 140 108893 0.70% 141 125167 0.80% 142 142766 0.92% 143 167626 1.08% 144 202169 1.30% 145 251244 1.62% 146 331268 2.13% 147 468409 3.01% 148 722151 4.64% 149 1372697 8.83% 150 4406952 28.34% 151 5620550 36.14% 15550326 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.24 fanout-score-rank=16 prefix-density=0.45 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=298.41 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=16.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=21 prefix-density=0.46 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=28.14 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.1 sequence=AAGGCCAAGATCCAGGACAAGGAGGG SRR7170458 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:42:21 Started mapping on | Feb 12 21:42:21 Finished on | Feb 12 21:44:14 Mapping speed, Million of reads per hour | 495.41 Number of input reads | 15550326 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 14466163 Uniquely mapped reads % | 93.03% Average mapped length | 292.11 Number of splices: Total | 14376403 Number of splices: Annotated (sjdb) | 14016018 Number of splices: GT/AG | 14112664 Number of splices: GC/AG | 212074 Number of splices: AT/AC | 8790 Number of splices: Non-canonical | 42875 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.17 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 436470 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 22408 % of reads mapped to too many loci | 0.14% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.96% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 661849 661849 661849 N_multimapping 436470 436470 436470 N_noFeature 543351 14235567 622110 N_ambiguous 280796 989 128572 UnstrandedReadsAssigned:13642016 PositiveStrandReadsAssigned:229607 NegativeStrandReadsAssigned:13715481 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170458 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170458-trimmed-pair1.fastq SRR7170458-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,550,326 reads, 13,636,127 reads pseudoaligned [quant] estimated average fragment length: 278.118 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,066 rounds 52401 SRR7170458.ke.tsv 34699 SRR7170458.se.tsv 87100 total ==> SRR7170458.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.88 1159 47.4784 Potri.005G024800.1.v4.1 1035 757.882 175 16.4672 Potri.004G059700.1.v4.1 961 683.904 18 1.87698 Potri.007G009000.2.v4.1 1416 1138.88 0 0 Potri.003G141000.2.v4.1 2943 2665.88 738.368 19.7521 Potri.016G087400.1.v4.1 270 77.8533 870 796.938 Potri.015G069301.1.v4.1 564 293.88 0 0 Potri.010G195200.1.v4.1 1773 1495.88 140 6.67441 Potri.012G127500.1.v4.1 977 699.893 63 6.41935 ==> SRR7170458.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 639 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 213 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 135 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170458 completed mapping pipeline successfully