Starting /dee2/code/volunteer_pipeline.sh SRR7170459 current disk space = 3050834231296 free memory = 1503807604 SRR7170459 SRAfilesize 7002ae718341d53b9287dc088b839fd4 SRR7170459.sra SRR7170459.sra file validated SRR7170459 is paired end SRR7170459 is conventional basespace SRR7170459 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170459_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.315 18.0 18.0 28.0 18.0 32.0 2 30.0765 31.0 29.0 31.0 27.0 33.0 3 31.229 33.0 31.0 33.0 28.0 33.0 4 32.2685 33.0 33.0 33.0 31.0 33.0 5 33.02675 33.0 33.0 34.0 33.0 34.0 6 37.2805 38.0 38.0 38.0 36.0 38.0 7 37.53525 38.0 38.0 38.0 37.0 38.0 8 37.50725 38.0 38.0 38.0 37.0 38.0 9 37.59125 38.0 38.0 38.0 38.0 38.0 10-14 37.599399999999996 38.0 38.0 38.0 38.0 38.0 15-19 37.63635000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.635000000000005 38.0 38.0 38.0 38.0 38.0 25-29 37.5472 38.0 38.0 38.0 37.8 38.0 30-34 37.5324 38.0 38.0 38.0 37.6 38.0 35-39 37.49215 38.0 38.0 38.0 37.0 38.0 40-44 37.439350000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.3895 38.0 38.0 38.0 37.0 38.0 50-54 37.20205 38.0 38.0 38.0 36.2 38.0 55-59 36.97045 38.0 38.0 38.0 35.6 38.0 60-64 36.90795 38.0 38.0 38.0 35.6 38.0 65-69 36.7587 38.0 38.0 38.0 34.8 38.0 70-74 36.6579 38.0 38.0 38.0 34.4 38.0 75-79 36.5823 38.0 38.0 38.0 34.4 38.0 80-84 36.341950000000004 38.0 37.2 38.0 33.6 38.0 85-89 36.291900000000005 38.0 37.0 38.0 33.6 38.0 90-94 36.056 38.0 37.0 38.0 32.4 38.0 95-99 36.009049999999995 38.0 36.8 38.0 32.6 38.0 100-104 35.2743 38.0 35.8 38.0 29.0 38.0 105-109 35.3577 38.0 36.0 38.0 29.4 38.0 110-114 35.19499999999999 38.0 35.6 38.0 28.8 38.0 115-119 34.833450000000006 38.0 35.0 38.0 27.4 38.0 120-124 34.410000000000004 38.0 34.6 38.0 25.6 38.0 125-129 33.9317 38.0 34.0 38.0 23.2 38.0 130-134 33.9288 38.0 34.0 38.0 23.4 38.0 135-139 32.946549999999995 37.2 32.4 38.0 17.4 38.0 140-144 32.16205 36.2 31.0 38.0 14.4 38.0 145-149 30.092200000000002 35.2 29.2 38.0 8.6 38.0 150-151 25.384625 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 3.0 11 0.0 12 1.0 13 1.0 14 2.0 15 1.0 16 2.0 17 3.0 18 0.0 19 5.0 20 6.0 21 2.0 22 5.0 23 6.0 24 9.0 25 15.0 26 15.0 27 25.0 28 36.0 29 34.0 30 46.0 31 76.0 32 102.0 33 189.0 34 328.0 35 646.0 36 1344.0 37 1098.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 37.82219884271436 10.336664913203577 11.257233035244608 40.583903208837455 2 20.925 14.95 35.35 28.775000000000002 3 20.75 18.05 28.349999999999998 32.85 4 22.400000000000002 28.549999999999997 23.325000000000003 25.724999999999998 5 21.825 33.575 24.8 19.8 6 17.549999999999997 36.55 25.85 20.05 7 14.149999999999999 24.55 42.9 18.4 8 16.950000000000003 24.95 31.724999999999998 26.375 9 17.424999999999997 24.15 34.775 23.65 10-14 19.865 29.880000000000003 27.095000000000002 23.16 15-19 19.675 28.515 28.389999999999997 23.419999999999998 20-24 20.285 28.799999999999997 27.689999999999998 23.225 25-29 19.88 29.01 27.6 23.51 30-34 20.06 27.99 28.16 23.79 35-39 19.235 29.099999999999998 27.83 23.835 40-44 19.78 28.749999999999996 27.634999999999998 23.835 45-49 19.43 28.849999999999998 27.935 23.785 50-54 20.125 28.939999999999998 27.474999999999998 23.46 55-59 19.485 28.595 28.09 23.830000000000002 60-64 19.975 28.449999999999996 27.889999999999997 23.685000000000002 65-69 19.78 28.42 28.115000000000002 23.685000000000002 70-74 20.380000000000003 27.735 27.839999999999996 24.044999999999998 75-79 20.544999999999998 28.144999999999996 27.82 23.49 80-84 20.380000000000003 28.71 27.245 23.665 85-89 20.18 28.349999999999998 27.615000000000002 23.855 90-94 20.4 28.389999999999997 28.025 23.185 95-99 20.064999999999998 28.71 27.315 23.91 100-104 20.435 29.34 27.250000000000004 22.975 105-109 20.47 28.285 27.860000000000003 23.385 110-114 20.599999999999998 28.28 27.625 23.494999999999997 115-119 20.544999999999998 28.439999999999998 27.284999999999997 23.73 120-124 20.5 28.044999999999998 27.27 24.185000000000002 125-129 20.86 27.345000000000002 27.925 23.87 130-134 20.66 27.79 27.555000000000003 23.995 135-139 20.435 27.98 27.875 23.71 140-144 20.53 27.675 27.74 24.055 145-149 20.805 27.345000000000002 27.685 24.165 150-151 20.3625 28.3375 27.474999999999998 23.825 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 1.5 14 1.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 0.5 23 1.0 24 2.5 25 4.0 26 5.5 27 4.5 28 7.0 29 17.0 30 20.5 31 23.5 32 32.5 33 40.5 34 55.0 35 75.5 36 99.0 37 126.5 38 141.0 39 157.5 40 189.5 41 224.0 42 240.0 43 256.0 44 268.5 45 258.0 46 260.5 47 253.0 48 229.5 49 207.5 50 181.5 51 146.0 52 114.0 53 93.0 54 71.0 55 52.5 56 36.0 57 26.0 58 22.5 59 16.0 60 11.5 61 7.5 62 5.5 63 5.0 64 2.0 65 1.5 66 1.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.95 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44668008048289 98.85000000000001 2 0.528169014084507 1.05 3 0.0 0.0 4 0.025150905432595575 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9624999999999999 0.0 0.0 0.0 0.0 100-101 1.1 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 2.975 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.5375 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.025 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.4375 0.0 0.0 0.0 0.0 136-137 4.675 0.0 0.0 0.0 0.0 138-139 5.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170459 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170459_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.006 33.0 33.0 34.0 32.0 34.0 2 33.16275 34.0 33.0 34.0 33.0 34.0 3 33.1885 34.0 33.0 34.0 33.0 34.0 4 33.15675 34.0 33.0 34.0 33.0 34.0 5 33.16675 34.0 33.0 34.0 33.0 34.0 6 37.4335 38.0 38.0 38.0 38.0 38.0 7 37.44875 38.0 38.0 38.0 38.0 38.0 8 37.43 38.0 38.0 38.0 38.0 38.0 9 37.424 38.0 38.0 38.0 38.0 38.0 10-14 37.3897 38.0 38.0 38.0 38.0 38.0 15-19 37.348650000000006 38.0 38.0 38.0 37.8 38.0 20-24 37.293549999999996 38.0 38.0 38.0 37.4 38.0 25-29 37.3094 38.0 38.0 38.0 38.0 38.0 30-34 37.20285 38.0 38.0 38.0 37.2 38.0 35-39 37.227599999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.25295 38.0 38.0 38.0 37.0 38.0 45-49 37.2125 38.0 38.0 38.0 37.0 38.0 50-54 37.16805000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.11635 38.0 38.0 38.0 37.0 38.0 60-64 37.08435 38.0 38.0 38.0 37.0 38.0 65-69 37.004400000000004 38.0 38.0 38.0 36.6 38.0 70-74 36.9682 38.0 38.0 38.0 36.2 38.0 75-79 36.936350000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.9007 38.0 38.0 38.0 36.0 38.0 85-89 36.75775 38.0 38.0 38.0 35.6 38.0 90-94 36.5127 38.0 38.0 38.0 34.8 38.0 95-99 36.401149999999994 38.0 38.0 38.0 34.0 38.0 100-104 36.35225 38.0 38.0 38.0 34.0 38.0 105-109 36.23015 38.0 37.8 38.0 34.0 38.0 110-114 36.08825 38.0 37.4 38.0 33.8 38.0 115-119 35.870149999999995 38.0 37.2 38.0 32.6 38.0 120-124 35.664 38.0 36.6 38.0 31.0 38.0 125-129 35.2708 38.0 36.0 38.0 30.6 38.0 130-134 34.93185 38.0 35.4 38.0 29.8 38.0 135-139 34.285 38.0 33.4 38.0 25.8 38.0 140-144 33.48975 38.0 33.0 38.0 21.2 38.0 145-149 32.355399999999996 38.0 33.0 38.0 12.4 38.0 150-151 26.307625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 3.0 5 2.0 6 0.0 7 2.0 8 2.0 9 0.0 10 1.0 11 3.0 12 0.0 13 0.0 14 1.0 15 2.0 16 4.0 17 2.0 18 0.0 19 2.0 20 5.0 21 6.0 22 7.0 23 6.0 24 6.0 25 10.0 26 15.0 27 13.0 28 21.0 29 20.0 30 30.0 31 44.0 32 80.0 33 88.0 34 136.0 35 301.0 36 850.0 37 2321.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.801100825619216 20.79059294470853 14.961220915686765 29.44708531398549 2 24.96872654490868 25.869402051538653 32.34926194645985 16.81260945709282 3 19.63972979734801 27.995996997748314 31.998999249437077 20.365273955466602 4 23.19239429572179 34.62596947710783 23.14235676757568 19.039279459594695 5 24.293219914936202 37.127845884413304 22.742056542406804 15.836877658243683 6 19.129782445611404 38.8097024256064 24.781195298824706 17.27931982995749 7 19.075 20.075000000000003 40.699999999999996 20.150000000000002 8 20.775 26.025 29.225 23.974999999999998 9 22.400000000000002 24.0 30.95 22.650000000000002 10-14 23.090772693173292 29.547386846711674 26.22155538884721 21.14028507126782 15-19 23.060377169726376 28.39277674953729 28.137661947876545 20.409184132859785 20-24 23.08654327163582 28.65432716358179 27.5887943971986 20.670335167583794 25-29 23.067300475356518 28.171128346259692 27.825869402051538 20.935701776332248 30-34 22.59194395796848 28.46634976232174 28.386289717287966 20.555416562421815 35-39 22.862146609957467 28.20615461596197 28.2661996497373 20.665499124343256 40-44 22.57741757966882 28.005402971634396 28.535694632047626 20.881484816649156 45-49 23.290138590083554 28.358432981437936 27.662980937609444 20.688447490869063 50-54 23.007255441581187 28.211158368776584 27.495621716287218 21.285964473355016 55-59 23.514108465079048 28.01681008605163 27.391434860916554 21.077646587952774 60-64 23.014959723820482 28.18832240956622 27.993195577125128 20.803522289488168 65-69 22.96222166624969 27.66574931198399 27.92594445834376 21.44608456342257 70-74 23.072304228171127 28.021015761821367 27.645734300725543 21.260945709281962 75-79 22.892169126845133 28.516387290467847 27.2604453340005 21.330998248686512 80-84 23.207405554165625 27.995996997748314 27.575681761320993 21.220915686765075 85-89 23.317488116087066 27.73580185138854 27.860895671753816 21.085814360770577 90-94 23.33750312734551 28.16112084063047 27.585689266950215 20.915686765073804 95-99 23.477608206154617 27.88591443582687 27.63572679509632 21.000750562922192 100-104 23.55148604022816 27.63434404082858 27.89952967076954 20.914640248173722 105-109 23.73661563094166 27.84449114380066 27.404182928049636 21.014710297208044 110-114 23.867900925694272 28.371278458844134 27.250437828371275 20.510382787090318 115-119 24.13309982486865 27.370527895921942 27.530647985989493 20.965724293219914 120-124 23.897923442581938 28.20115086314736 27.815861896422316 20.085063797848388 125-129 23.792844633475106 28.271203402551915 27.23042281711284 20.705529146860144 130-134 23.622717037778333 28.241180885664246 27.4906179634726 20.645484113084812 135-139 24.218163622717036 27.795846885163872 27.56067050287716 20.42531898924193 140-144 24.38829121841381 28.016012009006758 27.51563672754566 20.080060045033775 145-149 24.54340755566675 27.92594445834376 27.650738053540152 19.879909932449337 150-151 24.956217162872154 27.695771828871653 27.107830873154864 20.240180135101326 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.5 5 0.5 6 0.5 7 0.5 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.5 18 0.5 19 0.5 20 0.5 21 0.0 22 0.5 23 1.5 24 2.0 25 2.5 26 4.0 27 7.5 28 9.5 29 11.5 30 16.5 31 20.0 32 25.5 33 40.0 34 56.0 35 70.0 36 84.5 37 105.5 38 144.5 39 175.5 40 204.5 41 227.5 42 244.0 43 272.5 44 265.5 45 261.5 46 267.0 47 247.0 48 219.5 49 197.5 50 171.5 51 143.5 52 130.5 53 99.5 54 68.5 55 52.5 56 38.5 57 32.0 58 21.5 59 16.0 60 12.0 61 7.0 62 6.0 63 4.0 64 3.0 65 1.5 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.025 7 0.0 8 0.0 9 0.0 10-14 0.025 15-19 0.045 20-24 0.05 25-29 0.075 30-34 0.075 35-39 0.075 40-44 0.055 45-49 0.065 50-54 0.075 55-59 0.06 60-64 0.065 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.06999999999999999 105-109 0.06999999999999999 110-114 0.075 115-119 0.075 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.528834046839587 1.05 3 0.1007302946361118 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.30000000000000004 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8374999999999999 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.2625 0.0 0.0 0.0 0.0 104-105 1.4375 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.8625 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.3499999999999996 0.0 0.0 0.0 0.0 118-119 2.55 0.0 0.0 0.0 0.0 120-121 2.825 0.0 0.0 0.0 0.0 122-123 2.975 0.0 0.0 0.0 0.0 124-125 3.275 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.050000000000001 0.0 0.0 0.0 0.0 132-133 4.237500000000001 0.0 0.0 0.0 0.0 134-135 4.4625 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.15 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719112 spots for SRR7170459.sra Written 719112 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra Read 719105 spots for SRR7170459.sra Written 719105 spots for SRR7170459.sra SRR ids: ['SRR7170459.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_s221k_l9 SRR7170459.sra spots: 14382107 blocks: [[1, 719105], [719106, 1438210], [1438211, 2157315], [2157316, 2876420], [2876421, 3595525], [3595526, 4314630], [4314631, 5033735], [5033736, 5752840], [5752841, 6471945], [6471946, 7191050], [7191051, 7910155], [7910156, 8629260], [8629261, 9348365], [9348366, 10067470], [10067471, 10786575], [10786576, 11505680], [11505681, 12224785], [12224786, 12943890], [12943891, 13662995], [13662996, 14382107]] SRR7170459 file size 4851923 SRR7170459 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170459 SRR7170459_1.fastq SRR7170459_2.fastq Input file: SRR7170459_1.fastq Paired file: SRR7170459_2.fastq trimmed: SRR7170459-trimmed-pair1.fastq, SRR7170459-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:20:44 2025 >> started Wed Feb 12 21:21:03 2025 >> done (18.491s) 14382107 read pairs processed; of these: 15557 ( 0.11%) short read pairs filtered out after trimming by size control 21606 ( 0.15%) empty read pairs filtered out after trimming by size control 14344944 (99.74%) read pairs available; of these: 9261861 (64.57%) trimmed read pairs available after processing 5083083 (35.43%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 0 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 1 0.00% 25 8 0.00% 26 6 0.00% 27 7 0.00% 28 5 0.00% 29 3 0.00% 30 4 0.00% 31 6 0.00% 32 6 0.00% 33 12 0.00% 34 8 0.00% 35 14 0.00% 36 13 0.00% 37 13 0.00% 38 28 0.00% 39 38 0.00% 40 23 0.00% 41 29 0.00% 42 31 0.00% 43 42 0.00% 44 36 0.00% 45 42 0.00% 46 52 0.00% 47 70 0.00% 48 74 0.00% 49 102 0.00% 50 108 0.00% 51 122 0.00% 52 135 0.00% 53 149 0.00% 54 172 0.00% 55 215 0.00% 56 212 0.00% 57 237 0.00% 58 308 0.00% 59 379 0.00% 60 420 0.00% 61 479 0.00% 62 521 0.00% 63 622 0.00% 64 692 0.00% 65 701 0.00% 66 784 0.01% 67 873 0.01% 68 940 0.01% 69 1118 0.01% 70 1283 0.01% 71 1452 0.01% 72 1642 0.01% 73 1927 0.01% 74 2119 0.01% 75 2346 0.02% 76 2436 0.02% 77 2733 0.02% 78 2908 0.02% 79 3210 0.02% 80 3481 0.02% 81 3954 0.03% 82 4659 0.03% 83 5319 0.04% 84 6093 0.04% 85 6602 0.05% 86 6881 0.05% 87 7152 0.05% 88 7367 0.05% 89 7812 0.05% 90 8199 0.06% 91 9099 0.06% 92 9370 0.07% 93 10082 0.07% 94 10846 0.08% 95 11705 0.08% 96 12315 0.09% 97 12511 0.09% 98 12540 0.09% 99 12995 0.09% 100 13663 0.10% 101 13945 0.10% 102 14907 0.10% 103 15217 0.11% 104 16270 0.11% 105 17058 0.12% 106 17337 0.12% 107 18204 0.13% 108 18180 0.13% 109 18557 0.13% 110 18800 0.13% 111 19326 0.13% 112 20166 0.14% 113 20475 0.14% 114 21134 0.15% 115 22133 0.15% 116 22682 0.16% 117 23532 0.16% 118 23893 0.17% 119 24158 0.17% 120 24993 0.17% 121 25723 0.18% 122 26851 0.19% 123 27905 0.19% 124 29080 0.20% 125 30391 0.21% 126 31853 0.22% 127 33253 0.23% 128 34499 0.24% 129 36634 0.26% 130 38357 0.27% 131 40753 0.28% 132 43460 0.30% 133 46501 0.32% 134 50029 0.35% 135 54502 0.38% 136 59811 0.42% 137 66345 0.46% 138 72851 0.51% 139 82965 0.58% 140 94052 0.66% 141 109028 0.76% 142 128056 0.89% 143 152332 1.06% 144 189142 1.32% 145 241370 1.68% 146 322619 2.25% 147 463217 3.23% 148 724062 5.05% 149 1367798 9.54% 150 4032881 28.11% 151 5083083 35.43% 14344944 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=29 prefix-density=0.54 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=33 fanout-score=239.90 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=14.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=26 prefix-density=0.63 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=32 fanout-score=243.19 fanout-score-rank=1 prefix-density=0.14 prefix-fanout=16.7 sequence=GAAAGAGATGAGGCCTAACGTAAGTATTGAATTCCTCTGGTGGCTCTCTTTAACTATCCTGCTGGTTTCTGTGATCACATCTACTTCTACAGCTGCCTTTCTTGAAAGCAACTCGAGCCCCATTTTCAATGCCACAATCGGTGAAGGTAATGAAGAGGAGTTCTCTATGGAATCTGAAGTGCATCAGAGACTGCTGGCCTATCCGGGTAATCATATTAACTATAAGACTTTAGAACGACAACAAGTTTGCAATGCACAAATGTATGGCAGCTGT SRR7170459 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:21:47 Started mapping on | Feb 12 21:21:47 Finished on | Feb 12 21:23:44 Mapping speed, Million of reads per hour | 441.38 Number of input reads | 14344944 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13479253 Uniquely mapped reads % | 93.97% Average mapped length | 292.43 Number of splices: Total | 13371238 Number of splices: Annotated (sjdb) | 13056032 Number of splices: GT/AG | 13118592 Number of splices: GC/AG | 206014 Number of splices: AT/AC | 8030 Number of splices: Non-canonical | 38602 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 411095 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 36290 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463880 463880 463880 N_multimapping 411095 411095 411095 N_noFeature 497038 13245892 575603 N_ambiguous 269072 765 114025 UnstrandedReadsAssigned:12713143 PositiveStrandReadsAssigned:232596 NegativeStrandReadsAssigned:12789625 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170459 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170459-trimmed-pair1.fastq SRR7170459-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,344,944 reads, 12,730,081 reads pseudoaligned [quant] estimated average fragment length: 275.274 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR7170459.ke.tsv 34699 SRR7170459.se.tsv 87100 total ==> SRR7170459.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.73 623 25.7546 Potri.005G024800.1.v4.1 1035 760.726 147 13.9295 Potri.004G059700.1.v4.1 961 686.747 8 0.839727 Potri.007G009000.2.v4.1 1416 1141.73 0 0 Potri.003G141000.2.v4.1 2943 2668.73 501.301 13.5406 Potri.016G087400.1.v4.1 270 79.4089 701.726 637.006 Potri.015G069301.1.v4.1 564 295.379 0 0 Potri.010G195200.1.v4.1 1773 1498.73 19 0.913853 Potri.012G127500.1.v4.1 977 702.737 145 14.8737 ==> SRR7170459.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 774 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 319 Potri.001G212900.v4.1 41 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170459 completed mapping pipeline successfully