Starting /dee2/code/volunteer_pipeline.sh SRR7170460 current disk space = 3051072094208 free memory = 1039081000 SRR7170460 SRAfilesize ee6e7e66ddfcb1de9fea431e47b7804e SRR7170460.sra SRR7170460.sra file validated SRR7170460 is paired end SRR7170460 is conventional basespace SRR7170460 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170460_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.66925 18.0 18.0 28.0 18.0 32.0 2 30.28025 31.0 29.0 33.0 27.0 33.0 3 31.39525 33.0 31.0 33.0 29.0 33.0 4 32.317 33.0 33.0 33.0 31.0 33.0 5 33.08025 33.0 33.0 34.0 33.0 34.0 6 37.35375 38.0 38.0 38.0 36.0 38.0 7 37.54825 38.0 38.0 38.0 37.0 38.0 8 37.50775 38.0 38.0 38.0 37.0 38.0 9 37.62925 38.0 38.0 38.0 38.0 38.0 10-14 37.616400000000006 38.0 38.0 38.0 38.0 38.0 15-19 37.623599999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.649649999999994 38.0 38.0 38.0 38.0 38.0 25-29 37.588 38.0 38.0 38.0 38.0 38.0 30-34 37.56765 38.0 38.0 38.0 38.0 38.0 35-39 37.495799999999996 38.0 38.0 38.0 37.6 38.0 40-44 37.4365 38.0 38.0 38.0 37.0 38.0 45-49 37.421 38.0 38.0 38.0 37.0 38.0 50-54 37.22240000000001 38.0 38.0 38.0 36.2 38.0 55-59 37.0327 38.0 38.0 38.0 36.0 38.0 60-64 37.0436 38.0 38.0 38.0 35.6 38.0 65-69 36.83555 38.0 38.0 38.0 34.8 38.0 70-74 36.81695 38.0 38.0 38.0 34.8 38.0 75-79 36.724849999999996 38.0 38.0 38.0 34.4 38.0 80-84 36.497249999999994 38.0 37.8 38.0 34.0 38.0 85-89 36.328950000000006 38.0 37.0 38.0 33.6 38.0 90-94 36.2238 38.0 37.0 38.0 33.4 38.0 95-99 36.117599999999996 38.0 37.0 38.0 33.0 38.0 100-104 35.431799999999996 38.0 36.0 38.0 29.2 38.0 105-109 35.6149 38.0 36.2 38.0 30.4 38.0 110-114 35.3858 38.0 35.8 38.0 29.4 38.0 115-119 34.97295 38.0 35.2 38.0 27.8 38.0 120-124 34.67400000000001 38.0 34.8 38.0 27.0 38.0 125-129 34.212599999999995 38.0 34.0 38.0 23.8 38.0 130-134 34.18695 38.0 34.2 38.0 23.8 38.0 135-139 33.23225 38.0 32.8 38.0 18.6 38.0 140-144 32.3735 36.6 31.4 38.0 15.2 38.0 145-149 30.45135 36.0 29.8 38.0 8.6 38.0 150-151 26.107999999999997 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 1.0 18 3.0 19 2.0 20 9.0 21 3.0 22 5.0 23 3.0 24 8.0 25 16.0 26 15.0 27 19.0 28 36.0 29 39.0 30 59.0 31 71.0 32 94.0 33 170.0 34 285.0 35 517.0 36 1373.0 37 1265.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.458999484270244 10.520887055183085 12.94481691593605 36.07529654461062 2 21.175 15.5 33.375 29.95 3 18.95 19.025 29.475 32.550000000000004 4 22.5 27.375 23.425 26.700000000000003 5 22.6 30.675 24.2 22.525000000000002 6 19.675 34.375 24.6 21.349999999999998 7 13.700000000000001 26.700000000000003 41.3 18.3 8 18.575 26.525 30.25 24.65 9 17.05 25.5 32.800000000000004 24.65 10-14 19.11 30.31 27.275 23.305 15-19 19.98 28.74 27.55 23.73 20-24 19.72 28.845 27.744999999999997 23.69 25-29 19.78 28.544999999999998 27.694999999999997 23.98 30-34 19.384999999999998 28.87 27.705000000000002 24.04 35-39 20.044999999999998 28.544999999999998 27.685 23.724999999999998 40-44 19.655 28.945 27.889999999999997 23.51 45-49 20.080000000000002 28.660000000000004 27.200000000000003 24.060000000000002 50-54 19.875 28.74 27.82 23.565 55-59 20.325 28.29 27.685 23.7 60-64 19.925 27.994999999999997 28.315 23.765 65-69 20.085 27.794999999999998 28.249999999999996 23.87 70-74 19.925 28.095 27.685 24.295 75-79 20.21 28.084999999999997 27.725 23.98 80-84 20.206010300515025 27.75638781939097 27.541377068853446 24.496224811240563 85-89 20.435 28.105000000000004 27.62 23.84 90-94 20.275000000000002 28.060000000000002 27.639999999999997 24.025 95-99 20.145 28.03 28.060000000000002 23.765 100-104 20.419999999999998 28.26 27.495000000000005 23.825 105-109 20.369999999999997 28.26 27.439999999999998 23.93 110-114 20.89 27.794999999999998 27.560000000000002 23.755000000000003 115-119 20.94 28.37 27.125 23.565 120-124 20.52 27.665 27.229999999999997 24.585 125-129 20.1 27.61 27.525 24.765 130-134 20.655 27.55 27.485 24.310000000000002 135-139 20.24 27.900000000000002 27.305 24.555 140-144 20.97 26.8 27.72 24.51 145-149 20.11 27.894999999999996 27.705000000000002 24.29 150-151 20.3625 27.450000000000003 27.6875 24.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.0 20 1.5 21 1.0 22 1.0 23 2.5 24 2.0 25 3.0 26 7.0 27 8.0 28 7.0 29 6.5 30 10.5 31 25.5 32 41.0 33 53.0 34 65.0 35 83.5 36 99.0 37 119.5 38 135.5 39 138.0 40 166.0 41 215.0 42 237.0 43 228.0 44 253.0 45 258.0 46 244.0 47 252.0 48 232.5 49 204.0 50 193.5 51 168.5 52 122.0 53 104.0 54 85.0 55 58.0 56 51.5 57 38.0 58 27.0 59 18.5 60 8.5 61 7.5 62 8.0 63 5.5 64 0.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.005 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.625 #Duplication Level Percentage of deduplicated Percentage of total 1 98.98605830164765 97.625 2 0.7604562737642585 1.5 3 0.17743979721166034 0.525 4 0.050697084917617236 0.2 5 0.0 0.0 6 0.025348542458808618 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.675 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 0.9375 0.0 0.0 0.0 0.0 102-103 1.15 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.55 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.1375 0.0 0.0 0.0 0.0 116-117 2.3125 0.0 0.0 0.0 0.0 118-119 2.6375 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.0625 0.0 0.0 0.0 0.0 124-125 3.2750000000000004 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 3.9875 0.0 0.0 0.0 0.0 132-133 4.362500000000001 0.0 0.0 0.0 0.0 134-135 4.5625 0.0 0.0 0.0 0.0 136-137 4.9375 0.0 0.0 0.0 0.0 138-139 5.2625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGCTGA 10 0.006836113 144.9625 3 >>END_MODULE SRR7170460 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170460_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.012 33.0 33.0 34.0 32.0 34.0 2 33.0975 34.0 33.0 34.0 33.0 34.0 3 33.12075 34.0 33.0 34.0 33.0 34.0 4 33.121 34.0 33.0 34.0 33.0 34.0 5 33.0685 34.0 33.0 34.0 33.0 34.0 6 37.30875 38.0 38.0 38.0 38.0 38.0 7 37.3335 38.0 38.0 38.0 38.0 38.0 8 37.301 38.0 38.0 38.0 38.0 38.0 9 37.31625 38.0 38.0 38.0 38.0 38.0 10-14 37.2895 38.0 38.0 38.0 38.0 38.0 15-19 37.24395 38.0 38.0 38.0 38.0 38.0 20-24 37.19255 38.0 38.0 38.0 38.0 38.0 25-29 37.19525 38.0 38.0 38.0 38.0 38.0 30-34 37.19645 38.0 38.0 38.0 37.8 38.0 35-39 37.1595 38.0 38.0 38.0 37.8 38.0 40-44 37.1661 38.0 38.0 38.0 37.8 38.0 45-49 37.114650000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.077549999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.0267 38.0 38.0 38.0 37.0 38.0 60-64 36.9919 38.0 38.0 38.0 37.0 38.0 65-69 36.935199999999995 38.0 38.0 38.0 37.0 38.0 70-74 36.94815 38.0 38.0 38.0 37.0 38.0 75-79 36.87675 38.0 38.0 38.0 36.4 38.0 80-84 36.861 38.0 38.0 38.0 36.0 38.0 85-89 36.65259999999999 38.0 38.0 38.0 35.6 38.0 90-94 36.62145 38.0 38.0 38.0 35.4 38.0 95-99 36.4388 38.0 38.0 38.0 34.6 38.0 100-104 36.3787 38.0 38.0 38.0 34.2 38.0 105-109 36.31755 38.0 38.0 38.0 34.4 38.0 110-114 36.16835 38.0 38.0 38.0 34.0 38.0 115-119 35.9739 38.0 37.6 38.0 33.8 38.0 120-124 35.708600000000004 38.0 37.0 38.0 32.2 38.0 125-129 35.4213 38.0 36.4 38.0 31.0 38.0 130-134 34.9872 38.0 36.0 38.0 29.8 38.0 135-139 34.51155 38.0 34.8 38.0 27.6 38.0 140-144 33.98365 38.0 33.6 38.0 25.2 38.0 145-149 33.2268 38.0 33.0 38.0 19.4 38.0 150-151 27.624499999999998 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 11.0 4 3.0 5 1.0 6 4.0 7 2.0 8 1.0 9 4.0 10 1.0 11 0.0 12 4.0 13 1.0 14 1.0 15 2.0 16 3.0 17 4.0 18 8.0 19 4.0 20 11.0 21 2.0 22 7.0 23 4.0 24 6.0 25 8.0 26 9.0 27 15.0 28 12.0 29 24.0 30 26.0 31 28.0 32 45.0 33 66.0 34 116.0 35 248.0 36 727.0 37 2579.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.25293970477858 21.641230923192396 15.536652489367025 25.569176882662 2 27.120340255191394 26.745058794095574 27.995996997748314 18.138603952964726 3 20.41531148361271 30.998248686514884 29.146860145108832 19.439579684763572 4 24.218163622717036 34.450838128596445 23.267450587940957 18.06354766074556 5 24.843632724543408 36.42732049036778 21.441080810607957 17.28796597448086 6 20.280070017504375 37.934483620905226 23.58089522380595 18.204551137784446 7 20.0 22.1 37.65 20.25 8 22.280570142535634 26.981745436359088 26.18154538634659 24.55613903475869 9 22.330582645661416 26.581645411352838 28.582145536384097 22.50562640660165 10-14 23.840960240060017 28.68217054263566 26.061515378844714 21.415353838459612 15-19 23.515878969742435 28.33208302075519 27.09677419354839 21.05526381595399 20-24 23.299319727891156 29.041616646658664 26.965786314525808 20.69327731092437 25-29 23.579431772709082 28.08623449379752 27.2108843537415 21.123449379751904 30-34 23.6853955070796 28.55355981387902 27.262720768499527 20.498323910541853 35-39 23.031121785249674 28.349844891424 27.16401481036726 21.45501851295907 40-44 23.533236632821488 28.89511328965138 26.719351773120593 20.852298304406542 45-49 23.472041612483746 27.748324497349202 27.838351505451637 20.941282384715414 50-54 23.103086080128044 28.715050267593657 26.87440604211474 21.307457610163556 55-59 23.85215564669401 27.548264479343803 27.0481144343303 21.55146543963189 60-64 23.612083625087525 28.19845953786136 26.748024407322195 21.44143242972892 65-69 24.222111055527765 27.318659329664836 26.89344672336168 21.56578289144572 70-74 23.97058087757042 27.803071996797918 27.58292890378746 20.643418221844197 75-79 23.931752226558594 27.434203942759932 27.098969278494945 21.535074552186533 80-84 23.6977733299975 27.93094821115837 26.509882411808857 21.861396047035274 85-89 24.59844883662747 27.950963222416814 26.67500625469102 20.7755816862647 90-94 23.50763072304228 28.07605704278209 27.220415311483613 21.19589692269202 95-99 24.098254039721848 28.13547451098104 26.464555505528043 21.30171594376907 100-104 23.76425855513308 27.556533920352212 27.056233740244146 21.622973784270563 105-109 23.890750837877047 28.287729478265216 26.636986643989797 21.18453303986794 110-114 24.39463678206924 27.9467680608365 27.516509905943565 20.14208525115069 115-119 24.344606764058437 27.98679207524515 27.416449869921955 20.252151290774464 120-124 23.85789342006505 28.29121841381036 26.99524643482612 20.855641731298473 125-129 24.48836627470603 27.980985739304476 27.080310232674503 20.450337753314987 130-134 23.577683262446836 28.17613209907431 26.965223917938452 21.280960720540406 135-139 25.103827870903178 27.240430322742053 27.240430322742053 20.41531148361271 140-144 24.153114836127095 27.840880660495372 27.110332749562172 20.89567175381536 145-149 25.474105579184386 27.47560670502877 27.46059544658494 19.5896922692019 150-151 25.22511255627814 28.064032016008007 27.101050525262632 19.609804902451224 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 1.5 20 1.0 21 1.0 22 1.5 23 1.5 24 1.5 25 1.5 26 3.0 27 5.5 28 7.0 29 5.5 30 6.0 31 9.0 32 13.0 33 21.0 34 36.0 35 60.5 36 77.0 37 97.5 38 123.0 39 142.0 40 171.0 41 205.0 42 250.0 43 275.0 44 277.0 45 270.0 46 254.5 47 255.5 48 240.5 49 220.0 50 196.5 51 159.0 52 134.0 53 108.0 54 94.0 55 80.0 56 56.5 57 43.0 58 33.5 59 23.5 60 15.0 61 8.5 62 3.5 63 2.5 64 1.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.025 7 0.0 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.04 25-29 0.04 30-34 0.065 35-39 0.06999999999999999 40-44 0.034999999999999996 45-49 0.03 50-54 0.034999999999999996 55-59 0.03 60-64 0.03 65-69 0.05 70-74 0.065 75-79 0.06999999999999999 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.055 100-104 0.06 105-109 0.045 110-114 0.06 115-119 0.06 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.05 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.25 #Duplication Level Percentage of deduplicated Percentage of total 1 98.80407124681933 97.075 2 0.8651399491094147 1.7000000000000002 3 0.2035623409669211 0.6 4 0.07633587786259542 0.3 5 0.0 0.0 6 0.02544529262086514 0.15 7 0.02544529262086514 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 7 0.17500000000000002 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.0625 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.23750000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.9125 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.1624999999999996 0.0 0.0 0.0 0.0 116-117 2.3375 0.0 0.0 0.0 0.0 118-119 2.6625 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.325 0.0 0.0 0.0 0.0 126-127 3.5625 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 4.1 0.0 0.0 0.0 0.0 132-133 4.475 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 5.050000000000001 0.0 0.0 0.0 0.0 138-139 5.4125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519796 spots for SRR7170460.sra Written 519796 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra Read 519789 spots for SRR7170460.sra Written 519789 spots for SRR7170460.sra SRR ids: ['SRR7170460.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_aa5ss02c SRR7170460.sra spots: 10395787 blocks: [[1, 519789], [519790, 1039578], [1039579, 1559367], [1559368, 2079156], [2079157, 2598945], [2598946, 3118734], [3118735, 3638523], [3638524, 4158312], [4158313, 4678101], [4678102, 5197890], [5197891, 5717679], [5717680, 6237468], [6237469, 6757257], [6757258, 7277046], [7277047, 7796835], [7796836, 8316624], [8316625, 8836413], [8836414, 9356202], [9356203, 9875991], [9875992, 10395787]] SRR7170460 file size 3501090 SRR7170460 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170460 SRR7170460_1.fastq SRR7170460_2.fastq Input file: SRR7170460_1.fastq Paired file: SRR7170460_2.fastq trimmed: SRR7170460-trimmed-pair1.fastq, SRR7170460-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 20:55:58 2025 >> started Wed Feb 12 20:56:11 2025 >> done (13.180s) 10395787 read pairs processed; of these: 19439 ( 0.19%) short read pairs filtered out after trimming by size control 34335 ( 0.33%) empty read pairs filtered out after trimming by size control 10342013 (99.48%) read pairs available; of these: 6450363 (62.37%) trimmed read pairs available after processing 3891650 (37.63%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 4 0.00% 22 1 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 6 0.00% 27 8 0.00% 28 2 0.00% 29 6 0.00% 30 5 0.00% 31 10 0.00% 32 4 0.00% 33 9 0.00% 34 5 0.00% 35 6 0.00% 36 21 0.00% 37 10 0.00% 38 14 0.00% 39 26 0.00% 40 30 0.00% 41 20 0.00% 42 23 0.00% 43 29 0.00% 44 44 0.00% 45 45 0.00% 46 49 0.00% 47 66 0.00% 48 69 0.00% 49 69 0.00% 50 83 0.00% 51 101 0.00% 52 100 0.00% 53 145 0.00% 54 115 0.00% 55 128 0.00% 56 177 0.00% 57 169 0.00% 58 202 0.00% 59 254 0.00% 60 314 0.00% 61 305 0.00% 62 354 0.00% 63 446 0.00% 64 486 0.00% 65 522 0.01% 66 577 0.01% 67 629 0.01% 68 648 0.01% 69 785 0.01% 70 849 0.01% 71 1037 0.01% 72 1133 0.01% 73 1323 0.01% 74 1494 0.01% 75 1712 0.02% 76 1864 0.02% 77 2152 0.02% 78 2193 0.02% 79 2487 0.02% 80 2595 0.03% 81 3163 0.03% 82 3573 0.03% 83 4073 0.04% 84 5009 0.05% 85 5617 0.05% 86 5871 0.06% 87 6003 0.06% 88 6199 0.06% 89 6300 0.06% 90 6517 0.06% 91 6860 0.07% 92 7229 0.07% 93 8028 0.08% 94 8680 0.08% 95 9090 0.09% 96 9481 0.09% 97 9797 0.09% 98 9804 0.09% 99 10103 0.10% 100 10526 0.10% 101 10643 0.10% 102 11359 0.11% 103 11814 0.11% 104 12372 0.12% 105 13166 0.13% 106 13567 0.13% 107 13671 0.13% 108 13816 0.13% 109 14122 0.14% 110 14339 0.14% 111 14611 0.14% 112 15281 0.15% 113 15930 0.15% 114 16502 0.16% 115 17081 0.17% 116 17669 0.17% 117 17835 0.17% 118 18128 0.18% 119 18218 0.18% 120 18817 0.18% 121 19283 0.19% 122 19738 0.19% 123 20780 0.20% 124 22079 0.21% 125 22776 0.22% 126 23958 0.23% 127 25029 0.24% 128 25391 0.25% 129 26623 0.26% 130 28096 0.27% 131 29660 0.29% 132 31075 0.30% 133 32968 0.32% 134 35545 0.34% 135 38601 0.37% 136 42075 0.41% 137 46314 0.45% 138 50593 0.49% 139 56146 0.54% 140 63589 0.61% 141 72366 0.70% 142 83863 0.81% 143 99230 0.96% 144 122268 1.18% 145 156001 1.51% 146 207306 2.00% 147 296301 2.87% 148 469572 4.54% 149 913053 8.83% 150 2903242 28.07% 151 3891650 37.63% 10342013 reads passed initial QC criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=26 prefix-density=0.85 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.16 sequence-density-rank=26 fanout-score=27.32 fanout-score-rank=1 prefix-density=0.45 prefix-fanout=9.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.78 sequence-density-rank=1 fanout-score=2.80 fanout-score-rank=9 prefix-density=1.11 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=49.66 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=5.5 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170460 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 20:56:59 Started mapping on | Feb 12 20:56:59 Finished on | Feb 12 20:58:18 Mapping speed, Million of reads per hour | 471.28 Number of input reads | 10342013 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 9613969 Uniquely mapped reads % | 92.96% Average mapped length | 292.47 Number of splices: Total | 9728252 Number of splices: Annotated (sjdb) | 9529230 Number of splices: GT/AG | 9544308 Number of splices: GC/AG | 154164 Number of splices: AT/AC | 6158 Number of splices: Non-canonical | 23622 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.02 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 255153 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 11459 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.42% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 485104 485104 485104 N_multimapping 255153 255153 255153 N_noFeature 214962 9419875 255551 N_ambiguous 238684 483 85098 UnstrandedReadsAssigned:9160323 PositiveStrandReadsAssigned:193611 NegativeStrandReadsAssigned:9273320 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170460 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170460-trimmed-pair1.fastq SRR7170460-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,342,013 reads, 9,203,173 reads pseudoaligned [quant] estimated average fragment length: 260.549 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,110 rounds 52401 SRR7170460.ke.tsv 34699 SRR7170460.se.tsv 87100 total ==> SRR7170460.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.45 211 9.02397 Potri.005G024800.1.v4.1 1035 775.451 131 12.7046 Potri.004G059700.1.v4.1 961 701.461 13 1.39375 Potri.007G009000.2.v4.1 1416 1156.45 0 0 Potri.003G141000.2.v4.1 2943 2683.45 208 5.82928 Potri.016G087400.1.v4.1 270 77.6394 535.337 518.549 Potri.015G069301.1.v4.1 564 307.758 0 0 Potri.010G195200.1.v4.1 1773 1513.45 3 0.149073 Potri.012G127500.1.v4.1 977 717.456 78 8.17607 ==> SRR7170460.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 203 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 270 Potri.001G212900.v4.1 38 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 1 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170460 completed mapping pipeline successfully