Starting /dee2/code/volunteer_pipeline.sh SRR7170461 current disk space = 3050661511168 free memory = 1579906756 SRR7170461 SRAfilesize dc6f74ea99a9b1be128789c6eb7931a5 SRR7170461.sra SRR7170461.sra file validated SRR7170461 is paired end SRR7170461 is conventional basespace SRR7170461 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170461_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.24725 18.0 18.0 18.0 18.0 32.0 2 25.7675 27.0 25.0 27.0 18.0 30.0 3 26.94475 27.0 25.0 30.0 18.0 31.0 4 29.9795 31.0 29.0 33.0 27.0 33.0 5 30.74075 31.0 29.0 33.0 28.0 33.0 6 35.747 37.0 36.0 38.0 31.0 38.0 7 36.72125 38.0 37.0 38.0 34.0 38.0 8 36.95375 38.0 38.0 38.0 35.0 38.0 9 37.0995 38.0 38.0 38.0 36.0 38.0 10-14 37.3134 38.0 38.0 38.0 36.2 38.0 15-19 37.43455 38.0 38.0 38.0 37.0 38.0 20-24 37.46805 38.0 38.0 38.0 37.0 38.0 25-29 37.3656 38.0 38.0 38.0 37.0 38.0 30-34 37.46565 38.0 38.0 38.0 37.0 38.0 35-39 37.42705 38.0 38.0 38.0 37.0 38.0 40-44 36.7008 38.0 37.2 38.0 32.8 38.0 45-49 36.164249999999996 38.0 37.0 38.0 29.4 38.0 50-54 37.027249999999995 38.0 38.0 38.0 35.8 38.0 55-59 37.1278 38.0 38.0 38.0 36.0 38.0 60-64 37.0751 38.0 38.0 38.0 36.0 38.0 65-69 37.01915000000001 38.0 38.0 38.0 35.6 38.0 70-74 36.86495 38.0 38.0 38.0 34.8 38.0 75-79 36.78985 38.0 38.0 38.0 34.8 38.0 80-84 36.7029 38.0 37.8 38.0 34.2 38.0 85-89 36.35935 38.0 37.2 38.0 33.4 38.0 90-94 36.083549999999995 38.0 37.0 38.0 32.6 38.0 95-99 36.19375 38.0 37.0 38.0 33.4 38.0 100-104 36.1598 38.0 37.0 38.0 33.2 38.0 105-109 36.096700000000006 38.0 37.0 38.0 32.8 38.0 110-114 35.70960000000001 38.0 36.6 38.0 31.2 38.0 115-119 35.2518 38.0 36.0 38.0 28.6 38.0 120-124 35.25665 38.0 35.8 38.0 28.8 38.0 125-129 34.9488 38.0 35.0 38.0 27.6 38.0 130-134 34.578900000000004 38.0 35.0 38.0 26.0 38.0 135-139 34.168850000000006 38.0 34.2 38.0 24.2 38.0 140-144 33.386399999999995 38.0 33.2 38.0 21.0 38.0 145-149 32.4505 38.0 32.8 38.0 16.4 38.0 150-151 26.99475 34.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 15 2.0 16 0.0 17 3.0 18 0.0 19 5.0 20 1.0 21 3.0 22 1.0 23 3.0 24 3.0 25 13.0 26 8.0 27 19.0 28 29.0 29 38.0 30 63.0 31 76.0 32 116.0 33 178.0 34 312.0 35 548.0 36 1367.0 37 1212.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 27.583527583527584 29.422429422429424 7.355607355607356 35.63843563843564 2 21.625 15.45 35.325 27.6 3 19.975 20.9 25.75 33.375 4 22.525000000000002 28.325 23.05 26.1 5 22.625 32.074999999999996 25.275 20.025000000000002 6 18.099999999999998 35.725 24.625 21.55 7 13.5 24.575 42.95 18.975 8 16.900000000000002 25.224999999999998 32.225 25.650000000000002 9 16.5 23.95 35.4 24.15 10-14 19.2 29.57 27.750000000000004 23.48 15-19 19.1 29.32 27.91 23.669999999999998 20-24 19.759999999999998 28.515 28.1 23.625 25-29 19.775000000000002 28.95 27.83 23.445 30-34 18.709999999999997 29.39 28.365000000000002 23.535 35-39 19.35 28.71 27.91 24.03 40-44 19.547932189828472 29.189378406761012 27.644146621993297 23.61854278141721 45-49 20.064999999999998 29.265 27.400000000000002 23.27 50-54 20.235 28.825 27.43 23.51 55-59 19.98 28.999999999999996 27.994999999999997 23.025000000000002 60-64 19.705000000000002 28.405 28.299999999999997 23.59 65-69 20.150000000000002 28.62 27.644999999999996 23.585 70-74 19.869999999999997 29.304999999999996 27.11 23.715 75-79 19.825 28.694999999999997 27.73 23.75 80-84 19.64 28.799999999999997 27.750000000000004 23.810000000000002 85-89 19.305 29.2 27.834999999999997 23.66 90-94 19.532929939490923 29.03435515327299 27.459118867830174 23.973596039405912 95-99 19.84 28.46 27.96 23.74 100-104 20.32 28.970000000000002 27.16 23.549999999999997 105-109 20.205000000000002 28.349999999999998 27.555000000000003 23.89 110-114 20.044999999999998 28.03 28.194999999999997 23.73 115-119 19.89 28.96 28.194999999999997 22.955000000000002 120-124 19.950000000000003 28.46 27.49 24.099999999999998 125-129 20.265 28.794999999999998 27.084999999999997 23.855 130-134 20.585 28.410000000000004 27.860000000000003 23.145 135-139 21.04 28.249999999999996 27.51 23.200000000000003 140-144 20.24 27.955000000000002 28.144999999999996 23.66 145-149 20.169999999999998 28.549999999999997 27.37 23.91 150-151 19.825 28.125 27.800000000000004 24.25 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 3.0 24 4.0 25 3.0 26 6.5 27 11.0 28 12.5 29 19.0 30 30.5 31 29.5 32 37.0 33 58.5 34 66.0 35 80.0 36 92.5 37 113.0 38 146.0 39 168.0 40 203.5 41 232.5 42 251.0 43 266.0 44 260.0 45 252.0 46 262.0 47 252.0 48 222.5 49 196.0 50 158.0 51 131.0 52 112.5 53 89.0 54 64.5 55 45.0 56 37.0 57 28.5 58 15.5 59 11.5 60 7.0 61 3.5 62 4.5 63 3.0 64 2.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4750000000000005 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.57297161517207 99.1 2 0.37678975131876413 0.75 3 0.050238633509168545 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.1875 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.475 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.625 0.0 0.0 0.0 0.0 100-101 0.7 0.0 0.0 0.0 0.0 102-103 0.875 0.0 0.0 0.0 0.0 104-105 1.0125 0.0 0.0 0.0 0.0 106-107 1.2375 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.7125 0.0 0.0 0.0 0.0 114-115 1.9625 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.45 0.0 0.0 0.0 0.0 120-121 2.6500000000000004 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.225 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.7125 0.0 0.0 0.0 0.0 130-131 3.9625000000000004 0.0 0.0 0.0 0.0 132-133 4.262499999999999 0.0 0.0 0.0 0.0 134-135 4.65 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.0375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTGGTTA 10 0.0068378756 144.95 2 >>END_MODULE SRR7170461 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170461_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.3925 33.0 32.0 34.0 31.0 34.0 2 32.83275 33.0 33.0 34.0 32.0 34.0 3 30.54925 33.0 31.0 34.0 18.0 34.0 4 32.09075 33.0 32.0 34.0 27.0 34.0 5 32.711 33.0 33.0 34.0 32.0 34.0 6 37.073 38.0 38.0 38.0 36.0 38.0 7 36.78875 38.0 38.0 38.0 35.0 38.0 8 37.0845 38.0 38.0 38.0 36.0 38.0 9 37.189 38.0 38.0 38.0 36.0 38.0 10-14 37.1476 38.0 38.0 38.0 36.2 38.0 15-19 37.150999999999996 38.0 38.0 38.0 36.6 38.0 20-24 36.9231 38.0 38.0 38.0 35.8 38.0 25-29 36.768150000000006 38.0 38.0 38.0 35.2 38.0 30-34 36.979299999999995 38.0 38.0 38.0 36.0 38.0 35-39 37.02419999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.1731 38.0 37.2 38.0 30.4 38.0 45-49 37.00345 38.0 38.0 38.0 35.8 38.0 50-54 36.98175 38.0 38.0 38.0 36.0 38.0 55-59 35.61105 38.0 36.0 38.0 29.6 38.0 60-64 36.26485 38.0 37.6 38.0 32.6 38.0 65-69 36.0874 38.0 37.4 38.0 30.6 38.0 70-74 35.6872 38.0 36.6 38.0 30.2 38.0 75-79 36.52685 38.0 37.8 38.0 34.0 38.0 80-84 36.61135 38.0 38.0 38.0 34.4 38.0 85-89 36.430949999999996 38.0 38.0 38.0 34.0 38.0 90-94 36.44815 38.0 38.0 38.0 34.0 38.0 95-99 36.24934999999999 38.0 37.0 38.0 33.8 38.0 100-104 35.96255 38.0 37.0 38.0 33.0 38.0 105-109 35.739450000000005 38.0 36.8 38.0 31.6 38.0 110-114 35.67535 38.0 36.8 38.0 31.4 38.0 115-119 35.2695 38.0 36.2 38.0 29.2 38.0 120-124 35.02255 38.0 35.6 38.0 28.0 38.0 125-129 34.33645 38.0 34.2 38.0 24.4 38.0 130-134 34.217699999999994 38.0 33.4 38.0 24.8 38.0 135-139 33.602 38.0 33.0 38.0 22.0 38.0 140-144 32.52829999999999 38.0 32.6 38.0 14.0 38.0 145-149 31.50605 37.6 31.6 38.0 8.6 38.0 150-151 25.94525 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 4.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 1.0 10 0.0 11 2.0 12 1.0 13 2.0 14 2.0 15 2.0 16 1.0 17 2.0 18 6.0 19 4.0 20 7.0 21 4.0 22 13.0 23 11.0 24 20.0 25 12.0 26 24.0 27 37.0 28 36.0 29 49.0 30 60.0 31 78.0 32 119.0 33 155.0 34 265.0 35 418.0 36 997.0 37 1665.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.775 21.0 12.15 28.075 2 25.424999999999997 26.85 32.25 15.475 3 20.775 27.500000000000004 32.65 19.075 4 22.475 35.0 22.775000000000002 19.75 5 22.325 37.5 23.375 16.8 6 19.525000000000002 37.5 25.374999999999996 17.599999999999998 7 19.825 21.099999999999998 39.550000000000004 19.525000000000002 8 20.775 26.05 28.075 25.1 9 20.925 25.324999999999996 30.8 22.95 10-14 23.255 28.845 27.355 20.544999999999998 15-19 22.16 28.725 28.549999999999997 20.565 20-24 22.325 29.049999999999997 28.28 20.345 25-29 22.73 28.7 28.04 20.53 30-34 22.31 28.77 28.249999999999996 20.669999999999998 35-39 22.31 28.255000000000003 28.54 20.895 40-44 22.595000000000002 28.084999999999997 28.615000000000002 20.705000000000002 45-49 22.45 28.26 28.205000000000002 21.085 50-54 22.63 28.01 28.144999999999996 21.215 55-59 23.055 28.084999999999997 28.01 20.849999999999998 60-64 21.92 28.025 28.895 21.16 65-69 22.685 28.235 27.57 21.51 70-74 23.044999999999998 28.34 28.02 20.595 75-79 22.905 27.965 28.310000000000002 20.82 80-84 22.32 28.560000000000002 27.644999999999996 21.475 85-89 23.24 27.575 28.189999999999998 20.995 90-94 23.655 27.255000000000003 28.175 20.915 95-99 23.23 28.78 27.950000000000003 20.04 100-104 23.345 28.294999999999998 27.395000000000003 20.965 105-109 23.3 28.065 28.050000000000004 20.585 110-114 23.415 28.935 27.565 20.085 115-119 23.419999999999998 28.299999999999997 27.805000000000003 20.474999999999998 120-124 23.82 27.83 28.09 20.26 125-129 23.974999999999998 28.325 27.295 20.405 130-134 23.855 28.485 28.005000000000003 19.655 135-139 23.724999999999998 28.01 28.044999999999998 20.22 140-144 24.26 27.905 27.425 20.41 145-149 24.175 27.965 28.060000000000002 19.8 150-151 24.087500000000002 27.6375 28.975 19.3 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 2.5 23 3.0 24 4.0 25 4.0 26 4.5 27 9.0 28 11.5 29 13.0 30 18.0 31 23.5 32 32.0 33 48.0 34 64.5 35 74.5 36 96.0 37 118.5 38 150.5 39 179.5 40 204.5 41 242.5 42 261.0 43 274.5 44 278.0 45 262.5 46 247.0 47 235.0 48 217.0 49 192.5 50 162.5 51 126.5 52 98.5 53 89.5 54 76.5 55 50.5 56 33.0 57 27.5 58 21.5 59 16.0 60 9.0 61 4.0 62 4.0 63 2.0 64 1.5 65 1.0 66 0.0 67 0.0 68 1.0 69 1.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54614220877458 98.7 2 0.3530005042864347 0.7000000000000001 3 0.0 0.0 4 0.02521432173474534 0.1 5 0.02521432173474534 0.125 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.02521432173474534 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit GAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCA 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.0125 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2125 0.0 0.0 0.0 0.0 88-89 0.2875 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9750000000000001 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.3625 0.0 0.0 0.0 0.0 110-111 1.525 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.9249999999999998 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.5999999999999996 0.0 0.0 0.0 0.0 122-123 2.8875 0.0 0.0 0.0 0.0 124-125 3.1624999999999996 0.0 0.0 0.0 0.0 126-127 3.4375 0.0 0.0 0.0 0.0 128-129 3.6875 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.1875 0.0 0.0 0.0 0.0 134-135 4.55 0.0 0.0 0.0 0.0 136-137 4.6875 0.0 0.0 0.0 0.0 138-139 4.9375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664684 spots for SRR7170461.sra Written 664684 spots for SRR7170461.sra Read 664686 spots for SRR7170461.sra Written 664686 spots for SRR7170461.sra SRR ids: ['SRR7170461.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gfd0s7qg SRR7170461.sra spots: 13293682 blocks: [[1, 664684], [664685, 1329368], [1329369, 1994052], [1994053, 2658736], [2658737, 3323420], [3323421, 3988104], [3988105, 4652788], [4652789, 5317472], [5317473, 5982156], [5982157, 6646840], [6646841, 7311524], [7311525, 7976208], [7976209, 8640892], [8640893, 9305576], [9305577, 9970260], [9970261, 10634944], [10634945, 11299628], [11299629, 11964312], [11964313, 12628996], [12628997, 13293682]] SRR7170461 file size 4483092 SRR7170461 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170461 SRR7170461_1.fastq SRR7170461_2.fastq Input file: SRR7170461_1.fastq Paired file: SRR7170461_2.fastq trimmed: SRR7170461-trimmed-pair1.fastq, SRR7170461-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:41:00 2025 >> started Wed Feb 12 21:41:14 2025 >> done (13.869s) 13293682 read pairs processed; of these: 8213 ( 0.06%) short read pairs filtered out after trimming by size control 7275 ( 0.05%) empty read pairs filtered out after trimming by size control 13278194 (99.88%) read pairs available; of these: 7406432 (55.78%) trimmed read pairs available after processing 5871762 (44.22%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 5 0.00% 24 2 0.00% 25 5 0.00% 26 1 0.00% 27 2 0.00% 28 1 0.00% 29 4 0.00% 30 5 0.00% 31 2 0.00% 32 6 0.00% 33 6 0.00% 34 5 0.00% 35 6 0.00% 36 7 0.00% 37 9 0.00% 38 10 0.00% 39 16 0.00% 40 17 0.00% 41 24 0.00% 42 32 0.00% 43 28 0.00% 44 27 0.00% 45 29 0.00% 46 35 0.00% 47 46 0.00% 48 49 0.00% 49 63 0.00% 50 66 0.00% 51 79 0.00% 52 97 0.00% 53 102 0.00% 54 119 0.00% 55 105 0.00% 56 125 0.00% 57 163 0.00% 58 205 0.00% 59 211 0.00% 60 279 0.00% 61 311 0.00% 62 329 0.00% 63 373 0.00% 64 374 0.00% 65 439 0.00% 66 470 0.00% 67 554 0.00% 68 541 0.00% 69 635 0.00% 70 785 0.01% 71 937 0.01% 72 1018 0.01% 73 1211 0.01% 74 1334 0.01% 75 1451 0.01% 76 1601 0.01% 77 1779 0.01% 78 1883 0.01% 79 2007 0.02% 80 2246 0.02% 81 2575 0.02% 82 2976 0.02% 83 3393 0.03% 84 3940 0.03% 85 4516 0.03% 86 4588 0.03% 87 4958 0.04% 88 5331 0.04% 89 5586 0.04% 90 6100 0.05% 91 6535 0.05% 92 7124 0.05% 93 7877 0.06% 94 8138 0.06% 95 8694 0.07% 96 9019 0.07% 97 9456 0.07% 98 9649 0.07% 99 10140 0.08% 100 10778 0.08% 101 10982 0.08% 102 11747 0.09% 103 12590 0.09% 104 12992 0.10% 105 13638 0.10% 106 14145 0.11% 107 14351 0.11% 108 14872 0.11% 109 15170 0.11% 110 15444 0.12% 111 16059 0.12% 112 16775 0.13% 113 17434 0.13% 114 18203 0.14% 115 18740 0.14% 116 19634 0.15% 117 19938 0.15% 118 20447 0.15% 119 20815 0.16% 120 21389 0.16% 121 22131 0.17% 122 23113 0.17% 123 24434 0.18% 124 25318 0.19% 125 26348 0.20% 126 27376 0.21% 127 28875 0.22% 128 29705 0.22% 129 31236 0.24% 130 32454 0.24% 131 34298 0.26% 132 36367 0.27% 133 38949 0.29% 134 42036 0.32% 135 44878 0.34% 136 48883 0.37% 137 53469 0.40% 138 58706 0.44% 139 64853 0.49% 140 72602 0.55% 141 82453 0.62% 142 95994 0.72% 143 113821 0.86% 144 137696 1.04% 145 173217 1.30% 146 225263 1.70% 147 313746 2.36% 148 486437 3.66% 149 948844 7.15% 150 3583907 26.99% 151 5871762 44.22% 13278194 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=21 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=326.27 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=15.5 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.52 sequence-density-rank=1 fanout-score=2.05 fanout-score-rank=19 prefix-density=0.52 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=22 fanout-score=29.83 fanout-score-rank=1 prefix-density=0.24 prefix-fanout=10.3 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170461 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:41:58 Started mapping on | Feb 12 21:41:58 Finished on | Feb 12 21:43:27 Mapping speed, Million of reads per hour | 537.10 Number of input reads | 13278194 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12470506 Uniquely mapped reads % | 93.92% Average mapped length | 293.60 Number of splices: Total | 12487979 Number of splices: Annotated (sjdb) | 12192353 Number of splices: GT/AG | 12255942 Number of splices: GC/AG | 186302 Number of splices: AT/AC | 7649 Number of splices: Non-canonical | 38086 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339266 % of reads mapped to multiple loci | 2.56% Number of reads mapped to too many loci | 12444 % of reads mapped to too many loci | 0.09% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.40% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 476520 476520 476520 N_multimapping 339266 339266 339266 N_noFeature 502342 12258208 572502 N_ambiguous 242926 740 100453 UnstrandedReadsAssigned:11725238 PositiveStrandReadsAssigned:211558 NegativeStrandReadsAssigned:11797551 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170461 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170461-trimmed-pair1.fastq SRR7170461-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,278,194 reads, 11,690,704 reads pseudoaligned [quant] estimated average fragment length: 277.642 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,214 rounds 52401 SRR7170461.ke.tsv 34699 SRR7170461.se.tsv 87100 total ==> SRR7170461.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1741.36 873 38.9575 Potri.005G024800.1.v4.1 1035 758.358 257 26.3344 Potri.004G059700.1.v4.1 961 684.39 7 0.794803 Potri.007G009000.2.v4.1 1416 1139.36 0 0 Potri.003G141000.2.v4.1 2943 2666.36 626.401 18.2557 Potri.016G087400.1.v4.1 270 76.2157 834 850.329 Potri.015G069301.1.v4.1 564 294.066 0 0 Potri.010G195200.1.v4.1 1773 1496.36 246.926 12.8232 Potri.012G127500.1.v4.1 977 700.374 167 18.529 ==> SRR7170461.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 517 Potri.001G233950.v4.1 3 Potri.001G122700.v4.1 236 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 78 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170461 completed mapping pipeline successfully