Starting /dee2/code/volunteer_pipeline.sh SRR7170462 current disk space = 3050637520896 free memory = 1576042944 SRR7170462 SRAfilesize 634e27f70cba9a5bf82af9572e2a235f SRR7170462.sra SRR7170462.sra file validated SRR7170462 is paired end SRR7170462 is conventional basespace SRR7170462 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170462_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.197 18.0 18.0 18.0 18.0 32.0 2 27.767 27.0 27.0 30.0 25.0 31.0 3 29.69625 31.0 29.0 31.0 27.0 33.0 4 31.73675 33.0 31.0 33.0 29.0 33.0 5 32.418 33.0 33.0 33.0 32.0 33.0 6 36.51775 38.0 37.0 38.0 34.0 38.0 7 37.11 38.0 37.0 38.0 35.0 38.0 8 37.3985 38.0 38.0 38.0 36.0 38.0 9 37.466 38.0 38.0 38.0 37.0 38.0 10-14 37.4782 38.0 38.0 38.0 37.0 38.0 15-19 37.4792 38.0 38.0 38.0 37.0 38.0 20-24 37.5094 38.0 38.0 38.0 37.2 38.0 25-29 37.59155 38.0 38.0 38.0 38.0 38.0 30-34 37.52885 38.0 38.0 38.0 37.4 38.0 35-39 37.4773 38.0 38.0 38.0 37.0 38.0 40-44 37.472300000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.4182 38.0 38.0 38.0 37.0 38.0 50-54 37.34295 38.0 38.0 38.0 37.0 38.0 55-59 37.22385 38.0 38.0 38.0 36.2 38.0 60-64 37.22004999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.137 38.0 38.0 38.0 36.0 38.0 70-74 37.040150000000004 38.0 38.0 38.0 35.8 38.0 75-79 36.89445 38.0 38.0 38.0 35.0 38.0 80-84 36.890600000000006 38.0 38.0 38.0 35.4 38.0 85-89 36.62285 38.0 38.0 38.0 34.0 38.0 90-94 36.556000000000004 38.0 38.0 38.0 34.0 38.0 95-99 36.4902 38.0 37.6 38.0 34.0 38.0 100-104 36.3686 38.0 37.0 38.0 33.8 38.0 105-109 36.12885 38.0 37.0 38.0 33.0 38.0 110-114 36.01065 38.0 37.0 38.0 32.6 38.0 115-119 35.498749999999994 38.0 36.0 38.0 30.2 38.0 120-124 35.7367 38.0 36.0 38.0 31.2 38.0 125-129 35.22945 38.0 35.6 38.0 29.6 38.0 130-134 31.914749999999998 35.6 28.0 38.0 21.4 38.0 135-139 33.92764999999999 37.8 33.2 38.0 24.2 38.0 140-144 29.7763 32.8 25.0 37.4 15.2 38.0 145-149 32.07355 36.4 31.0 38.0 14.0 38.0 150-151 28.095375 34.0 16.5 37.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 0.0 18 1.0 19 2.0 20 0.0 21 0.0 22 1.0 23 3.0 24 5.0 25 13.0 26 15.0 27 25.0 28 21.0 29 32.0 30 45.0 31 74.0 32 95.0 33 153.0 34 308.0 35 569.0 36 1480.0 37 1154.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 25.196643943366542 30.46670162558993 7.393812270582066 36.94284216046146 2 21.275 14.025000000000002 36.425000000000004 28.275 3 18.4 20.5 26.924999999999997 34.175 4 23.325000000000003 27.975 22.925 25.775 5 22.475 34.025 23.599999999999998 19.900000000000002 6 17.075000000000003 35.8 27.075 20.05 7 14.249999999999998 24.75 43.225 17.775 8 16.875 24.575 32.574999999999996 25.974999999999998 9 17.125 23.75 34.65 24.474999999999998 10-14 19.28 30.255 27.61 22.855 15-19 19.05 28.89 28.535 23.525 20-24 19.765 28.89 27.994999999999997 23.35 25-29 19.53 28.549999999999997 27.955000000000002 23.965 30-34 19.73 29.04 27.744999999999997 23.485 35-39 19.62 29.09 27.615000000000002 23.674999999999997 40-44 20.185 29.17 27.46 23.185 45-49 19.744999999999997 29.035 27.455000000000002 23.765 50-54 20.555 28.7 26.919999999999998 23.825 55-59 19.509999999999998 29.110000000000003 27.72 23.66 60-64 19.735 28.895 27.875 23.494999999999997 65-69 20.225 28.32 28.345 23.11 70-74 19.82 28.449999999999996 28.025 23.705000000000002 75-79 19.759999999999998 28.575 28.09 23.575 80-84 20.285 28.494999999999997 27.765 23.455000000000002 85-89 19.905 28.355000000000004 27.735 24.005000000000003 90-94 19.645000000000003 28.884999999999998 27.415 24.055 95-99 20.02 27.750000000000004 28.285 23.945 100-104 20.27 28.494999999999997 27.58 23.655 105-109 19.93 28.155 28.025 23.89 110-114 19.71 28.365000000000002 28.24 23.685000000000002 115-119 20.645 28.515 27.800000000000004 23.04 120-124 20.28 27.605 27.845 24.27 125-129 20.169999999999998 28.499999999999996 27.534999999999997 23.794999999999998 130-134 20.345 28.54 27.515 23.599999999999998 135-139 20.919999999999998 28.125 27.400000000000002 23.555 140-144 20.630000000000003 28.035 28.125 23.21 145-149 20.32 28.22 27.755000000000003 23.705000000000002 150-151 20.225 28.125 28.875 22.775000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.5 7 0.5 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 0.5 23 1.5 24 2.5 25 3.0 26 4.5 27 6.0 28 7.5 29 14.0 30 21.5 31 31.0 32 38.0 33 37.0 34 58.5 35 84.5 36 97.5 37 125.0 38 154.5 39 185.0 40 214.0 41 244.5 42 257.5 43 259.5 44 270.5 45 272.0 46 264.5 47 242.5 48 213.5 49 175.5 50 135.5 51 122.0 52 113.5 53 90.5 54 66.0 55 43.0 56 38.5 57 35.5 58 19.5 59 13.5 60 10.0 61 7.5 62 7.0 63 2.5 64 0.5 65 1.0 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.5 73 1.0 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67377666248431 99.3 2 0.301129234629862 0.6 3 0.0 0.0 4 0.02509410288582183 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.475 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.5625 0.0 0.0 0.0 0.0 100-101 0.6499999999999999 0.0 0.0 0.0 0.0 102-103 0.7124999999999999 0.0 0.0 0.0 0.0 104-105 0.825 0.0 0.0 0.0 0.0 106-107 0.9125 0.0 0.0 0.0 0.0 108-109 0.9875 0.0 0.0 0.0 0.0 110-111 1.1 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.4125 0.0 0.0 0.0 0.0 116-117 1.5875 0.0 0.0 0.0 0.0 118-119 1.8 0.0 0.0 0.0 0.0 120-121 1.975 0.0 0.0 0.0 0.0 122-123 2.2249999999999996 0.0 0.0 0.0 0.0 124-125 2.3125 0.0 0.0 0.0 0.0 126-127 2.4 0.0 0.0 0.0 0.0 128-129 2.5875 0.0 0.0 0.0 0.0 130-131 2.7625 0.0 0.0 0.0 0.0 132-133 2.8875 0.0 0.0 0.0 0.0 134-135 3.025 0.0 0.0 0.0 0.0 136-137 3.1875 0.0 0.0 0.0 0.0 138-139 3.325 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170462 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170462_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.00725 33.0 33.0 34.0 32.0 34.0 2 33.047 34.0 33.0 34.0 32.0 34.0 3 33.11875 34.0 33.0 34.0 32.0 34.0 4 33.16775 34.0 33.0 34.0 33.0 34.0 5 33.14175 34.0 33.0 34.0 33.0 34.0 6 37.383 38.0 38.0 38.0 37.0 38.0 7 37.345 38.0 38.0 38.0 37.0 38.0 8 37.28325 38.0 38.0 38.0 37.0 38.0 9 37.3235 38.0 38.0 38.0 37.0 38.0 10-14 37.2547 38.0 38.0 38.0 37.0 38.0 15-19 35.9627 38.0 36.4 38.0 30.4 38.0 20-24 37.096700000000006 38.0 38.0 38.0 36.4 38.0 25-29 36.95595 38.0 38.0 38.0 36.0 38.0 30-34 37.13125 38.0 38.0 38.0 36.6 38.0 35-39 37.1592 38.0 38.0 38.0 37.0 38.0 40-44 37.0977 38.0 38.0 38.0 36.0 38.0 45-49 37.0099 38.0 38.0 38.0 36.0 38.0 50-54 36.99515 38.0 38.0 38.0 36.0 38.0 55-59 37.0293 38.0 38.0 38.0 36.0 38.0 60-64 36.9465 38.0 38.0 38.0 36.0 38.0 65-69 36.92195 38.0 38.0 38.0 36.0 38.0 70-74 36.81925 38.0 38.0 38.0 35.4 38.0 75-79 36.78575 38.0 38.0 38.0 35.0 38.0 80-84 36.70530000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.3054 38.0 37.8 38.0 33.4 38.0 90-94 34.00855 37.2 33.0 38.0 24.8 38.0 95-99 36.23525000000001 38.0 37.2 38.0 33.6 38.0 100-104 36.17215 38.0 37.2 38.0 33.6 38.0 105-109 36.0826 38.0 37.0 38.0 33.0 38.0 110-114 35.8366 38.0 37.0 38.0 32.2 38.0 115-119 35.66105 38.0 36.6 38.0 31.0 38.0 120-124 35.0419 38.0 35.8 38.0 28.8 38.0 125-129 34.6687 38.0 34.6 38.0 26.8 38.0 130-134 34.44945 38.0 34.0 38.0 26.2 38.0 135-139 33.736399999999996 38.0 33.0 38.0 22.4 38.0 140-144 32.639149999999994 38.0 33.0 38.0 15.8 38.0 145-149 31.4521 37.4 31.4 38.0 8.6 38.0 150-151 25.4585 32.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 1.0 5 0.0 6 4.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 0.0 13 0.0 14 4.0 15 1.0 16 3.0 17 0.0 18 3.0 19 3.0 20 6.0 21 7.0 22 4.0 23 13.0 24 10.0 25 11.0 26 19.0 27 24.0 28 26.0 29 36.0 30 66.0 31 69.0 32 114.0 33 141.0 34 234.0 35 408.0 36 1033.0 37 1749.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.05 22.25 12.85 26.85 2 26.525 26.150000000000002 30.775000000000002 16.55 3 20.825 28.15 31.924999999999997 19.1 4 24.0 35.175 23.025000000000002 17.8 5 24.2 36.35 22.05 17.4 6 19.400000000000002 39.0 24.525 17.075000000000003 7 19.05 19.875 41.475 19.6 8 20.95 25.15 28.425 25.474999999999998 9 21.525 25.05 30.099999999999998 23.325000000000003 10-14 22.945 29.549999999999997 26.400000000000002 21.105 15-19 22.939999999999998 27.845 28.43 20.785 20-24 22.58 28.49 28.62 20.31 25-29 22.925 27.555000000000003 29.509999999999998 20.01 30-34 22.6 28.74 28.360000000000003 20.3 35-39 22.68 28.49 27.965 20.865000000000002 40-44 22.814999999999998 28.095 28.12 20.97 45-49 22.91 28.225 28.410000000000004 20.455000000000002 50-54 22.515 28.04 28.439999999999998 21.005 55-59 22.939999999999998 28.139999999999997 28.255000000000003 20.665 60-64 22.855 28.235 28.29 20.62 65-69 22.81 28.025 28.194999999999997 20.97 70-74 22.59 27.644999999999996 28.475 21.29 75-79 23.48 27.529999999999998 27.944999999999997 21.044999999999998 80-84 23.135 28.139999999999997 28.29 20.435 85-89 22.99 28.310000000000002 28.249999999999996 20.45 90-94 23.445 28.575 27.66 20.32 95-99 23.11 28.325 27.985 20.580000000000002 100-104 24.115000000000002 27.785 28.12 19.98 105-109 23.150000000000002 27.860000000000003 28.384999999999998 20.605 110-114 23.265 27.525 29.020000000000003 20.19 115-119 23.75 28.299999999999997 27.765 20.185 120-124 23.580000000000002 27.939999999999998 28.050000000000004 20.43 125-129 23.64 28.29 27.395000000000003 20.674999999999997 130-134 24.279999999999998 27.97 27.49 20.26 135-139 23.86 27.625 27.884999999999998 20.630000000000003 140-144 24.325 27.584999999999997 28.175 19.915 145-149 24.065 27.950000000000003 27.48 20.505000000000003 150-151 23.5375 28.3625 28.349999999999998 19.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.5 16 0.5 17 1.0 18 1.5 19 1.5 20 1.5 21 1.5 22 1.0 23 1.5 24 2.5 25 2.0 26 6.5 27 7.0 28 8.0 29 14.0 30 17.5 31 24.0 32 31.0 33 44.5 34 61.5 35 72.5 36 92.0 37 120.0 38 148.0 39 177.0 40 215.0 41 239.0 42 250.5 43 272.5 44 283.0 45 282.5 46 263.5 47 239.0 48 215.0 49 186.5 50 160.5 51 122.5 52 92.5 53 81.5 54 67.5 55 50.5 56 36.5 57 28.5 58 22.0 59 15.0 60 12.5 61 9.0 62 4.5 63 2.5 64 1.5 65 1.0 66 1.5 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.5 78 0.5 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5721117543418 98.9 2 0.32720865844450037 0.65 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.025169896803423106 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 9 0.22499999999999998 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.425 0.0 0.0 0.0 0.0 96-97 0.475 0.0 0.0 0.0 0.0 98-99 0.5125 0.0 0.0 0.0 0.0 100-101 0.6000000000000001 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.75 0.0 0.0 0.0 0.0 106-107 0.8375 0.0 0.0 0.0 0.0 108-109 0.9125000000000001 0.0 0.0 0.0 0.0 110-111 1.025 0.0 0.0 0.0 0.0 112-113 1.15 0.0 0.0 0.0 0.0 114-115 1.3375 0.0 0.0 0.0 0.0 116-117 1.5125 0.0 0.0 0.0 0.0 118-119 1.725 0.0 0.0 0.0 0.0 120-121 1.9 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.375 0.0 0.0 0.0 0.0 126-127 2.5 0.0 0.0 0.0 0.0 128-129 2.75 0.0 0.0 0.0 0.0 130-131 2.9625 0.0 0.0 0.0 0.0 132-133 3.1624999999999996 0.0 0.0 0.0 0.0 134-135 3.375 0.0 0.0 0.0 0.0 136-137 3.625 0.0 0.0 0.0 0.0 138-139 3.7750000000000004 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATGAAG 10 0.006830828 145.0 5 >>END_MODULE Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836770 spots for SRR7170462.sra Written 836770 spots for SRR7170462.sra Read 836787 spots for SRR7170462.sra Written 836787 spots for SRR7170462.sra SRR ids: ['SRR7170462.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_katp1_6t SRR7170462.sra spots: 16735417 blocks: [[1, 836770], [836771, 1673540], [1673541, 2510310], [2510311, 3347080], [3347081, 4183850], [4183851, 5020620], [5020621, 5857390], [5857391, 6694160], [6694161, 7530930], [7530931, 8367700], [8367701, 9204470], [9204471, 10041240], [10041241, 10878010], [10878011, 11714780], [11714781, 12551550], [12551551, 13388320], [13388321, 14225090], [14225091, 15061860], [15061861, 15898630], [15898631, 16735417]] SRR7170462 file size 5649383 SRR7170462 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170462 SRR7170462_1.fastq SRR7170462_2.fastq Input file: SRR7170462_1.fastq Paired file: SRR7170462_2.fastq trimmed: SRR7170462-trimmed-pair1.fastq, SRR7170462-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:48:30 2025 >> started Wed Feb 12 21:48:51 2025 >> done (20.471s) 16735417 read pairs processed; of these: 11218 ( 0.07%) short read pairs filtered out after trimming by size control 10781 ( 0.06%) empty read pairs filtered out after trimming by size control 16713418 (99.87%) read pairs available; of these: 9935627 (59.45%) trimmed read pairs available after processing 6777791 (40.55%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 3 0.00% 20 3 0.00% 21 3 0.00% 22 2 0.00% 23 4 0.00% 24 8 0.00% 25 3 0.00% 26 6 0.00% 27 4 0.00% 28 4 0.00% 29 4 0.00% 30 3 0.00% 31 3 0.00% 32 6 0.00% 33 6 0.00% 34 6 0.00% 35 5 0.00% 36 5 0.00% 37 9 0.00% 38 5 0.00% 39 11 0.00% 40 11 0.00% 41 23 0.00% 42 18 0.00% 43 23 0.00% 44 21 0.00% 45 17 0.00% 46 33 0.00% 47 38 0.00% 48 47 0.00% 49 58 0.00% 50 59 0.00% 51 69 0.00% 52 65 0.00% 53 80 0.00% 54 72 0.00% 55 107 0.00% 56 124 0.00% 57 119 0.00% 58 135 0.00% 59 156 0.00% 60 225 0.00% 61 245 0.00% 62 264 0.00% 63 293 0.00% 64 335 0.00% 65 338 0.00% 66 395 0.00% 67 461 0.00% 68 480 0.00% 69 562 0.00% 70 661 0.00% 71 759 0.00% 72 939 0.01% 73 1061 0.01% 74 1208 0.01% 75 1253 0.01% 76 1450 0.01% 77 1759 0.01% 78 1700 0.01% 79 1856 0.01% 80 2064 0.01% 81 2422 0.01% 82 2768 0.02% 83 3149 0.02% 84 3912 0.02% 85 4550 0.03% 86 4829 0.03% 87 5012 0.03% 88 5526 0.03% 89 5807 0.03% 90 6187 0.04% 91 6700 0.04% 92 7238 0.04% 93 7825 0.05% 94 8540 0.05% 95 9212 0.06% 96 9591 0.06% 97 10001 0.06% 98 10409 0.06% 99 10930 0.07% 100 11285 0.07% 101 12045 0.07% 102 12726 0.08% 103 13629 0.08% 104 14339 0.09% 105 14971 0.09% 106 15728 0.09% 107 16234 0.10% 108 16838 0.10% 109 17324 0.10% 110 17676 0.11% 111 18724 0.11% 112 19302 0.12% 113 20247 0.12% 114 21228 0.13% 115 22445 0.13% 116 23273 0.14% 117 23858 0.14% 118 24752 0.15% 119 25286 0.15% 120 26289 0.16% 121 27618 0.17% 122 28633 0.17% 123 29941 0.18% 124 31559 0.19% 125 33285 0.20% 126 35493 0.21% 127 36974 0.22% 128 38712 0.23% 129 40891 0.24% 130 43476 0.26% 131 45942 0.27% 132 48965 0.29% 133 53155 0.32% 134 57553 0.34% 135 62368 0.37% 136 67910 0.41% 137 75953 0.45% 138 83944 0.50% 139 94416 0.56% 140 105686 0.63% 141 120094 0.72% 142 138385 0.83% 143 162340 0.97% 144 196240 1.17% 145 244780 1.46% 146 314489 1.88% 147 442096 2.65% 148 680812 4.07% 149 1327366 7.94% 150 4734053 28.32% 151 6777791 40.55% 16713418 reads passed initial QC criterion=sequence-density sequence-density=0.29 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.30 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=14.74 fanout-score-rank=1 prefix-density=0.19 prefix-fanout=6.8 sequence=CCTCTGCTGGTCTGG criterion=sequence-density sequence-density=0.23 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=25 prefix-density=0.24 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=32.36 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=4.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170462 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:49:36 Started mapping on | Feb 12 21:49:36 Finished on | Feb 12 21:51:21 Mapping speed, Million of reads per hour | 573.03 Number of input reads | 16713418 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15691838 Uniquely mapped reads % | 93.89% Average mapped length | 293.70 Number of splices: Total | 15577316 Number of splices: Annotated (sjdb) | 15180258 Number of splices: GT/AG | 15293909 Number of splices: GC/AG | 220017 Number of splices: AT/AC | 9449 Number of splices: Non-canonical | 53941 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 469708 % of reads mapped to multiple loci | 2.81% Number of reads mapped to too many loci | 76582 % of reads mapped to too many loci | 0.46% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.74% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 563552 563552 563552 N_multimapping 469708 469708 469708 N_noFeature 645229 15443972 735097 N_ambiguous 312494 1140 153859 UnstrandedReadsAssigned:14734115 PositiveStrandReadsAssigned:246726 NegativeStrandReadsAssigned:14802882 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170462 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170462-trimmed-pair1.fastq SRR7170462-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,713,418 reads, 14,702,044 reads pseudoaligned [quant] estimated average fragment length: 280.404 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,179 rounds 52401 SRR7170462.ke.tsv 34699 SRR7170462.se.tsv 87100 total ==> SRR7170462.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1738.6 1577 57.8111 Potri.005G024800.1.v4.1 1035 755.596 404 34.0777 Potri.004G059700.1.v4.1 961 681.624 6 0.561028 Potri.007G009000.2.v4.1 1416 1136.6 0 0 Potri.003G141000.2.v4.1 2943 2663.6 918.778 21.9847 Potri.016G087400.1.v4.1 270 75.6643 1299 1094.2 Potri.015G069301.1.v4.1 564 291.764 0 0 Potri.010G195200.1.v4.1 1773 1493.6 685 29.2305 Potri.012G127500.1.v4.1 977 697.613 334 30.5148 ==> SRR7170462.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 336 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 273 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 221 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170462 completed mapping pipeline successfully