Starting /dee2/code/volunteer_pipeline.sh SRR7170463 current disk space = 3050804752384 free memory = 1511924208 SRR7170463 SRAfilesize 0e38bc6d703d165491fb83b0408fae59 SRR7170463.sra SRR7170463.sra file validated SRR7170463 is paired end SRR7170463 is conventional basespace SRR7170463 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170463_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.06625 18.0 18.0 18.0 18.0 28.0 2 24.30875 25.0 18.0 27.0 18.0 28.0 3 23.90825 25.0 18.0 28.0 18.0 31.0 4 27.1165 29.0 27.0 30.0 15.0 31.0 5 29.86375 32.0 27.0 32.0 25.0 33.0 6 34.576 36.0 34.0 37.0 29.0 38.0 7 36.34025 38.0 37.0 38.0 34.0 38.0 8 36.71425 38.0 37.0 38.0 34.0 38.0 9 36.9935 38.0 38.0 38.0 35.0 38.0 10-14 37.33315 38.0 38.0 38.0 36.0 38.0 15-19 37.4031 38.0 38.0 38.0 36.6 38.0 20-24 37.6256 38.0 38.0 38.0 37.6 38.0 25-29 37.61785 38.0 38.0 38.0 38.0 38.0 30-34 37.56875 38.0 38.0 38.0 38.0 38.0 35-39 37.505849999999995 38.0 38.0 38.0 37.4 38.0 40-44 37.494099999999996 38.0 38.0 38.0 37.2 38.0 45-49 37.3006 38.0 38.0 38.0 36.8 38.0 50-54 37.280950000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.1066 38.0 38.0 38.0 36.0 38.0 60-64 37.1143 38.0 38.0 38.0 35.8 38.0 65-69 37.01625 38.0 38.0 38.0 35.8 38.0 70-74 36.8555 38.0 38.0 38.0 35.2 38.0 75-79 36.6688 38.0 38.0 38.0 34.4 38.0 80-84 36.50725 38.0 38.0 38.0 34.0 38.0 85-89 36.469899999999996 38.0 37.8 38.0 34.0 38.0 90-94 36.33075 38.0 37.2 38.0 33.6 38.0 95-99 35.900400000000005 38.0 36.8 38.0 32.0 38.0 100-104 36.044 38.0 37.0 38.0 33.0 38.0 105-109 35.796949999999995 38.0 36.4 38.0 31.8 38.0 110-114 35.57085 38.0 36.0 38.0 30.6 38.0 115-119 35.13415 38.0 35.4 38.0 28.4 38.0 120-124 34.966150000000006 38.0 35.0 38.0 28.0 38.0 125-129 34.4814 38.0 34.4 38.0 26.0 38.0 130-134 33.447449999999996 38.0 32.6 38.0 19.8 38.0 135-139 32.66415000000001 37.2 31.6 38.0 15.0 38.0 140-144 31.844300000000004 36.2 30.8 38.0 13.4 38.0 145-149 30.6601 36.0 29.6 38.0 8.6 38.0 150-151 24.705624999999998 32.0 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 2.0 14 1.0 15 0.0 16 0.0 17 1.0 18 2.0 19 4.0 20 5.0 21 5.0 22 7.0 23 5.0 24 7.0 25 17.0 26 18.0 27 16.0 28 30.0 29 37.0 30 57.0 31 107.0 32 124.0 33 180.0 34 352.0 35 622.0 36 1558.0 37 842.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 7.401656314699793 62.551759834368525 6.3146997929606625 23.731884057971016 2 24.975 15.475 32.9 26.650000000000002 3 25.174999999999997 19.025 26.325 29.475 4 23.775 28.775000000000002 21.425 26.025 5 22.7 31.874999999999996 24.425 21.0 6 19.675 35.25 25.174999999999997 19.900000000000002 7 14.274999999999999 26.474999999999998 41.525 17.724999999999998 8 17.525 24.85 31.45 26.174999999999997 9 16.55 26.325 33.775 23.35 10-14 19.6 30.19 27.38 22.830000000000002 15-19 19.525000000000002 29.244999999999997 27.435 23.794999999999998 20-24 19.045 29.110000000000003 27.750000000000004 24.095 25-29 19.38 29.075 28.665000000000003 22.88 30-34 19.845 29.7 27.925 22.53 35-39 19.955000000000002 29.270000000000003 27.16 23.615 40-44 19.68 29.285 27.534999999999997 23.5 45-49 19.895 28.32 28.07 23.715 50-54 20.055 28.62 27.865000000000002 23.46 55-59 19.98 28.83 27.58 23.61 60-64 19.525000000000002 29.044999999999998 27.694999999999997 23.735 65-69 20.41 28.235 27.595 23.76 70-74 20.355 28.389999999999997 27.68 23.575 75-79 19.875 29.154999999999998 27.47 23.5 80-84 20.54 28.084999999999997 27.325 24.05 85-89 20.11 28.565 27.605 23.72 90-94 20.52 28.465 26.995 24.02 95-99 20.055 28.494999999999997 27.975 23.474999999999998 100-104 20.87 28.255000000000003 27.46 23.415 105-109 20.305 28.16 27.975 23.56 110-114 20.62 28.92 26.88 23.580000000000002 115-119 20.5 28.08 27.63 23.79 120-124 20.599999999999998 28.294999999999998 27.21 23.895 125-129 20.200000000000003 28.89 27.625 23.285 130-134 20.885 28.444999999999997 27.365000000000002 23.305 135-139 20.75 28.854999999999997 27.0 23.395 140-144 20.39 28.79 26.974999999999998 23.845 145-149 20.485 28.299999999999997 27.13 24.085 150-151 20.962500000000002 28.762500000000003 27.1375 23.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 1.5 23 2.0 24 2.0 25 3.5 26 7.0 27 8.5 28 12.0 29 19.0 30 24.0 31 31.0 32 45.5 33 60.5 34 69.5 35 94.0 36 111.5 37 126.0 38 170.0 39 196.5 40 198.0 41 218.5 42 239.5 43 235.0 44 246.0 45 263.0 46 251.5 47 229.5 48 205.5 49 177.5 50 150.5 51 129.0 52 113.5 53 92.5 54 73.0 55 54.5 56 34.5 57 29.0 58 25.5 59 18.5 60 11.0 61 5.0 62 4.0 63 4.0 64 2.5 65 2.0 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4000000000000004 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.48750000000000004 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.4375 0.0 0.0 0.0 0.0 112-113 2.8125 0.0 0.0 0.0 0.0 114-115 3.1375 0.0 0.0 0.0 0.0 116-117 3.4875 0.0 0.0 0.0 0.0 118-119 3.9125 0.0 0.0 0.0 0.0 120-121 4.1875 0.0 0.0 0.0 0.0 122-123 4.5125 0.0 0.0 0.0 0.0 124-125 4.8125 0.0 0.0 0.0 0.0 126-127 5.25 0.0 0.0 0.0 0.0 128-129 5.6875 0.0 0.0 0.0 0.0 130-131 6.125 0.0 0.0 0.0 0.0 132-133 6.375 0.0 0.0 0.0 0.0 134-135 6.7125 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.5 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACTTC 10 0.006832588 144.9875 8 >>END_MODULE SRR7170463 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170463_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.01825 33.0 33.0 34.0 32.0 34.0 2 33.13975 34.0 33.0 34.0 32.0 34.0 3 33.16075 34.0 33.0 34.0 33.0 34.0 4 33.12575 34.0 33.0 34.0 33.0 34.0 5 33.1175 34.0 33.0 34.0 33.0 34.0 6 37.28625 38.0 38.0 38.0 37.0 38.0 7 37.31475 38.0 38.0 38.0 37.0 38.0 8 37.33025 38.0 38.0 38.0 37.0 38.0 9 37.345 38.0 38.0 38.0 37.0 38.0 10-14 37.3666 38.0 38.0 38.0 37.6 38.0 15-19 37.301249999999996 38.0 38.0 38.0 37.2 38.0 20-24 37.3138 38.0 38.0 38.0 37.0 38.0 25-29 37.3068 38.0 38.0 38.0 37.2 38.0 30-34 37.246449999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.226350000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.25574999999999 38.0 38.0 38.0 37.0 38.0 45-49 37.197950000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.1886 38.0 38.0 38.0 37.0 38.0 55-59 37.1775 38.0 38.0 38.0 37.0 38.0 60-64 37.13245 38.0 38.0 38.0 36.8 38.0 65-69 37.0299 38.0 38.0 38.0 36.0 38.0 70-74 36.957899999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.95085 38.0 38.0 38.0 36.0 38.0 80-84 36.867650000000005 38.0 38.0 38.0 36.0 38.0 85-89 36.8055 38.0 38.0 38.0 35.6 38.0 90-94 36.67215 38.0 38.0 38.0 35.2 38.0 95-99 36.51875 38.0 38.0 38.0 34.2 38.0 100-104 36.4473 38.0 38.0 38.0 34.0 38.0 105-109 36.403000000000006 38.0 38.0 38.0 34.0 38.0 110-114 36.144099999999995 38.0 37.6 38.0 33.6 38.0 115-119 35.942949999999996 38.0 37.0 38.0 33.0 38.0 120-124 35.59325 38.0 36.6 38.0 31.0 38.0 125-129 34.93285 38.0 35.8 38.0 29.0 38.0 130-134 34.828250000000004 38.0 35.8 38.0 28.6 38.0 135-139 34.34615 38.0 34.4 38.0 26.8 38.0 140-144 33.5318 38.0 33.0 38.0 21.6 38.0 145-149 32.77585 38.0 33.0 38.0 16.8 38.0 150-151 27.240000000000002 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 2.0 5 0.0 6 1.0 7 0.0 8 0.0 9 1.0 10 1.0 11 2.0 12 2.0 13 5.0 14 0.0 15 3.0 16 1.0 17 2.0 18 4.0 19 5.0 20 8.0 21 7.0 22 5.0 23 8.0 24 11.0 25 8.0 26 5.0 27 20.0 28 27.0 29 32.0 30 33.0 31 49.0 32 66.0 33 95.0 34 152.0 35 273.0 36 785.0 37 2379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 22.025 15.65 26.0 2 26.775 26.0 30.5 16.725 3 19.425 28.225 32.125 20.225 4 23.75 34.425 23.5 18.325 5 24.125 36.25 22.725 16.900000000000002 6 21.25 36.95 23.799999999999997 18.0 7 20.5 21.575 38.574999999999996 19.35 8 21.475 26.575 27.224999999999998 24.725 9 21.375 25.474999999999998 29.925 23.225 10-14 23.695 28.955 26.43 20.919999999999998 15-19 23.25 28.275 27.544999999999998 20.93 20-24 23.585 27.825 27.755000000000003 20.835 25-29 23.04115205760288 28.196409820491024 27.931396569828493 20.831041552077604 30-34 22.72840926138921 28.73431014652198 27.98419762964445 20.553082962444368 35-39 23.128469270390557 28.10921638245737 27.699154873230984 21.06315947392109 40-44 23.185 27.99 27.650000000000002 21.175 45-49 23.635 28.13 27.860000000000003 20.375 50-54 23.75 27.67 27.815 20.765 55-59 23.22 28.194999999999997 27.54 21.044999999999998 60-64 23.452345234523452 27.927792779277926 27.992799279927993 20.627062706270628 65-69 23.323498524778717 27.94919237885683 27.98419762964445 20.743111466720006 70-74 24.24591065979691 27.61742784252914 27.662448101645744 20.47421339602821 75-79 23.241620810405202 27.938969484742373 28.064032016008007 20.755377688844423 80-84 23.421710855427712 28.23411705852926 27.66383191595798 20.680340170085042 85-89 23.461730865432717 27.83391695847924 28.3991995997999 20.305152576288144 90-94 24.00080036016207 28.017607923565606 27.472362563153418 20.509229153118905 95-99 23.512053616084824 28.293488046413923 27.283184955486643 20.911273382014606 100-104 23.933590038505777 28.609291393709057 27.314097114567186 20.143021453217983 105-109 23.742122636791038 27.91337401220366 27.838351505451637 20.506151845553667 110-114 24.191047761940485 28.3520880220055 27.446861715428856 20.010002500625156 115-119 24.125856635485967 28.747936571457156 27.172227502376067 19.953979290680806 120-124 23.896948474237117 27.85392696348174 27.603801900950476 20.645322661330663 125-129 24.212106053026513 28.08904452226113 27.18359179589795 20.515257628814407 130-134 24.8224112056028 27.693846923461727 27.443721860930463 20.040020010005 135-139 24.58229114557279 27.428714357178592 27.788894447223612 20.200100050025014 140-144 25.047523761880942 27.073536768384194 27.448724362181093 20.430215107553774 145-149 25.18759379689845 27.073536768384194 28.024012006003 19.714857428714357 150-151 24.343585896474117 27.569392348087025 27.156789197299325 20.930232558139537 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 1.0 24 1.5 25 3.5 26 6.0 27 5.0 28 6.0 29 8.5 30 9.0 31 20.0 32 27.0 33 32.5 34 56.0 35 66.5 36 86.0 37 109.5 38 139.5 39 188.0 40 221.0 41 224.5 42 249.0 43 273.5 44 264.0 45 258.5 46 244.5 47 242.0 48 233.0 49 200.5 50 164.5 51 136.0 52 116.0 53 97.0 54 78.0 55 56.5 56 46.0 57 38.5 58 24.5 59 19.5 60 16.5 61 13.0 62 8.5 63 4.0 64 1.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.015 35-39 0.015 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.015 70-74 0.045 75-79 0.05 80-84 0.05 85-89 0.05 90-94 0.045 95-99 0.03 100-104 0.015 105-109 0.03 110-114 0.025 115-119 0.045 120-124 0.05 125-129 0.05 130-134 0.05 135-139 0.05 140-144 0.05 145-149 0.05 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37011841773746 98.6 2 0.5039052658100277 1.0 3 0.10078105316200556 0.3 4 0.02519526329050139 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.65 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.4875 0.0 0.0 0.0 0.0 112-113 2.8625 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.5375 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.237500000000001 0.0 0.0 0.0 0.0 122-123 4.5625 0.0 0.0 0.0 0.0 124-125 4.8625 0.0 0.0 0.0 0.0 126-127 5.2875 0.0 0.0 0.0 0.0 128-129 5.7125 0.0 0.0 0.0 0.0 130-131 6.15 0.0 0.0 0.0 0.0 132-133 6.4 0.0 0.0 0.0 0.0 134-135 6.737500000000001 0.0 0.0 0.0 0.0 136-137 7.0875 0.0 0.0 0.0 0.0 138-139 7.5125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGTAAT 10 0.006830828 145.0 1 TAGCTAA 10 0.006830828 145.0 7 TCCAGTT 10 0.006830828 145.0 3 ATAGCTA 10 0.006830828 145.0 6 GCTAAGT 10 0.006830828 145.0 9 ACCTTGG 10 0.006830828 145.0 145 TAATAGC 10 0.006830828 145.0 4 CAAGCAT 10 0.006830828 145.0 8 AAGCATC 10 0.006830828 145.0 9 GAAGGTA 10 0.006830828 145.0 2 CGTTTTT 10 0.006830828 145.0 1 >>END_MODULE Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522587 spots for SRR7170463.sra Written 522587 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra Read 522571 spots for SRR7170463.sra Written 522571 spots for SRR7170463.sra SRR ids: ['SRR7170463.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86myqpru SRR7170463.sra spots: 10451436 blocks: [[1, 522571], [522572, 1045142], [1045143, 1567713], [1567714, 2090284], [2090285, 2612855], [2612856, 3135426], [3135427, 3657997], [3657998, 4180568], [4180569, 4703139], [4703140, 5225710], [5225711, 5748281], [5748282, 6270852], [6270853, 6793423], [6793424, 7315994], [7315995, 7838565], [7838566, 8361136], [8361137, 8883707], [8883708, 9406278], [9406279, 9928849], [9928850, 10451436]] SRR7170463 file size 3519948 SRR7170463 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170463 SRR7170463_1.fastq SRR7170463_2.fastq Input file: SRR7170463_1.fastq Paired file: SRR7170463_2.fastq trimmed: SRR7170463-trimmed-pair1.fastq, SRR7170463-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:22:03 2025 >> started Wed Feb 12 21:22:15 2025 >> done (12.020s) 10451436 read pairs processed; of these: 9482 ( 0.09%) short read pairs filtered out after trimming by size control 15389 ( 0.15%) empty read pairs filtered out after trimming by size control 10426565 (99.76%) read pairs available; of these: 7084005 (67.94%) trimmed read pairs available after processing 3342560 (32.06%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 0 0.00% 21 2 0.00% 22 1 0.00% 23 0 0.00% 24 3 0.00% 25 1 0.00% 26 6 0.00% 27 3 0.00% 28 3 0.00% 29 9 0.00% 30 3 0.00% 31 17 0.00% 32 7 0.00% 33 7 0.00% 34 11 0.00% 35 11 0.00% 36 5 0.00% 37 9 0.00% 38 21 0.00% 39 23 0.00% 40 28 0.00% 41 25 0.00% 42 35 0.00% 43 35 0.00% 44 40 0.00% 45 39 0.00% 46 64 0.00% 47 62 0.00% 48 81 0.00% 49 105 0.00% 50 109 0.00% 51 116 0.00% 52 146 0.00% 53 139 0.00% 54 134 0.00% 55 166 0.00% 56 175 0.00% 57 227 0.00% 58 252 0.00% 59 324 0.00% 60 372 0.00% 61 377 0.00% 62 460 0.00% 63 532 0.01% 64 600 0.01% 65 655 0.01% 66 649 0.01% 67 757 0.01% 68 851 0.01% 69 922 0.01% 70 1027 0.01% 71 1208 0.01% 72 1434 0.01% 73 1659 0.02% 74 1783 0.02% 75 2045 0.02% 76 2151 0.02% 77 2329 0.02% 78 2428 0.02% 79 2708 0.03% 80 2957 0.03% 81 3402 0.03% 82 3948 0.04% 83 4418 0.04% 84 5268 0.05% 85 5586 0.05% 86 5811 0.06% 87 6127 0.06% 88 6439 0.06% 89 6612 0.06% 90 7028 0.07% 91 7693 0.07% 92 8124 0.08% 93 8874 0.09% 94 9594 0.09% 95 10158 0.10% 96 10647 0.10% 97 10900 0.10% 98 11296 0.11% 99 11429 0.11% 100 11941 0.11% 101 12475 0.12% 102 13069 0.13% 103 13836 0.13% 104 14664 0.14% 105 15126 0.15% 106 16174 0.16% 107 16224 0.16% 108 16339 0.16% 109 16857 0.16% 110 17239 0.17% 111 17419 0.17% 112 18152 0.17% 113 19313 0.19% 114 19646 0.19% 115 20814 0.20% 116 21191 0.20% 117 21833 0.21% 118 22456 0.22% 119 22705 0.22% 120 23389 0.22% 121 24362 0.23% 122 25300 0.24% 123 26230 0.25% 124 27947 0.27% 125 29178 0.28% 126 30554 0.29% 127 31874 0.31% 128 33326 0.32% 129 34728 0.33% 130 36808 0.35% 131 38882 0.37% 132 41530 0.40% 133 44658 0.43% 134 47635 0.46% 135 52190 0.50% 136 56671 0.54% 137 61344 0.59% 138 67465 0.65% 139 74897 0.72% 140 83623 0.80% 141 92979 0.89% 142 107791 1.03% 143 126813 1.22% 144 153474 1.47% 145 190675 1.83% 146 249775 2.40% 147 345955 3.32% 148 526444 5.05% 149 969877 9.30% 150 2906453 27.88% 151 3342560 32.06% 10426565 reads passed initial QC criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=26 prefix-density=0.48 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=113.83 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=11.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.16 fanout-score-rank=27 prefix-density=0.45 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.04 sequence-density-rank=28 fanout-score=53.27 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=9.3 sequence=AAAAAAGAAAGGCAGAAGCAAGTTCAGTAATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170463 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:22:58 Started mapping on | Feb 12 21:22:58 Finished on | Feb 12 21:24:29 Mapping speed, Million of reads per hour | 412.48 Number of input reads | 10426565 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 9449953 Uniquely mapped reads % | 90.63% Average mapped length | 290.42 Number of splices: Total | 8687172 Number of splices: Annotated (sjdb) | 8460821 Number of splices: GT/AG | 8515878 Number of splices: GC/AG | 137757 Number of splices: AT/AC | 6521 Number of splices: Non-canonical | 27016 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 245745 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 7711 % of reads mapped to too many loci | 0.07% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.90% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 738220 738220 738220 N_multimapping 245745 245745 245745 N_noFeature 355295 9292835 402889 N_ambiguous 177403 796 67505 UnstrandedReadsAssigned:8917255 PositiveStrandReadsAssigned:156322 NegativeStrandReadsAssigned:8979559 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170463 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170463-trimmed-pair1.fastq SRR7170463-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,426,565 reads, 8,943,446 reads pseudoaligned [quant] estimated average fragment length: 254.318 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,217 rounds 52401 SRR7170463.ke.tsv 34699 SRR7170463.se.tsv 87100 total ==> SRR7170463.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1764.68 509 30.6547 Potri.005G024800.1.v4.1 1035 781.682 227 30.8632 Potri.004G059700.1.v4.1 961 707.698 8 1.2014 Potri.007G009000.2.v4.1 1416 1162.68 0 0 Potri.003G141000.2.v4.1 2943 2689.68 431.644 17.0557 Potri.016G087400.1.v4.1 270 82.2336 413.289 534.134 Potri.015G069301.1.v4.1 564 314.086 0 0 Potri.010G195200.1.v4.1 1773 1519.68 38 2.65752 Potri.012G127500.1.v4.1 977 723.693 196 28.7838 ==> SRR7170463.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 676 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 216 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 16 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170463 completed mapping pipeline successfully