Starting /dee2/code/volunteer_pipeline.sh SRR7170464 current disk space = 3050647056384 free memory = 1572056664 SRR7170464 SRAfilesize ac0b92885c9ae8ff17165e5e842a606d SRR7170464.sra SRR7170464.sra file validated SRR7170464 is paired end SRR7170464 is conventional basespace SRR7170464 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170464_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.14925 18.0 18.0 33.0 18.0 33.0 2 28.84225 29.0 27.0 33.0 25.0 33.0 3 30.10825 31.0 29.0 33.0 27.0 33.0 4 30.3245 31.0 29.0 33.0 27.0 33.0 5 32.2145 33.0 32.0 33.0 32.0 33.0 6 36.3695 38.0 36.0 38.0 34.0 38.0 7 37.089 38.0 38.0 38.0 36.0 38.0 8 37.5805 38.0 38.0 38.0 37.0 38.0 9 37.55125 38.0 38.0 38.0 38.0 38.0 10-14 37.58215 38.0 38.0 38.0 38.0 38.0 15-19 37.5871 38.0 38.0 38.0 38.0 38.0 20-24 37.542449999999995 38.0 38.0 38.0 37.8 38.0 25-29 37.61295 38.0 38.0 38.0 38.0 38.0 30-34 37.5423 38.0 38.0 38.0 37.8 38.0 35-39 37.538599999999995 38.0 38.0 38.0 38.0 38.0 40-44 37.45694999999999 38.0 38.0 38.0 37.6 38.0 45-49 37.42315000000001 38.0 38.0 38.0 37.0 38.0 50-54 37.39035 38.0 38.0 38.0 37.0 38.0 55-59 37.3015 38.0 38.0 38.0 37.0 38.0 60-64 37.274249999999995 38.0 38.0 38.0 37.0 38.0 65-69 37.249 38.0 38.0 38.0 36.8 38.0 70-74 37.149750000000004 38.0 38.0 38.0 36.0 38.0 75-79 37.0125 38.0 38.0 38.0 36.0 38.0 80-84 37.01975 38.0 38.0 38.0 36.0 38.0 85-89 36.7888 38.0 38.0 38.0 35.0 38.0 90-94 36.7526 38.0 38.0 38.0 34.6 38.0 95-99 36.595299999999995 38.0 38.0 38.0 34.2 38.0 100-104 36.5924 38.0 38.0 38.0 34.2 38.0 105-109 36.38875 38.0 37.8 38.0 34.0 38.0 110-114 36.2404 38.0 37.6 38.0 33.8 38.0 115-119 35.8368 38.0 37.0 38.0 32.6 38.0 120-124 35.842349999999996 38.0 36.8 38.0 32.0 38.0 125-129 35.6074 38.0 36.0 38.0 31.2 38.0 130-134 31.990949999999998 35.4 28.4 38.0 22.2 38.0 135-139 34.330850000000005 38.0 33.6 38.0 26.2 38.0 140-144 30.550649999999997 34.8 26.4 38.0 15.6 38.0 145-149 32.75255 37.6 32.8 38.0 16.6 38.0 150-151 28.764000000000003 34.5 17.5 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 3.0 16 5.0 17 3.0 18 0.0 19 2.0 20 1.0 21 1.0 22 4.0 23 3.0 24 6.0 25 12.0 26 11.0 27 20.0 28 19.0 29 43.0 30 40.0 31 59.0 32 80.0 33 117.0 34 190.0 35 436.0 36 1383.0 37 1559.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.51909184726522 10.68111455108359 9.726522187822498 41.073271413828685 2 22.57257257257257 14.414414414414415 31.106106106106107 31.906906906906908 3 20.325 21.224999999999998 25.6 32.85 4 25.025 26.724999999999998 22.1 26.150000000000002 5 23.200000000000003 32.550000000000004 23.425 20.825 6 18.5 36.325 24.349999999999998 20.825 7 14.35 27.6 40.2 17.849999999999998 8 18.099999999999998 27.425 31.075000000000003 23.400000000000002 9 17.325 25.874999999999996 33.475 23.325000000000003 10-14 18.915000000000003 30.990000000000002 26.945000000000004 23.150000000000002 15-19 19.02 29.915000000000003 27.575 23.49 20-24 19.09 30.264999999999997 27.229999999999997 23.415 25-29 19.485 29.995 27.605 22.915 30-34 19.205 29.875 27.339999999999996 23.580000000000002 35-39 19.74 30.020000000000003 26.85 23.39 40-44 19.689999999999998 29.799999999999997 26.895000000000003 23.615 45-49 19.994999999999997 28.999999999999996 27.045 23.96 50-54 19.775000000000002 28.625 27.91 23.69 55-59 20.345 28.43 27.205000000000002 24.02 60-64 19.61 28.7 28.005000000000003 23.685000000000002 65-69 19.355 29.099999999999998 27.785 23.76 70-74 20.335 28.775000000000002 26.889999999999997 24.0 75-79 20.169999999999998 28.83 27.339999999999996 23.66 80-84 19.455 29.26 27.395000000000003 23.89 85-89 20.175 29.39 26.705000000000002 23.73 90-94 20.44 28.525 27.16 23.875 95-99 20.485 28.325 27.145000000000003 24.044999999999998 100-104 20.555 29.09 27.115000000000002 23.24 105-109 21.099999999999998 28.215 26.355 24.33 110-114 20.685000000000002 28.315 27.139999999999997 23.86 115-119 20.255000000000003 28.09 27.595 24.060000000000002 120-124 20.355 28.46 27.015 24.169999999999998 125-129 21.015 28.53 26.284999999999997 24.169999999999998 130-134 20.535 28.685 26.545 24.235 135-139 21.425 27.994999999999997 26.83 23.75 140-144 21.4 27.83 26.534999999999997 24.235 145-149 21.16 28.425 26.005 24.41 150-151 21.75 27.875 26.0375 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 3.0 24 5.0 25 4.5 26 5.5 27 12.0 28 16.5 29 17.5 30 22.0 31 32.0 32 47.0 33 57.0 34 75.0 35 102.0 36 114.0 37 127.5 38 157.0 39 185.5 40 195.5 41 199.5 42 208.5 43 209.5 44 209.0 45 225.5 46 228.0 47 217.0 48 213.0 49 189.0 50 158.5 51 139.0 52 129.5 53 112.5 54 88.0 55 71.5 56 59.0 57 48.0 58 34.0 59 24.5 60 16.5 61 11.5 62 11.5 63 6.5 64 1.5 65 2.5 66 2.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.1 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.54740061162079 96.675 2 1.146788990825688 2.25 3 0.22935779816513763 0.675 4 0.025484199796126403 0.1 5 0.0 0.0 6 0.05096839959225281 0.3 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GCCTTATGTGATAGATGCCTCTTTAAAATATCTAAGTGCTGGGGTTATGA 6 0.15 No Hit CCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACAC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.7250000000000001 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.6875 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 2.075 0.0 0.0 0.0 0.0 114-115 2.325 0.0 0.0 0.0 0.0 116-117 2.6875 0.0 0.0 0.0 0.0 118-119 3.0999999999999996 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.2375 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.7625 0.0 0.0 0.0 0.0 132-133 5.1375 0.0 0.0 0.0 0.0 134-135 5.4375 0.0 0.0 0.0 0.0 136-137 5.825 0.0 0.0 0.0 0.0 138-139 6.237500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTCGTT 10 0.0063298983 148.6923 1 ATCTATA 10 0.0068343505 144.975 6 GGTAGGA 10 0.0068343505 144.975 145 CTCGTTT 10 0.0068343505 144.975 2 AAAAAAA 65 0.007646297 13.382307 120-124 >>END_MODULE SRR7170464 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170464_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8935 33.0 33.0 34.0 32.0 34.0 2 33.04525 34.0 33.0 34.0 32.0 34.0 3 33.047 34.0 33.0 34.0 32.0 34.0 4 33.05075 34.0 33.0 34.0 32.0 34.0 5 32.95525 34.0 33.0 34.0 32.0 34.0 6 37.145 38.0 38.0 38.0 37.0 38.0 7 37.1305 38.0 38.0 38.0 37.0 38.0 8 37.10375 38.0 38.0 38.0 37.0 38.0 9 37.06875 38.0 38.0 38.0 37.0 38.0 10-14 37.0601 38.0 38.0 38.0 36.8 38.0 15-19 35.9696 38.0 36.8 38.0 30.6 38.0 20-24 36.86345 38.0 38.0 38.0 36.0 38.0 25-29 36.848 38.0 38.0 38.0 36.0 38.0 30-34 36.94584999999999 38.0 38.0 38.0 36.4 38.0 35-39 36.96704999999999 38.0 38.0 38.0 36.2 38.0 40-44 36.924699999999994 38.0 38.0 38.0 36.0 38.0 45-49 36.88935 38.0 38.0 38.0 36.0 38.0 50-54 36.905449999999995 38.0 38.0 38.0 36.0 38.0 55-59 36.8745 38.0 38.0 38.0 36.0 38.0 60-64 36.82699999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.812200000000004 38.0 38.0 38.0 35.8 38.0 70-74 36.6815 38.0 38.0 38.0 35.2 38.0 75-79 36.65285 38.0 38.0 38.0 35.0 38.0 80-84 36.60595 38.0 38.0 38.0 34.6 38.0 85-89 36.0783 38.0 37.6 38.0 32.4 38.0 90-94 33.9091 37.4 33.2 38.0 22.8 38.0 95-99 36.16085 38.0 37.8 38.0 33.6 38.0 100-104 36.096450000000004 38.0 38.0 38.0 33.2 38.0 105-109 35.9344 38.0 37.0 38.0 33.0 38.0 110-114 35.75925 38.0 37.0 38.0 31.8 38.0 115-119 35.63425 38.0 37.0 38.0 31.0 38.0 120-124 35.007850000000005 38.0 36.0 38.0 27.8 38.0 125-129 34.692049999999995 38.0 35.4 38.0 27.4 38.0 130-134 34.35475 38.0 34.8 38.0 25.4 38.0 135-139 33.71849999999999 38.0 33.4 38.0 22.4 38.0 140-144 32.71015 38.0 33.0 38.0 16.6 38.0 145-149 31.5614 38.0 32.2 38.0 8.4 38.0 150-151 25.560125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 2.0 4 1.0 5 1.0 6 0.0 7 0.0 8 2.0 9 0.0 10 1.0 11 1.0 12 3.0 13 3.0 14 3.0 15 4.0 16 4.0 17 5.0 18 3.0 19 10.0 20 12.0 21 9.0 22 11.0 23 14.0 24 11.0 25 17.0 26 32.0 27 27.0 28 27.0 29 43.0 30 61.0 31 82.0 32 94.0 33 124.0 34 192.0 35 321.0 36 857.0 37 2016.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.325 19.475 16.85 28.349999999999998 2 27.700000000000003 25.45 28.775000000000002 18.075 3 22.0 28.425 30.5 19.075 4 23.799999999999997 32.2 23.325000000000003 20.674999999999997 5 24.925 34.925 22.975 17.175 6 21.275 36.85 23.225 18.65 7 22.2 20.7 36.925000000000004 20.175 8 22.925 25.275 27.250000000000004 24.55 9 22.0 25.575 28.749999999999996 23.674999999999997 10-14 24.135 28.68 25.86 21.325 15-19 23.625 28.000000000000004 26.435 21.94 20-24 23.915 27.529999999999998 27.33 21.224999999999998 25-29 23.965 28.175 26.86 21.0 30-34 23.785 28.349999999999998 26.655 21.21 35-39 24.0 27.889999999999997 26.55 21.560000000000002 40-44 23.919999999999998 27.685 27.334999999999997 21.060000000000002 45-49 23.685000000000002 27.57 26.775 21.97 50-54 23.625 27.155 27.88 21.34 55-59 23.97 27.644999999999996 27.384999999999998 21.0 60-64 23.935000000000002 27.474999999999998 27.355 21.235 65-69 23.915 27.205000000000002 27.55 21.33 70-74 24.255 27.67 26.745 21.33 75-79 24.335 27.365000000000002 27.775 20.525 80-84 23.82 27.700000000000003 27.334999999999997 21.145 85-89 24.025 27.465 27.355 21.154999999999998 90-94 23.645 27.955000000000002 27.169999999999998 21.23 95-99 24.065 27.67 27.634999999999998 20.630000000000003 100-104 24.23 27.155 27.855 20.76 105-109 24.39 27.765 27.169999999999998 20.674999999999997 110-114 24.22 27.87 27.36 20.549999999999997 115-119 24.585 27.715 27.375 20.325 120-124 24.990000000000002 28.065 26.76 20.185 125-129 24.725 27.689999999999998 27.105 20.48 130-134 25.424999999999997 27.089999999999996 27.52 19.965 135-139 25.25 26.834999999999997 27.74 20.175 140-144 24.92 27.345000000000002 27.845 19.89 145-149 25.990000000000002 27.46 27.38 19.17 150-151 25.874999999999996 26.8625 27.9125 19.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 0.0 23 1.0 24 1.0 25 1.0 26 1.5 27 2.5 28 5.0 29 11.5 30 14.5 31 16.5 32 23.0 33 32.0 34 38.0 35 49.0 36 72.5 37 92.0 38 117.0 39 141.0 40 166.5 41 190.0 42 216.5 43 238.5 44 251.0 45 267.5 46 277.5 47 262.5 48 246.0 49 216.5 50 176.0 51 154.0 52 146.5 53 132.5 54 111.0 55 93.0 56 62.5 57 44.0 58 39.5 59 30.5 60 20.0 61 16.0 62 11.0 63 5.5 64 1.5 65 1.0 66 0.0 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.575 #Duplication Level Percentage of deduplicated Percentage of total 1 98.75729140248541 97.35000000000001 2 1.0905401978189198 2.15 3 0.10144559979710879 0.3 4 0.050722799898554397 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.225 0.0 0.0 0.0 0.0 86-87 0.25 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3625 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5875 0.0 0.0 0.0 0.0 96-97 0.7749999999999999 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.075 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.5750000000000002 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.525 0.0 0.0 0.0 0.0 122-123 3.9625000000000004 0.0 0.0 0.0 0.0 124-125 4.1875 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.050000000000001 0.0 0.0 0.0 0.0 130-131 5.5625 0.0 0.0 0.0 0.0 132-133 6.0125 0.0 0.0 0.0 0.0 134-135 6.425 0.0 0.0 0.0 0.0 136-137 6.887499999999999 0.0 0.0 0.0 0.0 138-139 7.362500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 20 0.00593511 29.0 60-64 >>END_MODULE Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677745 spots for SRR7170464.sra Written 677745 spots for SRR7170464.sra Read 677747 spots for SRR7170464.sra Written 677747 spots for SRR7170464.sra SRR ids: ['SRR7170464.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_n3mznhsa SRR7170464.sra spots: 13554902 blocks: [[1, 677745], [677746, 1355490], [1355491, 2033235], [2033236, 2710980], [2710981, 3388725], [3388726, 4066470], [4066471, 4744215], [4744216, 5421960], [5421961, 6099705], [6099706, 6777450], [6777451, 7455195], [7455196, 8132940], [8132941, 8810685], [8810686, 9488430], [9488431, 10166175], [10166176, 10843920], [10843921, 11521665], [11521666, 12199410], [12199411, 12877155], [12877156, 13554902]] SRR7170464 file size 4571611 SRR7170464 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170464 SRR7170464_1.fastq SRR7170464_2.fastq Input file: SRR7170464_1.fastq Paired file: SRR7170464_2.fastq trimmed: SRR7170464-trimmed-pair1.fastq, SRR7170464-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:44:20 2025 >> started Wed Feb 12 21:44:36 2025 >> done (15.912s) 13554902 read pairs processed; of these: 18008 ( 0.13%) short read pairs filtered out after trimming by size control 35227 ( 0.26%) empty read pairs filtered out after trimming by size control 13501667 (99.61%) read pairs available; of these: 7828279 (57.98%) trimmed read pairs available after processing 5673388 (42.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 7 0.00% 19 5 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 6 0.00% 24 7 0.00% 25 4 0.00% 26 4 0.00% 27 2 0.00% 28 6 0.00% 29 6 0.00% 30 11 0.00% 31 16 0.00% 32 9 0.00% 33 11 0.00% 34 12 0.00% 35 14 0.00% 36 20 0.00% 37 27 0.00% 38 31 0.00% 39 39 0.00% 40 35 0.00% 41 55 0.00% 42 42 0.00% 43 51 0.00% 44 63 0.00% 45 69 0.00% 46 82 0.00% 47 94 0.00% 48 96 0.00% 49 112 0.00% 50 149 0.00% 51 170 0.00% 52 180 0.00% 53 201 0.00% 54 214 0.00% 55 237 0.00% 56 239 0.00% 57 272 0.00% 58 310 0.00% 59 415 0.00% 60 451 0.00% 61 577 0.00% 62 601 0.00% 63 657 0.00% 64 679 0.01% 65 750 0.01% 66 770 0.01% 67 824 0.01% 68 958 0.01% 69 1023 0.01% 70 1316 0.01% 71 1429 0.01% 72 1719 0.01% 73 1945 0.01% 74 2094 0.02% 75 2403 0.02% 76 3236 0.02% 77 3172 0.02% 78 2794 0.02% 79 3072 0.02% 80 3365 0.02% 81 3841 0.03% 82 4385 0.03% 83 4814 0.04% 84 6247 0.05% 85 7121 0.05% 86 7467 0.06% 87 7471 0.06% 88 8017 0.06% 89 8302 0.06% 90 8772 0.06% 91 9534 0.07% 92 9903 0.07% 93 10854 0.08% 94 11533 0.09% 95 12300 0.09% 96 12880 0.10% 97 13144 0.10% 98 13552 0.10% 99 13888 0.10% 100 14726 0.11% 101 15057 0.11% 102 15998 0.12% 103 16938 0.13% 104 17947 0.13% 105 19013 0.14% 106 19657 0.15% 107 19898 0.15% 108 20114 0.15% 109 20615 0.15% 110 21517 0.16% 111 21660 0.16% 112 22688 0.17% 113 23733 0.18% 114 25018 0.19% 115 25853 0.19% 116 26786 0.20% 117 26999 0.20% 118 27593 0.20% 119 27447 0.20% 120 28479 0.21% 121 29029 0.22% 122 30371 0.22% 123 31814 0.24% 124 33332 0.25% 125 34406 0.25% 126 35630 0.26% 127 36996 0.27% 128 38036 0.28% 129 39658 0.29% 130 41259 0.31% 131 42996 0.32% 132 45190 0.33% 133 48179 0.36% 134 51092 0.38% 135 54694 0.41% 136 59161 0.44% 137 63982 0.47% 138 69432 0.51% 139 76071 0.56% 140 83489 0.62% 141 92650 0.69% 142 104489 0.77% 143 120267 0.89% 144 142066 1.05% 145 174382 1.29% 146 219821 1.63% 147 303520 2.25% 148 464319 3.44% 149 923052 6.84% 150 3669966 27.18% 151 5673388 42.02% 13501667 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=35 prefix-density=0.67 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=36.52 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.84 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=27 prefix-density=0.83 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=31 fanout-score=17.50 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.0 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7170464 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:45:25 Started mapping on | Feb 12 21:45:26 Finished on | Feb 12 21:48:45 Mapping speed, Million of reads per hour | 244.25 Number of input reads | 13501667 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11723976 Uniquely mapped reads % | 86.83% Average mapped length | 292.10 Number of splices: Total | 10531370 Number of splices: Annotated (sjdb) | 10306699 Number of splices: GT/AG | 10318801 Number of splices: GC/AG | 171093 Number of splices: AT/AC | 7994 Number of splices: Non-canonical | 33482 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346911 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 26949 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 10.34% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 1444865 1444865 1444865 N_multimapping 346911 346911 346911 N_noFeature 258965 11432206 320778 N_ambiguous 329503 812 99301 UnstrandedReadsAssigned:11135508 PositiveStrandReadsAssigned:290958 NegativeStrandReadsAssigned:11303897 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170464 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170464-trimmed-pair1.fastq SRR7170464-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,501,667 reads, 11,218,322 reads pseudoaligned [quant] estimated average fragment length: 250.434 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,283 rounds 52401 SRR7170464.ke.tsv 34699 SRR7170464.se.tsv 87100 total ==> SRR7170464.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1768.57 397 14.2839 Potri.005G024800.1.v4.1 1035 785.566 393 31.8338 Potri.004G059700.1.v4.1 961 711.576 22 1.96734 Potri.007G009000.2.v4.1 1416 1166.57 0 0 Potri.003G141000.2.v4.1 2943 2693.57 613 14.4814 Potri.016G087400.1.v4.1 270 80.2797 762.665 604.515 Potri.015G069301.1.v4.1 564 317.224 0 0 Potri.010G195200.1.v4.1 1773 1523.57 119.632 4.99647 Potri.012G127500.1.v4.1 977 727.571 226 19.7657 ==> SRR7170464.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 441 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 329 Potri.001G212900.v4.1 45 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 118 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170464 completed mapping pipeline successfully