Starting /dee2/code/volunteer_pipeline.sh SRR7170465 current disk space = 3050600177664 free memory = 1575696296 SRR7170465 SRAfilesize 411d863aabc19cfeb0c992059bb8a88e SRR7170465.sra SRR7170465.sra file validated SRR7170465 is paired end SRR7170465 is conventional basespace SRR7170465 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170465_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.09575 25.0 18.0 33.0 18.0 33.0 2 24.89775 25.0 18.0 30.0 18.0 33.0 3 28.6525 29.0 27.0 31.0 18.0 33.0 4 31.39425 33.0 31.0 33.0 29.0 33.0 5 32.49375 33.0 33.0 33.0 32.0 33.0 6 36.20375 38.0 36.0 38.0 33.0 38.0 7 36.46975 38.0 37.0 38.0 34.0 38.0 8 37.01625 38.0 38.0 38.0 35.0 38.0 9 37.29825 38.0 38.0 38.0 36.0 38.0 10-14 37.411100000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.51365 38.0 38.0 38.0 37.0 38.0 20-24 37.2112 38.0 38.0 38.0 36.0 38.0 25-29 36.63355 38.0 37.8 38.0 34.2 38.0 30-34 37.35015 38.0 38.0 38.0 36.8 38.0 35-39 37.4884 38.0 38.0 38.0 37.0 38.0 40-44 36.817099999999996 38.0 37.8 38.0 34.8 38.0 45-49 34.7023 37.8 33.8 38.0 25.2 38.0 50-54 37.0535 38.0 37.8 38.0 35.6 38.0 55-59 37.217349999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.115849999999995 38.0 38.0 38.0 36.0 38.0 65-69 36.99635 38.0 38.0 38.0 35.6 38.0 70-74 37.011250000000004 38.0 38.0 38.0 36.0 38.0 75-79 36.87845 38.0 38.0 38.0 34.8 38.0 80-84 36.763099999999994 38.0 38.0 38.0 34.6 38.0 85-89 36.5245 38.0 37.8 38.0 34.0 38.0 90-94 36.25775 38.0 37.2 38.0 33.4 38.0 95-99 36.38185 38.0 37.0 38.0 34.0 38.0 100-104 36.3365 38.0 37.0 38.0 33.8 38.0 105-109 36.18775 38.0 37.0 38.0 33.6 38.0 110-114 35.65295 38.0 36.2 38.0 31.0 38.0 115-119 35.27445 38.0 35.4 38.0 29.2 38.0 120-124 35.07505 38.0 35.4 38.0 28.0 38.0 125-129 34.9657 38.0 35.0 38.0 28.0 38.0 130-134 34.635149999999996 38.0 34.8 38.0 26.8 38.0 135-139 33.729200000000006 38.0 33.2 38.0 22.6 38.0 140-144 28.5205 32.8 23.0 37.0 10.6 38.0 145-149 25.280700000000003 31.2 12.4 37.4 2.0 38.0 150-151 15.784875 8.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 14 1.0 15 1.0 16 1.0 17 0.0 18 1.0 19 1.0 20 3.0 21 3.0 22 2.0 23 11.0 24 6.0 25 10.0 26 17.0 27 37.0 28 50.0 29 59.0 30 79.0 31 94.0 32 144.0 33 222.0 34 417.0 35 846.0 36 1436.0 37 559.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.587188612099645 11.311642094560243 8.38840874428063 44.71276054905948 2 20.500625782227786 15.344180225281601 32.49061326658323 31.66458072590738 3 20.025000000000002 18.8 27.0 34.175 4 22.0 28.849999999999998 22.6 26.55 5 21.875 32.975 25.95 19.2 6 19.05 35.3 25.025 20.625 7 14.374999999999998 24.725 42.625 18.275 8 17.2 24.65 32.05 26.1 9 17.2 23.9 35.575 23.325000000000003 10-14 19.785 29.725 28.105000000000004 22.384999999999998 15-19 19.715 28.815 28.49 22.98 20-24 20.335 28.675 27.889999999999997 23.1 25-29 19.855 29.080000000000002 27.485 23.580000000000002 30-34 19.755 28.849999999999998 27.925 23.47 35-39 20.165 29.13 27.41 23.294999999999998 40-44 20.572057205720572 28.462846284628462 27.71277127712771 23.25232523252325 45-49 19.945 28.375 27.939999999999998 23.74 50-54 19.255 27.865000000000002 28.96 23.919999999999998 55-59 19.545 28.595 28.275 23.585 60-64 20.11 28.595 28.03 23.265 65-69 20.03 28.175 28.355000000000004 23.44 70-74 20.10502625656414 28.217054263565895 28.197049262315577 23.48087021755439 75-79 20.13 27.96 28.1 23.810000000000002 80-84 19.21 28.395 28.395 24.0 85-89 20.857085708570857 28.182818281828183 28.132813281328133 22.827282728272827 90-94 20.240120060030016 27.68384192096048 28.74437218609305 23.33166583291646 95-99 19.706897414094936 27.744710648727057 28.940129045165808 23.608262892012206 100-104 20.225 28.595 28.134999999999998 23.044999999999998 105-109 20.49 28.689999999999998 27.375 23.445 110-114 20.09 28.535 27.615000000000002 23.76 115-119 20.19 28.549999999999997 27.939999999999998 23.32 120-124 20.4 28.34 27.555000000000003 23.705000000000002 125-129 20.4 27.744999999999997 28.365000000000002 23.49 130-134 20.46 28.655 27.48 23.405 135-139 20.465 27.705000000000002 27.93 23.9 140-144 20.29 28.144999999999996 27.375 24.19 145-149 21.125 28.499999999999996 27.36 23.015 150-151 20.1625 29.45 27.0625 23.325000000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 1.5 22 2.0 23 3.0 24 4.5 25 3.0 26 4.5 27 7.0 28 9.0 29 13.5 30 19.0 31 25.5 32 39.0 33 48.0 34 49.5 35 70.5 36 105.5 37 128.0 38 143.5 39 164.0 40 191.5 41 210.0 42 231.0 43 258.5 44 271.5 45 280.5 46 279.5 47 267.0 48 244.5 49 197.0 50 159.5 51 141.5 52 106.0 53 80.0 54 65.0 55 47.0 56 33.5 57 24.5 58 18.5 59 16.0 60 13.0 61 7.0 62 5.0 63 3.0 64 1.5 65 0.5 66 0.5 67 1.5 68 1.0 69 0.0 70 1.0 71 1.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.6500000000000001 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.05 95-99 0.034999999999999996 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72424166457759 99.45 2 0.2757583354224116 0.5499999999999999 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.85 0.0 0.0 0.0 0.0 108-109 1.0125 0.0 0.0 0.0 0.0 110-111 1.25 0.0 0.0 0.0 0.0 112-113 1.4 0.0 0.0 0.0 0.0 114-115 1.5125 0.0 0.0 0.0 0.0 116-117 1.675 0.0 0.0 0.0 0.0 118-119 1.8375 0.0 0.0 0.0 0.0 120-121 2.025 0.0 0.0 0.0 0.0 122-123 2.325 0.0 0.0 0.0 0.0 124-125 2.6375 0.0 0.0 0.0 0.0 126-127 2.8499999999999996 0.0 0.0 0.0 0.0 128-129 3.05 0.0 0.0 0.0 0.0 130-131 3.3125 0.0 0.0 0.0 0.0 132-133 3.4625 0.0 0.0 0.0 0.0 134-135 3.675 0.0 0.0 0.0 0.0 136-137 3.8625 0.0 0.0 0.0 0.0 138-139 4.1 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CATTCCC 10 0.006832588 144.9875 4 >>END_MODULE SRR7170465 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170465_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.07225 33.0 33.0 34.0 32.0 34.0 2 33.12125 34.0 33.0 34.0 32.0 34.0 3 33.1425 34.0 33.0 34.0 32.0 34.0 4 33.09125 34.0 33.0 34.0 33.0 34.0 5 33.097 34.0 33.0 34.0 32.0 34.0 6 37.2715 38.0 38.0 38.0 37.0 38.0 7 37.4005 38.0 38.0 38.0 37.0 38.0 8 37.33575 38.0 38.0 38.0 37.0 38.0 9 37.34825 38.0 38.0 38.0 37.0 38.0 10-14 36.635149999999996 38.0 37.2 38.0 32.8 38.0 15-19 36.86815 38.0 37.8 38.0 35.0 38.0 20-24 36.916399999999996 38.0 38.0 38.0 36.0 38.0 25-29 37.0036 38.0 38.0 38.0 36.4 38.0 30-34 37.15995 38.0 38.0 38.0 36.8 38.0 35-39 37.16925 38.0 38.0 38.0 36.8 38.0 40-44 37.185249999999996 38.0 38.0 38.0 37.0 38.0 45-49 35.912549999999996 38.0 35.6 38.0 30.8 38.0 50-54 36.182 38.0 37.2 38.0 30.2 38.0 55-59 37.1182 38.0 38.0 38.0 36.4 38.0 60-64 36.924549999999996 38.0 38.0 38.0 35.8 38.0 65-69 36.920849999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.80825 38.0 38.0 38.0 35.2 38.0 75-79 36.8596 38.0 38.0 38.0 35.8 38.0 80-84 36.722500000000004 38.0 38.0 38.0 35.2 38.0 85-89 36.69885 38.0 38.0 38.0 35.0 38.0 90-94 36.6637 38.0 38.0 38.0 34.8 38.0 95-99 36.4474 38.0 38.0 38.0 34.0 38.0 100-104 36.217349999999996 38.0 37.8 38.0 33.8 38.0 105-109 36.13355 38.0 37.0 38.0 33.4 38.0 110-114 36.154450000000004 38.0 37.4 38.0 33.4 38.0 115-119 35.8343 38.0 37.0 38.0 32.2 38.0 120-124 35.35445 38.0 36.2 38.0 29.8 38.0 125-129 34.87585 38.0 35.6 38.0 27.6 38.0 130-134 34.79815000000001 38.0 35.2 38.0 28.2 38.0 135-139 34.101699999999994 38.0 33.4 38.0 24.6 38.0 140-144 33.35995 38.0 33.0 38.0 21.0 38.0 145-149 32.429449999999996 38.0 33.0 38.0 12.2 38.0 150-151 26.507125000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 1.0 4 2.0 5 0.0 6 2.0 7 0.0 8 1.0 9 1.0 10 3.0 11 2.0 12 0.0 13 1.0 14 1.0 15 2.0 16 6.0 17 6.0 18 2.0 19 2.0 20 2.0 21 2.0 22 7.0 23 9.0 24 11.0 25 10.0 26 22.0 27 18.0 28 24.0 29 48.0 30 55.0 31 54.0 32 98.0 33 117.0 34 211.0 35 337.0 36 849.0 37 2091.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.974999999999994 22.175 12.3 27.55 2 25.924999999999997 26.650000000000002 31.874999999999996 15.55 3 20.875 27.474999999999998 32.300000000000004 19.35 4 22.25 34.0 23.825 19.925 5 25.124999999999996 35.825 22.05 17.0 6 19.3 39.25 23.75 17.7 7 19.5 22.25 39.375 18.875 8 21.675 26.3 27.825 24.2 9 21.8 24.825 30.425 22.95 10-14 23.275000000000002 29.82 26.16 20.745 15-19 23.064999999999998 28.965000000000003 27.715 20.255000000000003 20-24 22.75 28.470000000000002 28.194999999999997 20.585 25-29 22.895 28.09 28.365000000000002 20.65 30-34 23.075000000000003 27.855 28.105000000000004 20.965 35-39 23.075000000000003 28.310000000000002 27.845 20.77 40-44 23.21 28.265 28.665000000000003 19.86 45-49 22.915 28.87 27.615000000000002 20.599999999999998 50-54 22.695 27.865000000000002 28.175 21.265 55-59 23.005 28.144999999999996 28.155 20.695 60-64 22.855 27.975 28.37 20.8 65-69 23.06 27.855 28.225 20.86 70-74 23.06 28.13 28.110000000000003 20.7 75-79 23.225 28.194999999999997 27.589999999999996 20.990000000000002 80-84 23.724999999999998 27.565 28.065 20.645 85-89 23.155 28.83 27.639999999999997 20.375 90-94 22.655 28.01 28.43 20.905 95-99 22.895 28.095 28.410000000000004 20.599999999999998 100-104 23.849999999999998 27.544999999999998 28.18 20.424999999999997 105-109 23.125 28.735 27.68 20.46 110-114 23.425 28.34 27.57 20.665 115-119 23.84 28.235 27.855 20.07 120-124 23.669999999999998 28.21 27.495000000000005 20.625 125-129 23.925 28.075 27.47 20.53 130-134 24.26 28.199999999999996 27.700000000000003 19.84 135-139 23.599999999999998 28.425 27.975 20.0 140-144 24.13 28.28 27.775 19.814999999999998 145-149 25.019999999999996 28.194999999999997 26.919999999999998 19.865 150-151 25.874999999999996 27.975 26.700000000000003 19.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 3.0 24 3.5 25 3.0 26 2.5 27 5.0 28 10.5 29 13.0 30 19.5 31 25.5 32 31.5 33 43.5 34 54.5 35 76.0 36 100.5 37 117.0 38 135.5 39 163.0 40 202.0 41 226.0 42 252.5 43 268.0 44 280.5 45 277.0 46 261.5 47 260.0 48 236.5 49 187.0 50 152.5 51 143.5 52 118.0 53 87.5 54 60.0 55 45.5 56 35.0 57 25.5 58 20.5 59 13.5 60 9.5 61 7.0 62 7.0 63 6.5 64 3.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64877069744105 99.3 2 0.35122930255895635 0.7000000000000001 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.1 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.175 0.0 0.0 0.0 0.0 92-93 0.175 0.0 0.0 0.0 0.0 94-95 0.21250000000000002 0.0 0.0 0.0 0.0 96-97 0.275 0.0 0.0 0.0 0.0 98-99 0.3625 0.0 0.0 0.0 0.0 100-101 0.4375 0.0 0.0 0.0 0.0 102-103 0.5875 0.0 0.0 0.0 0.0 104-105 0.725 0.0 0.0 0.0 0.0 106-107 0.8625 0.0 0.0 0.0 0.0 108-109 1.0375 0.0 0.0 0.0 0.0 110-111 1.3 0.0 0.0 0.0 0.0 112-113 1.4500000000000002 0.0 0.0 0.0 0.0 114-115 1.5625 0.0 0.0 0.0 0.0 116-117 1.725 0.0 0.0 0.0 0.0 118-119 1.8875 0.0 0.0 0.0 0.0 120-121 2.05 0.0 0.0 0.0 0.0 122-123 2.35 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.9000000000000004 0.0 0.0 0.0 0.0 128-129 3.0999999999999996 0.0 0.0 0.0 0.0 130-131 3.3625 0.0 0.0 0.0 0.0 132-133 3.55 0.0 0.0 0.0 0.0 134-135 3.8375 0.0 0.0 0.0 0.0 136-137 4.125 0.0 0.0 0.0 0.0 138-139 4.4625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTGGT 10 0.006830828 145.0 5 >>END_MODULE Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727356 spots for SRR7170465.sra Written 727356 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra Read 727354 spots for SRR7170465.sra Written 727354 spots for SRR7170465.sra SRR ids: ['SRR7170465.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_rg747_77 SRR7170465.sra spots: 14547082 blocks: [[1, 727354], [727355, 1454708], [1454709, 2182062], [2182063, 2909416], [2909417, 3636770], [3636771, 4364124], [4364125, 5091478], [5091479, 5818832], [5818833, 6546186], [6546187, 7273540], [7273541, 8000894], [8000895, 8728248], [8728249, 9455602], [9455603, 10182956], [10182957, 10910310], [10910311, 11637664], [11637665, 12365018], [12365019, 13092372], [13092373, 13819726], [13819727, 14547082]] SRR7170465 file size 4907828 SRR7170465 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170465 SRR7170465_1.fastq SRR7170465_2.fastq Input file: SRR7170465_1.fastq Paired file: SRR7170465_2.fastq trimmed: SRR7170465-trimmed-pair1.fastq, SRR7170465-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:44:01 2025 >> started Wed Feb 12 21:44:17 2025 >> done (15.646s) 14547082 read pairs processed; of these: 8213 ( 0.06%) short read pairs filtered out after trimming by size control 7315 ( 0.05%) empty read pairs filtered out after trimming by size control 14531554 (99.89%) read pairs available; of these: 8209679 (56.50%) trimmed read pairs available after processing 6321875 (43.50%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 2 0.00% 20 4 0.00% 21 5 0.00% 22 6 0.00% 23 3 0.00% 24 4 0.00% 25 4 0.00% 26 1 0.00% 27 4 0.00% 28 2 0.00% 29 3 0.00% 30 3 0.00% 31 6 0.00% 32 5 0.00% 33 1 0.00% 34 6 0.00% 35 4 0.00% 36 5 0.00% 37 5 0.00% 38 13 0.00% 39 15 0.00% 40 15 0.00% 41 10 0.00% 42 12 0.00% 43 13 0.00% 44 20 0.00% 45 22 0.00% 46 28 0.00% 47 38 0.00% 48 42 0.00% 49 51 0.00% 50 34 0.00% 51 61 0.00% 52 79 0.00% 53 52 0.00% 54 71 0.00% 55 85 0.00% 56 94 0.00% 57 125 0.00% 58 126 0.00% 59 158 0.00% 60 166 0.00% 61 196 0.00% 62 217 0.00% 63 260 0.00% 64 310 0.00% 65 294 0.00% 66 351 0.00% 67 423 0.00% 68 425 0.00% 69 493 0.00% 70 605 0.00% 71 690 0.00% 72 732 0.01% 73 904 0.01% 74 1017 0.01% 75 1117 0.01% 76 1220 0.01% 77 1400 0.01% 78 1484 0.01% 79 1673 0.01% 80 1859 0.01% 81 2074 0.01% 82 2356 0.02% 83 2765 0.02% 84 3287 0.02% 85 3843 0.03% 86 4013 0.03% 87 4307 0.03% 88 4528 0.03% 89 4864 0.03% 90 5265 0.04% 91 5687 0.04% 92 6060 0.04% 93 6649 0.05% 94 7211 0.05% 95 7608 0.05% 96 8194 0.06% 97 8571 0.06% 98 8990 0.06% 99 9223 0.06% 100 9821 0.07% 101 10400 0.07% 102 10671 0.07% 103 11501 0.08% 104 11976 0.08% 105 12571 0.09% 106 13201 0.09% 107 13586 0.09% 108 13937 0.10% 109 14342 0.10% 110 15353 0.11% 111 15547 0.11% 112 16258 0.11% 113 17212 0.12% 114 17517 0.12% 115 18149 0.12% 116 19099 0.13% 117 19917 0.14% 118 20364 0.14% 119 20990 0.14% 120 21359 0.15% 121 22106 0.15% 122 22847 0.16% 123 23837 0.16% 124 25081 0.17% 125 26492 0.18% 126 27710 0.19% 127 28882 0.20% 128 30614 0.21% 129 31873 0.22% 130 33239 0.23% 131 35064 0.24% 132 37387 0.26% 133 39933 0.27% 134 42843 0.29% 135 45501 0.31% 136 49872 0.34% 137 54429 0.37% 138 59844 0.41% 139 67051 0.46% 140 75095 0.52% 141 86256 0.59% 142 99753 0.69% 143 118079 0.81% 144 145326 1.00% 145 182892 1.26% 146 241765 1.66% 147 343097 2.36% 148 545107 3.75% 149 1085052 7.47% 150 4136313 28.46% 151 6321875 43.50% 14531554 reads passed initial QC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=20.18 fanout-score-rank=1 prefix-density=0.17 prefix-fanout=2.9 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCT criterion=sequence-density sequence-density=0.50 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=25 prefix-density=0.50 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.08 sequence-density-rank=25 fanout-score=27.59 fanout-score-rank=1 prefix-density=0.22 prefix-fanout=9.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170465 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:45:01 Started mapping on | Feb 12 21:45:01 Finished on | Feb 12 21:46:41 Mapping speed, Million of reads per hour | 523.14 Number of input reads | 14531554 Average input read length | 295 UNIQUE READS: Uniquely mapped reads number | 13684437 Uniquely mapped reads % | 94.17% Average mapped length | 294.43 Number of splices: Total | 13124107 Number of splices: Annotated (sjdb) | 12788185 Number of splices: GT/AG | 12882079 Number of splices: GC/AG | 192253 Number of splices: AT/AC | 8086 Number of splices: Non-canonical | 41689 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.69 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403975 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 22328 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.85% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 451487 451487 451487 N_multimapping 403975 403975 403975 N_noFeature 542400 13480527 625857 N_ambiguous 243777 1082 122683 UnstrandedReadsAssigned:12898260 PositiveStrandReadsAssigned:202828 NegativeStrandReadsAssigned:12935897 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170465 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170465-trimmed-pair1.fastq SRR7170465-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,531,554 reads, 12,883,963 reads pseudoaligned [quant] estimated average fragment length: 278.783 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,106 rounds 52401 SRR7170465.ke.tsv 34699 SRR7170465.se.tsv 87100 total ==> SRR7170465.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1740.22 1791 77.2165 Potri.005G024800.1.v4.1 1035 757.217 396 39.2367 Potri.004G059700.1.v4.1 961 683.232 7 0.768683 Potri.007G009000.2.v4.1 1416 1138.22 0 0 Potri.003G141000.2.v4.1 2943 2665.22 532.268 14.9836 Potri.016G087400.1.v4.1 270 73.8224 911 925.866 Potri.015G069301.1.v4.1 564 292.965 0 0 Potri.010G195200.1.v4.1 1773 1495.22 10 0.50178 Potri.012G127500.1.v4.1 977 699.222 389 41.74 ==> SRR7170465.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 905 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 263 Potri.001G212900.v4.1 62 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 28 SRR7170465 completed mapping pipeline successfully