Starting /dee2/code/volunteer_pipeline.sh SRR7170466 current disk space = 3050949660672 free memory = 1036534276 SRR7170466 SRAfilesize 9be80137ef85674dd0d753dfef6e2c42 SRR7170466.sra SRR7170466.sra file validated SRR7170466 is paired end SRR7170466 is conventional basespace SRR7170466 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170466_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.24475 18.0 18.0 25.0 18.0 32.0 2 29.6835 30.0 28.0 31.0 27.0 33.0 3 30.2935 31.0 29.0 33.0 27.0 33.0 4 31.58725 33.0 31.0 33.0 29.0 33.0 5 32.529 33.0 33.0 33.0 31.0 34.0 6 37.0095 38.0 37.0 38.0 36.0 38.0 7 37.299 38.0 38.0 38.0 36.0 38.0 8 37.456 38.0 38.0 38.0 37.0 38.0 9 37.4335 38.0 38.0 38.0 37.0 38.0 10-14 36.74615 38.0 37.4 38.0 34.0 38.0 15-19 37.45675 38.0 38.0 38.0 37.0 38.0 20-24 37.4567 38.0 38.0 38.0 37.0 38.0 25-29 36.47985 38.0 37.0 38.0 31.8 38.0 30-34 37.09895 38.0 38.0 38.0 35.4 38.0 35-39 37.2594 38.0 38.0 38.0 36.6 38.0 40-44 37.3927 38.0 38.0 38.0 37.0 38.0 45-49 37.32125 38.0 38.0 38.0 36.8 38.0 50-54 37.276300000000006 38.0 38.0 38.0 36.4 38.0 55-59 37.189949999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.11515 38.0 38.0 38.0 36.0 38.0 65-69 37.0536 38.0 38.0 38.0 36.0 38.0 70-74 36.58385 38.0 37.8 38.0 34.0 38.0 75-79 36.844550000000005 38.0 38.0 38.0 35.2 38.0 80-84 36.7929 38.0 38.0 38.0 34.8 38.0 85-89 36.5743 38.0 38.0 38.0 34.2 38.0 90-94 36.5296 38.0 38.0 38.0 34.0 38.0 95-99 36.4114 38.0 37.8 38.0 34.0 38.0 100-104 36.44475 38.0 37.8 38.0 34.0 38.0 105-109 36.3714 38.0 37.4 38.0 33.8 38.0 110-114 36.14125 38.0 37.0 38.0 33.6 38.0 115-119 35.817249999999994 38.0 36.8 38.0 32.0 38.0 120-124 35.67655 38.0 36.2 38.0 31.0 38.0 125-129 35.31705 38.0 36.0 38.0 29.8 38.0 130-134 35.0985 38.0 35.6 38.0 28.6 38.0 135-139 34.55585 38.0 34.6 38.0 26.2 38.0 140-144 34.40255 38.0 35.0 38.0 26.2 38.0 145-149 33.6101 38.0 34.0 38.0 22.6 38.0 150-151 29.406374999999997 35.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 7 1.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 1.0 18 3.0 19 6.0 20 3.0 21 4.0 22 3.0 23 5.0 24 10.0 25 7.0 26 12.0 27 18.0 28 26.0 29 28.0 30 46.0 31 64.0 32 92.0 33 133.0 34 184.0 35 386.0 36 1066.0 37 1898.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.44117647058824 12.55252100840336 11.318277310924369 35.688025210084035 2 20.135067533766886 16.18309154577289 35.5927963981991 28.08904452226113 3 18.3 21.925 27.500000000000004 32.275 4 23.0 30.95 22.2 23.849999999999998 5 21.275 34.475 24.175 20.075000000000003 6 18.4 35.825 25.1 20.674999999999997 7 14.025000000000002 25.775 42.0 18.2 8 17.549999999999997 26.25 30.675 25.525 9 17.075000000000003 23.9 33.75 25.275 10-14 18.915000000000003 30.294999999999998 27.155 23.635 15-19 19.29 28.025 28.4 24.285 20-24 19.285 28.63 28.110000000000003 23.974999999999998 25-29 19.27 29.310000000000002 27.805000000000003 23.615 30-34 19.145 28.685 28.815 23.355 35-39 19.295 28.71 27.894999999999996 24.099999999999998 40-44 19.935 28.694999999999997 27.815 23.555 45-49 19.63 28.605000000000004 28.12 23.645 50-54 19.96 28.175 28.23 23.635 55-59 20.015 28.63 27.894999999999996 23.46 60-64 20.135 29.455 27.865000000000002 22.545 65-69 19.89 28.084999999999997 28.515 23.51 70-74 19.794999999999998 28.29 28.315 23.599999999999998 75-79 19.845 28.994999999999997 27.939999999999998 23.22 80-84 20.24 28.389999999999997 28.015 23.355 85-89 20.68 28.235 27.944999999999997 23.14 90-94 20.225 28.720000000000002 27.445000000000004 23.61 95-99 19.71 28.7 28.235 23.355 100-104 20.52 28.29 27.575 23.615 105-109 20.044999999999998 28.255000000000003 27.935 23.765 110-114 20.32 28.345 27.625 23.71 115-119 19.965 28.965000000000003 27.16 23.91 120-124 20.580000000000002 28.26 27.735 23.425 125-129 20.745 28.28 27.38 23.595 130-134 20.43 28.27 27.54 23.76 135-139 20.84 27.860000000000003 27.865000000000002 23.435 140-144 20.87 28.355000000000004 27.295 23.48 145-149 20.605 28.225 27.35 23.82 150-151 19.5625 28.15 27.400000000000002 24.887500000000003 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 1.0 18 1.0 19 0.5 20 0.0 21 1.0 22 2.0 23 3.0 24 5.5 25 6.0 26 6.5 27 8.0 28 6.0 29 8.5 30 20.0 31 35.0 32 43.5 33 53.0 34 73.0 35 84.0 36 96.5 37 121.0 38 143.0 39 166.0 40 198.0 41 230.5 42 257.5 43 275.0 44 264.0 45 257.0 46 254.0 47 241.5 48 212.5 49 176.0 50 157.5 51 141.5 52 108.0 53 84.5 54 68.0 55 50.0 56 46.5 57 29.0 58 18.0 59 14.5 60 7.5 61 6.0 62 5.5 63 2.5 64 2.5 65 2.5 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.8 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.69894631209232 99.35000000000001 2 0.27596588058203714 0.5499999999999999 3 0.0 0.0 4 0.025087807325639738 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.38749999999999996 0.0 0.0 0.0 0.0 90-91 0.45 0.0 0.0 0.0 0.0 92-93 0.5125 0.0 0.0 0.0 0.0 94-95 0.6125 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 1.0499999999999998 0.0 0.0 0.0 0.0 104-105 1.3 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.75 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.5999999999999996 0.0 0.0 0.0 0.0 118-119 2.9749999999999996 0.0 0.0 0.0 0.0 120-121 3.1375 0.0 0.0 0.0 0.0 122-123 3.425 0.0 0.0 0.0 0.0 124-125 3.7625 0.0 0.0 0.0 0.0 126-127 3.9875 0.0 0.0 0.0 0.0 128-129 4.387499999999999 0.0 0.0 0.0 0.0 130-131 4.6625 0.0 0.0 0.0 0.0 132-133 4.8875 0.0 0.0 0.0 0.0 134-135 5.15 0.0 0.0 0.0 0.0 136-137 5.5375 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACACATT 10 0.006836113 144.9625 4 ACCTCCT 10 0.006836113 144.9625 9 >>END_MODULE SRR7170466 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170466_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.02025 33.0 33.0 34.0 32.0 34.0 2 33.116 34.0 33.0 34.0 32.0 34.0 3 33.09525 34.0 33.0 34.0 33.0 34.0 4 33.111 34.0 33.0 34.0 33.0 34.0 5 33.114 34.0 33.0 34.0 33.0 34.0 6 37.28425 38.0 38.0 38.0 37.0 38.0 7 37.354 38.0 38.0 38.0 37.0 38.0 8 37.28575 38.0 38.0 38.0 37.0 38.0 9 37.311 38.0 38.0 38.0 37.0 38.0 10-14 37.24855 38.0 38.0 38.0 37.0 38.0 15-19 37.16105 38.0 38.0 38.0 37.0 38.0 20-24 37.1039 38.0 38.0 38.0 37.0 38.0 25-29 37.099849999999996 38.0 38.0 38.0 36.8 38.0 30-34 37.2315 38.0 38.0 38.0 37.0 38.0 35-39 37.21195 38.0 38.0 38.0 37.0 38.0 40-44 37.115300000000005 38.0 38.0 38.0 36.8 38.0 45-49 36.9769 38.0 38.0 38.0 36.0 38.0 50-54 36.733250000000005 38.0 38.0 38.0 35.8 38.0 55-59 36.88535 38.0 38.0 38.0 35.8 38.0 60-64 36.33 38.0 37.4 38.0 33.0 38.0 65-69 36.8252 38.0 38.0 38.0 35.8 38.0 70-74 36.52545 38.0 38.0 38.0 34.6 38.0 75-79 36.6234 38.0 38.0 38.0 35.0 38.0 80-84 36.005900000000004 38.0 37.4 38.0 30.2 38.0 85-89 35.07854999999999 38.0 35.4 38.0 27.6 38.0 90-94 36.41845 38.0 37.8 38.0 34.0 38.0 95-99 36.2693 38.0 38.0 38.0 34.0 38.0 100-104 36.003499999999995 38.0 37.4 38.0 30.2 38.0 105-109 35.57455 38.0 36.4 38.0 30.6 38.0 110-114 35.619299999999996 38.0 37.0 38.0 31.0 38.0 115-119 35.69805 38.0 37.0 38.0 31.8 38.0 120-124 35.5121 38.0 36.6 38.0 30.6 38.0 125-129 35.134 38.0 36.0 38.0 30.0 38.0 130-134 34.46340000000001 38.0 34.2 38.0 26.2 38.0 135-139 34.4375 38.0 34.4 38.0 26.6 38.0 140-144 33.5736 38.0 33.2 38.0 20.6 38.0 145-149 32.87355 38.0 33.0 38.0 16.6 38.0 150-151 27.7165 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 2.0 5 1.0 6 3.0 7 0.0 8 2.0 9 2.0 10 3.0 11 3.0 12 2.0 13 1.0 14 0.0 15 2.0 16 4.0 17 1.0 18 5.0 19 5.0 20 4.0 21 6.0 22 7.0 23 6.0 24 10.0 25 11.0 26 15.0 27 17.0 28 19.0 29 38.0 30 56.0 31 85.0 32 83.0 33 119.0 34 202.0 35 317.0 36 820.0 37 2139.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.2 21.8 13.450000000000001 26.55 2 25.8 26.224999999999998 31.7 16.275000000000002 3 19.975 28.675 32.0 19.35 4 23.7 35.0 23.400000000000002 17.9 5 25.15 35.9 22.025 16.925 6 19.650000000000002 37.75 25.05 17.549999999999997 7 19.7 19.400000000000002 40.925 19.975 8 21.775 25.45 27.250000000000004 25.525 9 20.775 25.275 30.349999999999998 23.599999999999998 10-14 23.435 29.435 26.200000000000003 20.93 15-19 22.945 28.025 28.26 20.77 20-24 23.09 28.505000000000003 28.075 20.330000000000002 25-29 23.25 28.33 27.72 20.7 30-34 22.805 28.360000000000003 28.005000000000003 20.830000000000002 35-39 22.825 28.33 27.839999999999996 21.005 40-44 23.02 28.405 27.889999999999997 20.685000000000002 45-49 22.78 28.24 28.12 20.86 50-54 23.185 27.474999999999998 28.465 20.875 55-59 22.54 27.63 28.595 21.235 60-64 23.405 27.83 28.194999999999997 20.57 65-69 24.29 28.155 27.255000000000003 20.3 70-74 23.68 27.805000000000003 27.26 21.255 75-79 22.95 28.055000000000003 27.994999999999997 21.0 80-84 23.380000000000003 28.305000000000003 27.775 20.54 85-89 23.369999999999997 28.52 27.834999999999997 20.275000000000002 90-94 24.075 27.694999999999997 27.505000000000003 20.724999999999998 95-99 22.725 28.57 27.794999999999998 20.91 100-104 23.615 28.49 27.755000000000003 20.14 105-109 24.25 27.93 27.515 20.305 110-114 23.395 28.62 27.41 20.575 115-119 24.075 27.965 27.82 20.14 120-124 24.135 28.175 27.505000000000003 20.185 125-129 24.19 28.449999999999996 27.295 20.064999999999998 130-134 24.585 27.639999999999997 27.395000000000003 20.380000000000003 135-139 24.529999999999998 28.115000000000002 27.08 20.275000000000002 140-144 23.880000000000003 28.27 27.560000000000002 20.29 145-149 25.069999999999997 28.194999999999997 27.405 19.33 150-151 23.5125 28.299999999999997 27.825 20.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 1.0 23 1.5 24 3.0 25 4.0 26 3.0 27 5.5 28 9.5 29 11.5 30 15.5 31 19.0 32 31.5 33 45.5 34 55.0 35 71.0 36 89.5 37 107.5 38 142.5 39 165.0 40 181.0 41 207.0 42 235.0 43 287.0 44 292.0 45 275.0 46 266.0 47 249.5 48 230.0 49 200.0 50 185.0 51 150.5 52 114.5 53 89.0 54 70.5 55 58.0 56 37.5 57 29.5 58 20.0 59 14.0 60 11.0 61 4.5 62 4.5 63 2.0 64 1.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.225 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34492315444696 98.575 2 0.5794910556815319 1.15 3 0.05039052658100278 0.15 4 0.0 0.0 5 0.02519526329050139 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.037500000000000006 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.16249999999999998 0.0 0.0 0.0 0.0 84-85 0.23750000000000002 0.0 0.0 0.0 0.0 86-87 0.325 0.0 0.0 0.0 0.0 88-89 0.36250000000000004 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.4875 0.0 0.0 0.0 0.0 94-95 0.5874999999999999 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8125 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.45 0.0 0.0 0.0 0.0 108-109 1.7 0.0 0.0 0.0 0.0 110-111 1.9500000000000002 0.0 0.0 0.0 0.0 112-113 2.0625 0.0 0.0 0.0 0.0 114-115 2.25 0.0 0.0 0.0 0.0 116-117 2.55 0.0 0.0 0.0 0.0 118-119 2.9375 0.0 0.0 0.0 0.0 120-121 3.1125 0.0 0.0 0.0 0.0 122-123 3.4124999999999996 0.0 0.0 0.0 0.0 124-125 3.7375 0.0 0.0 0.0 0.0 126-127 3.9625000000000004 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 4.85 0.0 0.0 0.0 0.0 134-135 5.125 0.0 0.0 0.0 0.0 136-137 5.5125 0.0 0.0 0.0 0.0 138-139 5.75 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779367 spots for SRR7170466.sra Written 779367 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra Read 779348 spots for SRR7170466.sra Written 779348 spots for SRR7170466.sra SRR ids: ['SRR7170466.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_59uk12b_ SRR7170466.sra spots: 15586979 blocks: [[1, 779348], [779349, 1558696], [1558697, 2338044], [2338045, 3117392], [3117393, 3896740], [3896741, 4676088], [4676089, 5455436], [5455437, 6234784], [6234785, 7014132], [7014133, 7793480], [7793481, 8572828], [8572829, 9352176], [9352177, 10131524], [10131525, 10910872], [10910873, 11690220], [11690221, 12469568], [12469569, 13248916], [13248917, 14028264], [14028265, 14807612], [14807613, 15586979]] SRR7170466 file size 5260215 SRR7170466 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170466 SRR7170466_1.fastq SRR7170466_2.fastq Input file: SRR7170466_1.fastq Paired file: SRR7170466_2.fastq trimmed: SRR7170466-trimmed-pair1.fastq, SRR7170466-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:13:35 2025 >> started Wed Feb 12 21:13:56 2025 >> done (20.414s) 15586979 read pairs processed; of these: 12596 ( 0.08%) short read pairs filtered out after trimming by size control 12554 ( 0.08%) empty read pairs filtered out after trimming by size control 15561829 (99.84%) read pairs available; of these: 8701713 (55.92%) trimmed read pairs available after processing 6860116 (44.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 1 0.00% 21 6 0.00% 22 2 0.00% 23 2 0.00% 24 7 0.00% 25 4 0.00% 26 7 0.00% 27 7 0.00% 28 3 0.00% 29 7 0.00% 30 2 0.00% 31 3 0.00% 32 9 0.00% 33 11 0.00% 34 11 0.00% 35 10 0.00% 36 9 0.00% 37 14 0.00% 38 31 0.00% 39 23 0.00% 40 23 0.00% 41 23 0.00% 42 40 0.00% 43 38 0.00% 44 34 0.00% 45 46 0.00% 46 57 0.00% 47 57 0.00% 48 80 0.00% 49 90 0.00% 50 95 0.00% 51 121 0.00% 52 140 0.00% 53 158 0.00% 54 178 0.00% 55 153 0.00% 56 193 0.00% 57 235 0.00% 58 253 0.00% 59 297 0.00% 60 377 0.00% 61 395 0.00% 62 464 0.00% 63 511 0.00% 64 547 0.00% 65 587 0.00% 66 684 0.00% 67 760 0.00% 68 805 0.01% 69 968 0.01% 70 1024 0.01% 71 1212 0.01% 72 1415 0.01% 73 1529 0.01% 74 1715 0.01% 75 1943 0.01% 76 2132 0.01% 77 2321 0.01% 78 2542 0.02% 79 2696 0.02% 80 3085 0.02% 81 3444 0.02% 82 3855 0.02% 83 4383 0.03% 84 5289 0.03% 85 6080 0.04% 86 6388 0.04% 87 6643 0.04% 88 7013 0.05% 89 7366 0.05% 90 7771 0.05% 91 8483 0.05% 92 9200 0.06% 93 9991 0.06% 94 10793 0.07% 95 11229 0.07% 96 11828 0.08% 97 12244 0.08% 98 12889 0.08% 99 13049 0.08% 100 13899 0.09% 101 14620 0.09% 102 15352 0.10% 103 16263 0.10% 104 16858 0.11% 105 17942 0.12% 106 18250 0.12% 107 18800 0.12% 108 18942 0.12% 109 19588 0.13% 110 19983 0.13% 111 20861 0.13% 112 21478 0.14% 113 22017 0.14% 114 23101 0.15% 115 23956 0.15% 116 24780 0.16% 117 25314 0.16% 118 26007 0.17% 119 26415 0.17% 120 26971 0.17% 121 27603 0.18% 122 28525 0.18% 123 30010 0.19% 124 30738 0.20% 125 32462 0.21% 126 33697 0.22% 127 35147 0.23% 128 36520 0.23% 129 37264 0.24% 130 39662 0.25% 131 41429 0.27% 132 43318 0.28% 133 46575 0.30% 134 49834 0.32% 135 53302 0.34% 136 58472 0.38% 137 62822 0.40% 138 68771 0.44% 139 76216 0.49% 140 83998 0.54% 141 96563 0.62% 142 111379 0.72% 143 131358 0.84% 144 159745 1.03% 145 209543 1.35% 146 257902 1.66% 147 365608 2.35% 148 559120 3.59% 149 1074924 6.91% 150 4199669 26.99% 151 6860116 44.08% 15561829 reads passed initial QC criterion=sequence-density sequence-density=0.38 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=27 prefix-density=0.39 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.13 sequence-density-rank=20 fanout-score=12.55 fanout-score-rank=1 prefix-density=0.82 prefix-fanout=2.0 sequence=TGCTTGCTTCTAATCTTAATGGCGCCCACAATTACGCTTGTAAGGATT criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=2.20 fanout-score-rank=22 prefix-density=0.69 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=25.10 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=4.1 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170466 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:14:45 Started mapping on | Feb 12 21:14:45 Finished on | Feb 12 21:16:48 Mapping speed, Million of reads per hour | 455.47 Number of input reads | 15561829 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14625053 Uniquely mapped reads % | 93.98% Average mapped length | 293.24 Number of splices: Total | 14456461 Number of splices: Annotated (sjdb) | 14114798 Number of splices: GT/AG | 14195513 Number of splices: GC/AG | 209650 Number of splices: AT/AC | 8958 Number of splices: Non-canonical | 42340 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 413707 % of reads mapped to multiple loci | 2.66% Number of reads mapped to too many loci | 25880 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.12% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 535907 535907 535907 N_multimapping 413707 413707 413707 N_noFeature 541179 14362220 637104 N_ambiguous 284486 1100 117054 UnstrandedReadsAssigned:13799388 PositiveStrandReadsAssigned:261733 NegativeStrandReadsAssigned:13870895 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170466 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170466-trimmed-pair1.fastq SRR7170466-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,561,829 reads, 13,767,422 reads pseudoaligned [quant] estimated average fragment length: 271.595 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,112 rounds 52401 SRR7170466.ke.tsv 34699 SRR7170466.se.tsv 87100 total ==> SRR7170466.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.41 1056 39.513 Potri.005G024800.1.v4.1 1035 764.405 557 47.6432 Potri.004G059700.1.v4.1 961 690.432 6 0.568198 Potri.007G009000.2.v4.1 1416 1145.41 0 0 Potri.003G141000.2.v4.1 2943 2672.41 558.67 13.6686 Potri.016G087400.1.v4.1 270 78.1805 763 638.11 Potri.015G069301.1.v4.1 564 299.336 0 0 Potri.010G195200.1.v4.1 1773 1502.41 536 23.3264 Potri.012G127500.1.v4.1 977 706.422 231 21.3805 ==> SRR7170466.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 609 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 284 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 45 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170466 completed mapping pipeline successfully