Starting /dee2/code/volunteer_pipeline.sh SRR7170467 current disk space = 3050632040448 free memory = 1575080100 SRR7170467 SRAfilesize 2776f8b99c11af2c3f891f895675a363 SRR7170467.sra SRR7170467.sra file validated SRR7170467 is paired end SRR7170467 is conventional basespace SRR7170467 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170467_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.9685 18.0 18.0 30.0 18.0 32.0 2 30.74825 31.0 30.0 33.0 27.0 33.0 3 31.5955 33.0 31.0 33.0 28.0 33.0 4 31.952 33.0 31.0 33.0 29.0 33.0 5 32.67625 33.0 33.0 33.0 31.0 34.0 6 36.45525 38.0 37.0 38.0 34.0 38.0 7 36.85525 38.0 37.0 38.0 35.0 38.0 8 37.269 38.0 38.0 38.0 36.0 38.0 9 37.3935 38.0 38.0 38.0 37.0 38.0 10-14 36.6499 38.0 37.4 38.0 32.0 38.0 15-19 37.435 38.0 38.0 38.0 37.0 38.0 20-24 37.480650000000004 38.0 38.0 38.0 37.0 38.0 25-29 36.5269 38.0 37.0 38.0 32.0 38.0 30-34 37.087849999999996 38.0 38.0 38.0 35.4 38.0 35-39 37.2697 38.0 38.0 38.0 36.8 38.0 40-44 37.4219 38.0 38.0 38.0 37.0 38.0 45-49 37.37665 38.0 38.0 38.0 37.0 38.0 50-54 37.34525000000001 38.0 38.0 38.0 37.0 38.0 55-59 37.271 38.0 38.0 38.0 36.4 38.0 60-64 37.159850000000006 38.0 38.0 38.0 36.0 38.0 65-69 37.13185 38.0 38.0 38.0 36.0 38.0 70-74 36.7378 38.0 37.8 38.0 34.6 38.0 75-79 36.98975 38.0 38.0 38.0 35.8 38.0 80-84 36.8889 38.0 38.0 38.0 35.2 38.0 85-89 36.71790000000001 38.0 38.0 38.0 34.8 38.0 90-94 36.676899999999996 38.0 38.0 38.0 34.8 38.0 95-99 36.60785 38.0 38.0 38.0 34.0 38.0 100-104 36.61305 38.0 38.0 38.0 34.2 38.0 105-109 36.51610000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.34955000000001 38.0 37.2 38.0 34.0 38.0 115-119 35.95525 38.0 37.0 38.0 32.2 38.0 120-124 35.91545 38.0 36.8 38.0 32.6 38.0 125-129 35.5793 38.0 36.2 38.0 30.6 38.0 130-134 35.3846 38.0 36.0 38.0 30.2 38.0 135-139 34.8718 38.0 35.0 38.0 27.6 38.0 140-144 34.801249999999996 38.0 35.0 38.0 27.8 38.0 145-149 34.1108 38.0 34.2 38.0 25.4 38.0 150-151 29.896875 35.5 27.0 38.0 8.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 2.0 17 3.0 18 1.0 19 5.0 20 1.0 21 2.0 22 2.0 23 7.0 24 10.0 25 5.0 26 9.0 27 13.0 28 26.0 29 37.0 30 44.0 31 60.0 32 70.0 33 119.0 34 177.0 35 343.0 36 932.0 37 2132.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.47625295198111 11.414326948307531 12.936237208081868 40.173182891629494 2 21.38569284642321 15.682841420710355 34.817408704352175 28.114057028514257 3 19.8 20.8 25.85 33.550000000000004 4 22.1 27.400000000000002 23.775 26.724999999999998 5 21.5 33.175 25.525 19.8 6 18.45 35.9 26.325 19.325 7 15.174999999999999 25.674999999999997 40.65 18.5 8 17.275 26.55 31.374999999999996 24.8 9 16.3 25.724999999999998 34.1 23.875 10-14 19.215 29.925 27.235 23.625 15-19 18.895 29.659999999999997 27.615000000000002 23.830000000000002 20-24 19.365 29.345 27.500000000000004 23.79 25-29 19.505 29.815 27.229999999999997 23.45 30-34 18.815 29.025000000000002 27.74 24.42 35-39 19.42 28.79 27.839999999999996 23.95 40-44 19.88 29.544999999999998 26.995 23.580000000000002 45-49 19.325 28.875 27.860000000000003 23.94 50-54 20.18 29.515 26.810000000000002 23.494999999999997 55-59 19.21 29.494999999999997 27.58 23.715 60-64 19.830000000000002 28.965000000000003 27.650000000000002 23.555 65-69 20.055 28.365000000000002 28.1 23.48 70-74 19.29 28.910000000000004 27.765 24.035 75-79 19.89 28.52 28.24 23.35 80-84 20.09 28.575 27.555000000000003 23.78 85-89 19.759999999999998 28.199999999999996 27.744999999999997 24.295 90-94 19.935 28.53 27.74 23.794999999999998 95-99 20.34 28.000000000000004 28.244999999999997 23.415 100-104 19.79 28.7 27.6 23.91 105-109 20.165 28.205000000000002 27.845 23.785 110-114 20.4 28.265 28.000000000000004 23.335 115-119 20.445 28.720000000000002 27.29 23.544999999999998 120-124 20.395 28.449999999999996 26.87 24.285 125-129 20.630000000000003 27.639999999999997 27.43 24.3 130-134 20.76 27.689999999999998 27.389999999999997 24.16 135-139 21.3 28.294999999999998 27.175 23.23 140-144 20.62 28.325 27.089999999999996 23.965 145-149 21.165 28.23 26.919999999999998 23.685000000000002 150-151 21.1375 27.0625 27.375 24.425 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 0.5 23 1.0 24 2.5 25 3.5 26 6.5 27 6.5 28 8.0 29 13.0 30 19.0 31 24.5 32 39.0 33 57.0 34 64.0 35 91.0 36 114.5 37 126.0 38 147.0 39 182.5 40 203.0 41 221.5 42 233.0 43 237.5 44 266.0 45 265.0 46 252.5 47 242.0 48 212.5 49 180.5 50 173.0 51 139.5 52 106.0 53 97.0 54 72.0 55 57.0 56 40.5 57 25.0 58 19.0 59 16.5 60 10.5 61 7.0 62 8.0 63 3.5 64 1.0 65 1.0 66 0.0 67 0.5 68 1.0 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.725 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49723479135244 98.95 2 0.47762694821518353 0.95 3 0.0 0.0 4 0.025138260432378077 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0875 0.0 0.0 0.0 0.0 88-89 0.175 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3 0.0 0.0 0.0 0.0 94-95 0.4125 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7375 0.0 0.0 0.0 0.0 100-101 0.8375 0.0 0.0 0.0 0.0 102-103 0.975 0.0 0.0 0.0 0.0 104-105 1.15 0.0 0.0 0.0 0.0 106-107 1.2875 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7000000000000002 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.2 0.0 0.0 0.0 0.0 116-117 2.5 0.0 0.0 0.0 0.0 118-119 2.75 0.0 0.0 0.0 0.0 120-121 2.9625 0.0 0.0 0.0 0.0 122-123 3.1500000000000004 0.0 0.0 0.0 0.0 124-125 3.25 0.0 0.0 0.0 0.0 126-127 3.5 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.449999999999999 0.0 0.0 0.0 0.0 134-135 4.85 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.3875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTGCT 10 0.0060887975 150.61038 1 GGGGACA 10 0.006836113 144.9625 2 >>END_MODULE SRR7170467 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170467_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.04675 33.0 33.0 34.0 32.0 34.0 2 33.08675 34.0 33.0 34.0 32.0 34.0 3 33.105 34.0 33.0 34.0 33.0 34.0 4 33.05775 34.0 33.0 34.0 32.0 34.0 5 33.05425 34.0 33.0 34.0 33.0 34.0 6 37.36275 38.0 38.0 38.0 37.0 38.0 7 37.36925 38.0 38.0 38.0 37.0 38.0 8 37.3695 38.0 38.0 38.0 37.0 38.0 9 37.23575 38.0 38.0 38.0 37.0 38.0 10-14 37.16725 38.0 38.0 38.0 36.8 38.0 15-19 37.12045 38.0 38.0 38.0 36.6 38.0 20-24 37.1134 38.0 38.0 38.0 36.6 38.0 25-29 37.09165 38.0 38.0 38.0 36.6 38.0 30-34 37.206900000000005 38.0 38.0 38.0 37.0 38.0 35-39 37.181349999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.09845 38.0 38.0 38.0 36.6 38.0 45-49 37.01265 38.0 38.0 38.0 36.0 38.0 50-54 36.76825 38.0 38.0 38.0 35.4 38.0 55-59 36.95585 38.0 38.0 38.0 35.8 38.0 60-64 36.31655 38.0 37.4 38.0 33.0 38.0 65-69 36.8314 38.0 38.0 38.0 35.6 38.0 70-74 36.62050000000001 38.0 38.0 38.0 34.6 38.0 75-79 36.64295 38.0 38.0 38.0 34.6 38.0 80-84 36.06125 38.0 37.2 38.0 30.4 38.0 85-89 35.09415 38.0 35.4 38.0 27.2 38.0 90-94 36.4585 38.0 37.8 38.0 34.0 38.0 95-99 36.3478 38.0 38.0 38.0 33.8 38.0 100-104 36.002700000000004 38.0 37.4 38.0 30.2 38.0 105-109 35.6225 38.0 36.6 38.0 30.4 38.0 110-114 35.71715 38.0 36.6 38.0 31.4 38.0 115-119 35.7871 38.0 37.0 38.0 32.2 38.0 120-124 35.535399999999996 38.0 36.6 38.0 30.6 38.0 125-129 35.17015 38.0 36.0 38.0 29.8 38.0 130-134 34.433899999999994 38.0 34.0 38.0 25.8 38.0 135-139 34.516299999999994 38.0 34.2 38.0 27.2 38.0 140-144 33.5081 38.0 33.0 38.0 20.6 38.0 145-149 32.5405 38.0 33.0 38.0 11.8 38.0 150-151 27.269624999999998 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 0.0 5 0.0 6 4.0 7 0.0 8 0.0 9 2.0 10 0.0 11 0.0 12 2.0 13 2.0 14 1.0 15 3.0 16 0.0 17 2.0 18 0.0 19 4.0 20 11.0 21 4.0 22 9.0 23 11.0 24 7.0 25 15.0 26 19.0 27 18.0 28 36.0 29 39.0 30 53.0 31 66.0 32 83.0 33 161.0 34 192.0 35 338.0 36 846.0 37 2065.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.175 20.549999999999997 17.1 28.175 2 25.575 26.900000000000002 30.275000000000002 17.25 3 21.15 27.875 30.4 20.575 4 23.599999999999998 33.425 24.325 18.65 5 24.45 34.1 24.224999999999998 17.224999999999998 6 19.525000000000002 36.825 25.124999999999996 18.525 7 18.8 20.474999999999998 41.075 19.650000000000002 8 20.925 24.75 29.95 24.375 9 23.1 23.95 29.125 23.825 10-14 23.56 28.955 26.284999999999997 21.2 15-19 23.305 27.965 27.49 21.240000000000002 20-24 23.115 27.894999999999996 28.084999999999997 20.905 25-29 23.575 27.87 27.500000000000004 21.055 30-34 23.189999999999998 28.470000000000002 27.61 20.73 35-39 22.89614480724036 27.92139606980349 27.906395319765988 21.27606380319016 40-44 23.485 28.005000000000003 27.83 20.68 45-49 23.465 28.384999999999998 27.43 20.72 50-54 22.765 28.18 27.965 21.09 55-59 23.125 27.950000000000003 27.889999999999997 21.035 60-64 23.45 27.735 27.93 20.885 65-69 23.32 28.02 27.515 21.145 70-74 23.115 27.955000000000002 27.445000000000004 21.485000000000003 75-79 23.717371737173718 27.77777777777778 27.652765276527653 20.85208520852085 80-84 23.602360236023603 27.742774277427745 27.722772277227726 20.932093209320932 85-89 23.705000000000002 27.91 27.675 20.71 90-94 23.945 27.794999999999998 27.215 21.044999999999998 95-99 23.395 27.92 27.994999999999997 20.69 100-104 24.371218560928046 28.056402820141006 27.35136756837842 20.22101105055253 105-109 24.095 28.175 27.555000000000003 20.175 110-114 24.14 28.095 26.905 20.86 115-119 23.77237723772377 28.487848784878487 27.59275927592759 20.147014701470148 120-124 24.861243062153108 27.726386319315964 27.191359567978402 20.22101105055253 125-129 24.179835967193437 27.91058211642328 27.800560112022403 20.10902180436087 130-134 24.697469746974697 27.9027902790279 27.93779377937794 19.46194619461946 135-139 24.40622031101555 28.05140257012851 27.731386569328464 19.810990549527478 140-144 24.33 28.105000000000004 27.279999999999998 20.285 145-149 24.25621281064053 28.096404820241013 27.796389819490976 19.85099254962748 150-151 24.953119139892486 26.915864483060382 27.728466058257283 20.40255031878985 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.0 20 0.0 21 0.5 22 0.5 23 0.0 24 3.0 25 3.5 26 2.0 27 3.5 28 4.0 29 8.0 30 14.5 31 17.0 32 21.5 33 32.0 34 48.5 35 62.0 36 74.0 37 90.5 38 128.5 39 169.0 40 204.0 41 233.0 42 249.0 43 256.0 44 274.0 45 286.5 46 280.0 47 259.0 48 245.5 49 219.0 50 171.5 51 139.0 52 110.0 53 91.0 54 77.0 55 67.5 56 47.5 57 31.5 58 23.5 59 14.0 60 10.0 61 10.5 62 7.0 63 3.5 64 2.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.005 105-109 0.0 110-114 0.0 115-119 0.01 120-124 0.005 125-129 0.02 130-134 0.01 135-139 0.005 140-144 0.0 145-149 0.005 150-151 0.0125 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.21815889029004 98.35000000000001 2 0.6809583858764187 1.35 3 0.1008827238335435 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.037500000000000006 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.05 0.0 0.0 0.0 0.0 86-87 0.0625 0.0 0.0 0.0 0.0 88-89 0.15 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.275 0.0 0.0 0.0 0.0 94-95 0.38749999999999996 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6625000000000001 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8999999999999999 0.0 0.0 0.0 0.0 104-105 1.075 0.0 0.0 0.0 0.0 106-107 1.2125 0.0 0.0 0.0 0.0 108-109 1.4249999999999998 0.0 0.0 0.0 0.0 110-111 1.625 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 2.0999999999999996 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.8375 0.0 0.0 0.0 0.0 122-123 3.0250000000000004 0.0 0.0 0.0 0.0 124-125 3.125 0.0 0.0 0.0 0.0 126-127 3.3625 0.0 0.0 0.0 0.0 128-129 3.6500000000000004 0.0 0.0 0.0 0.0 130-131 3.9 0.0 0.0 0.0 0.0 132-133 4.275 0.0 0.0 0.0 0.0 134-135 4.625 0.0 0.0 0.0 0.0 136-137 4.8375 0.0 0.0 0.0 0.0 138-139 5.175 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CGCCGCC 10 0.006830828 145.0 8 >>END_MODULE Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra Read 774390 spots for SRR7170467.sra Written 774390 spots for SRR7170467.sra Read 774386 spots for SRR7170467.sra Written 774386 spots for SRR7170467.sra SRR ids: ['SRR7170467.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_hnmraqqt SRR7170467.sra spots: 15487724 blocks: [[1, 774386], [774387, 1548772], [1548773, 2323158], [2323159, 3097544], [3097545, 3871930], [3871931, 4646316], [4646317, 5420702], [5420703, 6195088], [6195089, 6969474], [6969475, 7743860], [7743861, 8518246], [8518247, 9292632], [9292633, 10067018], [10067019, 10841404], [10841405, 11615790], [11615791, 12390176], [12390177, 13164562], [13164563, 13938948], [13938949, 14713334], [14713335, 15487724]] SRR7170467 file size 5226581 SRR7170467 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170467 SRR7170467_1.fastq SRR7170467_2.fastq Input file: SRR7170467_1.fastq Paired file: SRR7170467_2.fastq trimmed: SRR7170467-trimmed-pair1.fastq, SRR7170467-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:09:52 2025 >> started Wed Feb 12 22:10:09 2025 >> done (17.698s) 15487724 read pairs processed; of these: 11961 ( 0.08%) short read pairs filtered out after trimming by size control 13481 ( 0.09%) empty read pairs filtered out after trimming by size control 15462282 (99.84%) read pairs available; of these: 8415204 (54.42%) trimmed read pairs available after processing 7047078 (45.58%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 2 0.00% 21 2 0.00% 22 0 0.00% 23 1 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 8 0.00% 28 4 0.00% 29 2 0.00% 30 4 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 12 0.00% 35 10 0.00% 36 13 0.00% 37 13 0.00% 38 16 0.00% 39 17 0.00% 40 21 0.00% 41 37 0.00% 42 28 0.00% 43 39 0.00% 44 50 0.00% 45 35 0.00% 46 47 0.00% 47 44 0.00% 48 56 0.00% 49 81 0.00% 50 102 0.00% 51 123 0.00% 52 135 0.00% 53 128 0.00% 54 137 0.00% 55 152 0.00% 56 172 0.00% 57 217 0.00% 58 232 0.00% 59 252 0.00% 60 317 0.00% 61 375 0.00% 62 431 0.00% 63 481 0.00% 64 540 0.00% 65 547 0.00% 66 594 0.00% 67 692 0.00% 68 711 0.00% 69 825 0.01% 70 995 0.01% 71 1106 0.01% 72 1239 0.01% 73 1386 0.01% 74 1576 0.01% 75 1794 0.01% 76 1979 0.01% 77 2226 0.01% 78 2220 0.01% 79 2588 0.02% 80 2692 0.02% 81 3158 0.02% 82 3490 0.02% 83 3990 0.03% 84 4849 0.03% 85 5328 0.03% 86 5774 0.04% 87 6206 0.04% 88 6513 0.04% 89 6672 0.04% 90 7157 0.05% 91 7712 0.05% 92 8212 0.05% 93 9134 0.06% 94 9447 0.06% 95 10399 0.07% 96 10577 0.07% 97 10943 0.07% 98 11432 0.07% 99 11652 0.08% 100 12267 0.08% 101 12910 0.08% 102 13387 0.09% 103 14301 0.09% 104 15276 0.10% 105 15821 0.10% 106 16422 0.11% 107 17284 0.11% 108 16888 0.11% 109 17744 0.11% 110 18108 0.12% 111 18727 0.12% 112 19570 0.13% 113 20413 0.13% 114 20571 0.13% 115 22187 0.14% 116 22495 0.15% 117 23132 0.15% 118 23401 0.15% 119 24122 0.16% 120 24540 0.16% 121 25233 0.16% 122 26264 0.17% 123 27020 0.17% 124 28552 0.18% 125 29723 0.19% 126 31377 0.20% 127 32552 0.21% 128 33543 0.22% 129 34703 0.22% 130 36556 0.24% 131 38602 0.25% 132 40143 0.26% 133 43204 0.28% 134 46161 0.30% 135 49583 0.32% 136 54317 0.35% 137 58218 0.38% 138 64291 0.42% 139 70894 0.46% 140 78580 0.51% 141 90127 0.58% 142 104389 0.68% 143 123007 0.80% 144 149333 0.97% 145 196367 1.27% 146 241070 1.56% 147 344975 2.23% 148 529259 3.42% 149 1028651 6.65% 150 4198763 27.15% 151 7047078 45.58% 15462282 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.69 fanout-score-rank=10 prefix-density=0.61 prefix-fanout=2.4 sequence=CTGATGCACTGCACTTGACG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=96.16 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.46 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=25 prefix-density=0.46 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=37.42 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=6.7 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170467 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:10:55 Started mapping on | Feb 12 22:10:55 Finished on | Feb 12 22:13:05 Mapping speed, Million of reads per hour | 428.19 Number of input reads | 15462282 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14275027 Uniquely mapped reads % | 92.32% Average mapped length | 293.87 Number of splices: Total | 13720381 Number of splices: Annotated (sjdb) | 13425644 Number of splices: GT/AG | 13468106 Number of splices: GC/AG | 206633 Number of splices: AT/AC | 8582 Number of splices: Non-canonical | 37060 Mismatch rate per base, % | 0.44% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 403547 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 37385 % of reads mapped to too many loci | 0.24% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.74% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 794987 794987 794987 N_multimapping 403547 403547 403547 N_noFeature 401300 14028839 464774 N_ambiguous 299041 1116 115868 UnstrandedReadsAssigned:13574686 PositiveStrandReadsAssigned:245072 NegativeStrandReadsAssigned:13694385 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170467 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170467-trimmed-pair1.fastq SRR7170467-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,462,282 reads, 13,601,698 reads pseudoaligned [quant] estimated average fragment length: 270.596 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,259 rounds 52401 SRR7170467.ke.tsv 34699 SRR7170467.se.tsv 87100 total ==> SRR7170467.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.4 745 27.1959 Potri.005G024800.1.v4.1 1035 765.404 511 42.6107 Potri.004G059700.1.v4.1 961 691.425 17 1.56925 Potri.007G009000.2.v4.1 1416 1146.4 0 0 Potri.003G141000.2.v4.1 2943 2673.4 705 16.8311 Potri.016G087400.1.v4.1 270 75.5347 1162 981.857 Potri.015G069301.1.v4.1 564 299.112 0 0 Potri.010G195200.1.v4.1 1773 1503.4 485 20.5899 Potri.012G127500.1.v4.1 977 707.404 107 9.65395 ==> SRR7170467.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 513 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 201 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 209 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170467 completed mapping pipeline successfully