Starting /dee2/code/volunteer_pipeline.sh SRR7170468 current disk space = 3050711986176 free memory = 1036145572 SRR7170468 SRAfilesize 2f789f6b352583bc287121e7547c283c SRR7170468.sra SRR7170468.sra file validated SRR7170468 is paired end SRR7170468 is conventional basespace SRR7170468 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170468_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.371 25.0 18.0 33.0 18.0 33.0 2 26.37875 27.0 25.0 31.0 18.0 33.0 3 29.39325 31.0 28.0 33.0 25.0 33.0 4 31.30875 33.0 31.0 33.0 29.0 33.0 5 32.44325 33.0 33.0 33.0 32.0 33.0 6 36.60275 38.0 37.0 38.0 34.0 38.0 7 37.192 38.0 38.0 38.0 36.0 38.0 8 37.49775 38.0 38.0 38.0 37.0 38.0 9 37.62525 38.0 38.0 38.0 37.0 38.0 10-14 37.6179 38.0 38.0 38.0 38.0 38.0 15-19 37.61715 38.0 38.0 38.0 38.0 38.0 20-24 37.67 38.0 38.0 38.0 38.0 38.0 25-29 37.5822 38.0 38.0 38.0 38.0 38.0 30-34 37.57945000000001 38.0 38.0 38.0 38.0 38.0 35-39 37.55995 38.0 38.0 38.0 38.0 38.0 40-44 37.484249999999996 38.0 38.0 38.0 37.6 38.0 45-49 37.4935 38.0 38.0 38.0 37.6 38.0 50-54 37.389599999999994 38.0 38.0 38.0 37.0 38.0 55-59 37.2965 38.0 38.0 38.0 36.8 38.0 60-64 37.2231 38.0 38.0 38.0 36.2 38.0 65-69 37.19155 38.0 38.0 38.0 36.0 38.0 70-74 37.11865 38.0 38.0 38.0 36.0 38.0 75-79 36.771550000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.604049999999994 38.0 38.0 38.0 35.2 38.0 85-89 36.53445000000001 38.0 38.0 38.0 35.0 38.0 90-94 36.418549999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.31395 38.0 38.0 38.0 34.0 38.0 100-104 36.080850000000005 38.0 37.4 38.0 33.6 38.0 105-109 35.88185 38.0 37.0 38.0 33.2 38.0 110-114 35.734 38.0 37.0 38.0 32.6 38.0 115-119 35.521150000000006 38.0 36.6 38.0 31.0 38.0 120-124 35.27185 38.0 36.0 38.0 29.8 38.0 125-129 34.9396 38.0 36.0 38.0 28.0 38.0 130-134 34.562149999999995 38.0 34.6 38.0 27.4 38.0 135-139 34.18725 38.0 33.6 38.0 25.2 38.0 140-144 33.4713 38.0 33.0 38.0 22.4 38.0 145-149 32.31645 38.0 33.0 38.0 14.0 38.0 150-151 26.426625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 1.0 15 2.0 16 2.0 17 4.0 18 7.0 19 38.0 20 2.0 21 3.0 22 5.0 23 6.0 24 5.0 25 11.0 26 17.0 27 14.0 28 18.0 29 29.0 30 38.0 31 53.0 32 78.0 33 110.0 34 153.0 35 372.0 36 1149.0 37 1882.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.9639175257732 10.283505154639174 13.814432989690722 37.93814432989691 2 24.825 14.399999999999999 32.025 28.749999999999996 3 20.275000000000002 19.275000000000002 24.625 35.825 4 22.675 26.575 21.224999999999998 29.525000000000002 5 22.425 30.825000000000003 24.425 22.325 6 20.325 34.35 26.05 19.275000000000002 7 14.649999999999999 27.1 41.225 17.025000000000002 8 17.474999999999998 27.725 29.75 25.05 9 16.150000000000002 25.45 33.475 24.925 10-14 18.88 31.6 26.479999999999997 23.04 15-19 19.51597579878994 29.401470073503678 27.051352567628385 24.031201560078003 20-24 19.02 30.06 27.189999999999998 23.73 25-29 19.139999999999997 29.5 27.534999999999997 23.825 30-34 19.006900690069006 29.57795779577958 27.18771877187719 24.227422742274225 35-39 19.471947194719473 29.01290129012901 27.462746274627463 24.052405240524052 40-44 19.509999999999998 29.24 27.295 23.955000000000002 45-49 19.41 29.115000000000002 27.534999999999997 23.94 50-54 19.845 28.96 27.045 24.15 55-59 19.2 28.665000000000003 27.975 24.16 60-64 19.49 28.560000000000002 27.384999999999998 24.565 65-69 20.145 29.145 26.905 23.805 70-74 19.095000000000002 29.854999999999997 26.825 24.224999999999998 75-79 19.529882470617654 29.62740685171293 27.14678669667417 23.695923980995246 80-84 19.68295244286643 28.774316147422113 27.529129369405407 24.013602040306044 85-89 19.905 28.95 26.590000000000003 24.555 90-94 19.955000000000002 28.315 27.465 24.265 95-99 20.02 28.215 27.125 24.64 100-104 19.85 28.499999999999996 27.01 24.64 105-109 20.885 27.905 27.01 24.2 110-114 20.1 28.525 27.46 23.915 115-119 20.51 28.595 26.365 24.529999999999998 120-124 20.169999999999998 28.685 26.740000000000002 24.404999999999998 125-129 20.380000000000003 28.185 27.21 24.224999999999998 130-134 19.905 28.125 26.919999999999998 25.05 135-139 20.515 27.500000000000004 27.310000000000002 24.675 140-144 20.23 27.905 27.339999999999996 24.525 145-149 20.565 28.115000000000002 26.790000000000003 24.529999999999998 150-151 19.787499999999998 27.675 27.55 24.9875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.5 20 1.5 21 1.0 22 0.5 23 1.5 24 3.0 25 2.5 26 5.0 27 11.5 28 20.5 29 22.5 30 21.0 31 27.0 32 39.5 33 54.5 34 63.0 35 83.0 36 107.5 37 119.0 38 146.0 39 178.0 40 197.0 41 209.0 42 223.0 43 232.0 44 227.5 45 236.0 46 223.0 47 210.5 48 219.5 49 198.5 50 163.5 51 137.5 52 120.0 53 107.5 54 91.0 55 77.0 56 65.5 57 49.5 58 31.5 59 23.0 60 18.0 61 9.0 62 7.0 63 5.0 64 2.0 65 0.5 66 1.5 67 1.0 68 0.0 69 0.0 70 0.5 71 0.5 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.025 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.075 #Duplication Level Percentage of deduplicated Percentage of total 1 98.48055627092455 95.6 2 1.2104043265516353 2.35 3 0.1545197012619109 0.44999999999999996 4 0.07725985063095545 0.3 5 0.02575328354365182 0.125 6 0.02575328354365182 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.02575328354365182 1.0250000000000001 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACATTACTCGATCTCGTAT 41 1.0250000000000001 TruSeq Adapter, Index 27 (97% over 39bp) GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 6 0.15 No Hit CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4500000000000002 0.0 0.0 0.0 0.0 96-97 1.6375 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.0374999999999996 0.0 0.0 0.0 0.0 108-109 3.375 0.0 0.0 0.0 0.0 110-111 3.7875 0.0 0.0 0.0 0.0 112-113 4.1 0.0 0.0 0.0 0.0 114-115 4.3125 0.0 0.0 0.0 0.0 116-117 4.637499999999999 0.0 0.0 0.0 0.0 118-119 4.875 0.0 0.0 0.0 0.0 120-121 5.15 0.0 0.0 0.0 0.0 122-123 5.6125 0.0 0.0 0.0 0.0 124-125 5.925 0.0 0.0 0.0 0.0 126-127 6.237500000000001 0.0 0.0 0.0 0.0 128-129 6.675 0.0 0.0 0.0 0.0 130-131 6.949999999999999 0.0 0.0 0.0 0.0 132-133 7.3125 0.0 0.0 0.0 0.0 134-135 7.6875 0.0 0.0 0.0 0.0 136-137 7.975 0.0 0.0 0.0 0.0 138-139 8.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 95 5.164755E-4 12.209475 65-69 >>END_MODULE SRR7170468 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170468_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.755 33.0 33.0 34.0 32.0 34.0 2 32.95975 33.0 33.0 34.0 32.0 34.0 3 32.9625 34.0 33.0 34.0 32.0 34.0 4 32.83725 34.0 33.0 34.0 32.0 34.0 5 32.938 34.0 33.0 34.0 32.0 34.0 6 37.13625 38.0 38.0 38.0 37.0 38.0 7 37.142 38.0 38.0 38.0 37.0 38.0 8 37.18975 38.0 38.0 38.0 37.0 38.0 9 37.16075 38.0 38.0 38.0 37.0 38.0 10-14 37.1274 38.0 38.0 38.0 37.0 38.0 15-19 37.110749999999996 38.0 38.0 38.0 37.0 38.0 20-24 37.0907 38.0 38.0 38.0 37.0 38.0 25-29 37.0537 38.0 38.0 38.0 37.0 38.0 30-34 36.987249999999996 38.0 38.0 38.0 36.8 38.0 35-39 37.00305 38.0 38.0 38.0 37.0 38.0 40-44 36.92635 38.0 38.0 38.0 36.6 38.0 45-49 36.904700000000005 38.0 38.0 38.0 36.4 38.0 50-54 36.912150000000004 38.0 38.0 38.0 36.2 38.0 55-59 36.736000000000004 38.0 38.0 38.0 35.8 38.0 60-64 36.59805 38.0 38.0 38.0 35.8 38.0 65-69 36.640550000000005 38.0 38.0 38.0 35.8 38.0 70-74 36.6497 38.0 38.0 38.0 35.6 38.0 75-79 36.5722 38.0 38.0 38.0 35.0 38.0 80-84 36.352500000000006 38.0 38.0 38.0 34.8 38.0 85-89 36.1717 38.0 38.0 38.0 34.2 38.0 90-94 35.9889 38.0 38.0 38.0 33.8 38.0 95-99 35.932750000000006 38.0 38.0 38.0 33.8 38.0 100-104 35.730399999999996 38.0 37.8 38.0 33.0 38.0 105-109 35.70355 38.0 37.4 38.0 32.8 38.0 110-114 35.44345 38.0 36.8 38.0 31.0 38.0 115-119 35.3095 38.0 37.0 38.0 31.0 38.0 120-124 34.91565000000001 38.0 36.4 38.0 29.0 38.0 125-129 34.5075 38.0 35.6 38.0 27.4 38.0 130-134 33.8738 38.0 33.8 38.0 23.0 38.0 135-139 33.000350000000005 38.0 33.0 38.0 16.6 38.0 140-144 32.26035 38.0 33.0 38.0 12.8 38.0 145-149 31.1064 38.0 31.4 38.0 5.8 38.0 150-151 25.112499999999997 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 14.0 3 4.0 4 4.0 5 1.0 6 2.0 7 1.0 8 4.0 9 1.0 10 1.0 11 3.0 12 4.0 13 2.0 14 5.0 15 3.0 16 4.0 17 4.0 18 19.0 19 20.0 20 5.0 21 17.0 22 9.0 23 13.0 24 13.0 25 15.0 26 20.0 27 21.0 28 35.0 29 34.0 30 55.0 31 46.0 32 79.0 33 103.0 34 153.0 35 270.0 36 768.0 37 2248.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 30.522892169126848 20.365273955466602 19.764823617713283 29.347010257693267 2 27.845884413309985 26.069552164123095 27.845884413309985 18.23867900925694 3 22.692019014260694 28.29622216662497 29.997498123592692 19.014260695521642 4 23.961980990495245 31.94097048524262 22.786393196598297 21.310655327663834 5 25.94445834375782 34.375781836377286 22.366775081310983 17.312984738553915 6 22.325 37.4 22.3 17.974999999999998 7 19.375 22.225 38.375 20.025000000000002 8 24.3 26.450000000000003 26.25 23.0 9 23.45 25.15 29.425 21.975 10-14 24.415 29.125 25.41 21.05 15-19 23.806190309515475 27.736386819340968 27.1963598179909 21.261063053152657 20-24 24.891222805701425 27.431857964491122 27.236809202300577 20.44011002750688 25-29 24.969981989193517 28.47208324994997 26.3708224934961 20.187112267360416 30-34 24.12309231923943 28.29622216662497 27.185389041781338 20.395296472354264 35-39 23.57650355248674 27.959571700190132 27.25407785449815 21.209846892824977 40-44 25.070042025215127 26.806083650190114 27.436461877126277 20.687412447468482 45-49 24.353523733306655 27.77472115240334 27.18951633071575 20.68223878357425 50-54 23.92957182873149 28.321328531412565 26.820728291316527 20.928371348539414 55-59 24.462338701610484 27.553265979793938 27.123136941082326 20.861258377513252 60-64 23.77688844422211 27.023511755877937 27.34367183591796 21.85592796398199 65-69 24.126888822175523 27.64935454818373 27.16901831281897 21.054738316821776 70-74 24.163122341756317 28.61646234676007 26.53490117588191 20.6855141356017 75-79 24.359487590072057 27.9273418734988 27.096677341873498 20.616493194555645 80-84 23.777833375031275 28.501376032024016 26.54490868151113 21.175881911433574 85-89 24.469575660528424 27.702161729383505 26.53622898318655 21.29203362690152 90-94 24.95371528646485 28.13109832374281 26.38478859144358 20.530397798348762 95-99 24.763572679509632 28.07605704278209 26.604953715286467 20.555416562421815 100-104 25.047533273291307 28.004603222255582 26.803762633843693 20.144100870609428 105-109 24.532172520764536 28.074652256579608 26.918843190233165 20.474332032422694 110-114 24.838628971728795 27.5806855141356 27.455591693770327 20.125093820365276 115-119 25.038779084313234 28.091068301225917 26.670002501876404 20.20015011258444 120-124 24.92493995196157 28.412730184147318 26.72137710168134 19.94095276220977 125-129 25.08008008008008 27.98798798798799 26.72172172172172 20.21021021021021 130-134 25.715859030837002 27.563075690829 26.917300760913093 19.803764517420905 135-139 25.894599869876384 27.68630198688754 27.260897852960316 19.15820029027576 140-144 26.227538915861654 27.15851644226438 26.723059212172785 19.890885429701186 145-149 25.351548816494017 28.434169043687135 26.387429314917682 19.826852824901167 150-151 25.83187390542907 28.183637728296222 26.419814861145856 19.564673505128845 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 1.5 20 2.5 21 1.0 22 0.5 23 0.5 24 0.5 25 1.0 26 2.5 27 3.0 28 3.0 29 5.5 30 5.0 31 10.0 32 16.5 33 21.5 34 29.5 35 51.0 36 71.0 37 91.0 38 105.5 39 123.0 40 173.0 41 215.5 42 254.5 43 269.5 44 259.5 45 269.5 46 285.0 47 269.5 48 233.5 49 214.0 50 191.5 51 167.5 52 133.5 53 102.0 54 99.5 55 90.5 56 70.0 57 49.5 58 31.5 59 21.5 60 16.0 61 10.5 62 8.0 63 5.0 64 2.0 65 1.0 66 1.0 67 1.5 68 1.5 69 0.5 70 0.0 71 0.0 72 1.0 73 1.0 74 0.0 75 0.0 76 0.0 77 0.5 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.05 5 0.075 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.025 25-29 0.06 30-34 0.075 35-39 0.06999999999999999 40-44 0.06 45-49 0.034999999999999996 50-54 0.04 55-59 0.03 60-64 0.05 65-69 0.06999999999999999 70-74 0.075 75-79 0.08 80-84 0.075 85-89 0.08 90-94 0.075 95-99 0.075 100-104 0.06999999999999999 105-109 0.06999999999999999 110-114 0.075 115-119 0.075 120-124 0.08 125-129 0.1 130-134 0.12 135-139 0.095 140-144 0.105 145-149 0.08499999999999999 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 97.1 #Duplication Level Percentage of deduplicated Percentage of total 1 98.78990731204944 95.92500000000001 2 0.8238928939237898 1.6 3 0.18022657054582905 0.525 4 0.07723995880535531 0.3 5 0.0 0.0 6 0.051493305870236865 0.3 7 0.051493305870236865 0.35000000000000003 8 0.0 0.0 9 0.0 0.0 >10 0.025746652935118432 1.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 40 1.0 Illumina Single End PCR Primer 1 (96% over 32bp) CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 7 0.17500000000000002 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.037500000000000006 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.0875 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.375 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.625 0.0 0.0 0.0 0.0 86-87 0.7875 0.0 0.0 0.0 0.0 88-89 0.9125000000000001 0.0 0.0 0.0 0.0 90-91 1.1 0.0 0.0 0.0 0.0 92-93 1.2875 0.0 0.0 0.0 0.0 94-95 1.4500000000000002 0.0 0.0 0.0 0.0 96-97 1.6375 0.0 0.0 0.0 0.0 98-99 1.8625 0.0 0.0 0.0 0.0 100-101 2.0625 0.0 0.0 0.0 0.0 102-103 2.2875 0.0 0.0 0.0 0.0 104-105 2.6875 0.0 0.0 0.0 0.0 106-107 3.0374999999999996 0.0 0.0 0.0 0.0 108-109 3.425 0.0 0.0 0.0 0.0 110-111 3.8375 0.0 0.0 0.0 0.0 112-113 4.15 0.0 0.0 0.0 0.0 114-115 4.375 0.0 0.0 0.0 0.0 116-117 4.725 0.0 0.0 0.0 0.0 118-119 4.975 0.0 0.0 0.0 0.0 120-121 5.25 0.0 0.0 0.0 0.0 122-123 5.7125 0.0 0.0 0.0 0.0 124-125 6.025 0.0 0.0 0.0 0.0 126-127 6.3375 0.0 0.0 0.0 0.0 128-129 6.775 0.0 0.0 0.0 0.0 130-131 7.050000000000001 0.0 0.0 0.0 0.0 132-133 7.4375 0.0 0.0 0.0 0.0 134-135 7.8125 0.0 0.0 0.0 0.0 136-137 8.1625 0.0 0.0 0.0 0.0 138-139 8.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAACGCT 10 0.006830828 145.0 9 ACTTCGG 10 0.006830828 145.0 7 CAGATTG 10 0.006830828 145.0 3 CTTCGGA 10 0.006830828 145.0 8 TTGAACG 10 0.006830828 145.0 7 TGAACGC 10 0.006830828 145.0 8 AGATTGA 10 0.006830828 145.0 4 TTCGGAT 10 0.006830828 145.0 9 AAAAAAA 85 5.955226E-7 17.058823 70-74 >>END_MODULE Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518971 spots for SRR7170468.sra Written 518971 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra Read 518955 spots for SRR7170468.sra Written 518955 spots for SRR7170468.sra SRR ids: ['SRR7170468.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qisia0vz SRR7170468.sra spots: 10379116 blocks: [[1, 518955], [518956, 1037910], [1037911, 1556865], [1556866, 2075820], [2075821, 2594775], [2594776, 3113730], [3113731, 3632685], [3632686, 4151640], [4151641, 4670595], [4670596, 5189550], [5189551, 5708505], [5708506, 6227460], [6227461, 6746415], [6746416, 7265370], [7265371, 7784325], [7784326, 8303280], [8303281, 8822235], [8822236, 9341190], [9341191, 9860145], [9860146, 10379116]] SRR7170468 file size 3495441 SRR7170468 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170468 SRR7170468_1.fastq SRR7170468_2.fastq Input file: SRR7170468_1.fastq Paired file: SRR7170468_2.fastq trimmed: SRR7170468-trimmed-pair1.fastq, SRR7170468-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:30:34 2025 >> started Wed Feb 12 21:30:47 2025 >> done (13.077s) 10379116 read pairs processed; of these: 15878 ( 0.15%) short read pairs filtered out after trimming by size control 135211 ( 1.30%) empty read pairs filtered out after trimming by size control 10228027 (98.54%) read pairs available; of these: 6695300 (65.46%) trimmed read pairs available after processing 3532727 (34.54%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 8 0.00% 19 18 0.00% 20 14 0.00% 21 11 0.00% 22 5 0.00% 23 14 0.00% 24 11 0.00% 25 9 0.00% 26 14 0.00% 27 24 0.00% 28 14 0.00% 29 16 0.00% 30 21 0.00% 31 26 0.00% 32 21 0.00% 33 35 0.00% 34 35 0.00% 35 36 0.00% 36 48 0.00% 37 43 0.00% 38 57 0.00% 39 59 0.00% 40 75 0.00% 41 67 0.00% 42 83 0.00% 43 107 0.00% 44 106 0.00% 45 111 0.00% 46 137 0.00% 47 178 0.00% 48 162 0.00% 49 217 0.00% 50 253 0.00% 51 303 0.00% 52 361 0.00% 53 374 0.00% 54 371 0.00% 55 424 0.00% 56 426 0.00% 57 468 0.00% 58 521 0.01% 59 648 0.01% 60 707 0.01% 61 804 0.01% 62 929 0.01% 63 980 0.01% 64 1088 0.01% 65 1100 0.01% 66 1278 0.01% 67 1436 0.01% 68 1586 0.02% 69 1700 0.02% 70 1956 0.02% 71 2207 0.02% 72 2562 0.03% 73 2805 0.03% 74 3281 0.03% 75 3689 0.04% 76 4679 0.05% 77 5906 0.06% 78 5402 0.05% 79 4887 0.05% 80 5092 0.05% 81 5496 0.05% 82 6257 0.06% 83 6678 0.07% 84 7998 0.08% 85 8206 0.08% 86 8469 0.08% 87 9030 0.09% 88 9063 0.09% 89 9358 0.09% 90 9650 0.09% 91 10136 0.10% 92 10509 0.10% 93 11163 0.11% 94 12113 0.12% 95 12647 0.12% 96 12780 0.12% 97 13208 0.13% 98 13057 0.13% 99 13134 0.13% 100 13611 0.13% 101 13797 0.13% 102 14456 0.14% 103 14991 0.15% 104 15565 0.15% 105 16368 0.16% 106 16576 0.16% 107 16783 0.16% 108 16811 0.16% 109 17390 0.17% 110 17757 0.17% 111 17577 0.17% 112 18017 0.18% 113 18754 0.18% 114 19109 0.19% 115 20292 0.20% 116 20776 0.20% 117 21123 0.21% 118 21491 0.21% 119 21489 0.21% 120 21687 0.21% 121 22785 0.22% 122 23277 0.23% 123 24515 0.24% 124 25765 0.25% 125 26630 0.26% 126 27817 0.27% 127 29031 0.28% 128 30123 0.29% 129 31653 0.31% 130 33070 0.32% 131 35060 0.34% 132 37330 0.36% 133 39866 0.39% 134 42399 0.41% 135 45727 0.45% 136 49253 0.48% 137 53492 0.52% 138 58873 0.58% 139 64133 0.63% 140 71674 0.70% 141 82253 0.80% 142 93392 0.91% 143 108232 1.06% 144 132090 1.29% 145 164168 1.61% 146 217182 2.12% 147 310466 3.04% 148 474501 4.64% 149 896202 8.76% 150 2820964 27.58% 151 3532727 34.54% 10228027 reads passed initial QC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=30 prefix-density=0.72 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=36 fanout-score=53.97 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.5 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=29 prefix-density=0.64 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=22.28 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.6 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCC SRR7170468 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:31:37 Started mapping on | Feb 12 21:31:37 Finished on | Feb 12 21:33:10 Mapping speed, Million of reads per hour | 395.92 Number of input reads | 10228027 Average input read length | 290 UNIQUE READS: Uniquely mapped reads number | 9412930 Uniquely mapped reads % | 92.03% Average mapped length | 290.52 Number of splices: Total | 8604795 Number of splices: Annotated (sjdb) | 8419104 Number of splices: GT/AG | 8444217 Number of splices: GC/AG | 129666 Number of splices: AT/AC | 6656 Number of splices: Non-canonical | 24256 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 249795 % of reads mapped to multiple loci | 2.44% Number of reads mapped to too many loci | 16839 % of reads mapped to too many loci | 0.16% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.25% % of reads unmapped: other | 0.11% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 573730 573730 573730 N_multimapping 249795 249795 249795 N_noFeature 206314 9147451 259560 N_ambiguous 289551 663 77066 UnstrandedReadsAssigned:8917065 PositiveStrandReadsAssigned:264816 NegativeStrandReadsAssigned:9076304 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170468 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170468-trimmed-pair1.fastq SRR7170468-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 10,228,027 reads, 9,009,271 reads pseudoaligned [quant] estimated average fragment length: 255.215 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,251 rounds 52401 SRR7170468.ke.tsv 34699 SRR7170468.se.tsv 87100 total ==> SRR7170468.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1763.79 340 14.5529 Potri.005G024800.1.v4.1 1035 780.785 159 15.3739 Potri.004G059700.1.v4.1 961 706.795 13 1.38857 Potri.007G009000.2.v4.1 1416 1161.79 0 0 Potri.003G141000.2.v4.1 2943 2688.79 295 8.28292 Potri.016G087400.1.v4.1 270 80.8309 588 549.184 Potri.015G069301.1.v4.1 564 313.021 0 0 Potri.010G195200.1.v4.1 1773 1518.79 42 2.08771 Potri.012G127500.1.v4.1 977 722.785 84 8.7738 ==> SRR7170468.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 616 Potri.001G233950.v4.1 2 Potri.001G122700.v4.1 323 Potri.001G212900.v4.1 14 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 0 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170468 completed mapping pipeline successfully