Starting /dee2/code/volunteer_pipeline.sh SRR7170469 current disk space = 3050522136576 free memory = 1507918600 SRR7170469 SRAfilesize db6accfccbbfd9c435967c5e8eb0864e SRR7170469.sra SRR7170469.sra file validated SRR7170469 is paired end SRR7170469 is conventional basespace SRR7170469 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170469_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.296 25.0 18.0 33.0 18.0 33.0 2 25.77975 27.0 18.0 31.0 18.0 33.0 3 28.8065 30.0 27.0 33.0 18.0 33.0 4 31.28225 33.0 31.0 33.0 29.0 33.0 5 32.02025 33.0 31.0 33.0 30.0 33.0 6 36.23225 38.0 36.0 38.0 33.0 38.0 7 36.47825 38.0 37.0 38.0 34.0 38.0 8 37.0585 38.0 38.0 38.0 35.0 38.0 9 37.352 38.0 38.0 38.0 37.0 38.0 10-14 37.41725 38.0 38.0 38.0 36.8 38.0 15-19 37.491150000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.540299999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.422000000000004 38.0 38.0 38.0 37.2 38.0 30-34 37.515750000000004 38.0 38.0 38.0 38.0 38.0 35-39 37.505250000000004 38.0 38.0 38.0 37.8 38.0 40-44 36.9232 38.0 37.6 38.0 33.0 38.0 45-49 36.51965 38.0 37.6 38.0 33.0 38.0 50-54 37.1778 38.0 38.0 38.0 36.4 38.0 55-59 37.1976 38.0 38.0 38.0 36.6 38.0 60-64 37.18345 38.0 38.0 38.0 36.2 38.0 65-69 37.09165 38.0 38.0 38.0 36.0 38.0 70-74 36.924800000000005 38.0 38.0 38.0 35.8 38.0 75-79 36.88505 38.0 38.0 38.0 35.6 38.0 80-84 36.86305 38.0 38.0 38.0 35.2 38.0 85-89 36.5776 38.0 37.8 38.0 34.2 38.0 90-94 36.3688 38.0 38.0 38.0 34.0 38.0 95-99 36.4111 38.0 38.0 38.0 34.0 38.0 100-104 36.369350000000004 38.0 37.4 38.0 33.8 38.0 105-109 36.3069 38.0 37.0 38.0 34.0 38.0 110-114 36.024899999999995 38.0 37.0 38.0 33.0 38.0 115-119 35.583800000000004 38.0 36.2 38.0 30.6 38.0 120-124 35.55385 38.0 36.0 38.0 30.2 38.0 125-129 35.4106 38.0 36.0 38.0 30.4 38.0 130-134 35.052800000000005 38.0 35.4 38.0 28.6 38.0 135-139 34.699200000000005 38.0 34.8 38.0 27.6 38.0 140-144 33.7917 38.0 33.4 38.0 22.8 38.0 145-149 33.144549999999995 38.0 33.0 38.0 19.6 38.0 150-151 27.512375 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 2.0 12 0.0 13 2.0 14 2.0 15 0.0 16 1.0 17 0.0 18 5.0 19 2.0 20 2.0 21 4.0 22 8.0 23 2.0 24 4.0 25 6.0 26 11.0 27 22.0 28 31.0 29 42.0 30 50.0 31 57.0 32 72.0 33 133.0 34 192.0 35 415.0 36 1109.0 37 1825.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.102695763799744 11.322207958921695 8.600770218228499 39.974326059050064 2 19.979994998749685 14.053513378344586 34.60865216304076 31.357839459864966 3 18.625 21.85 28.825 30.7 4 22.45 30.15 22.650000000000002 24.75 5 22.15 32.725 24.5 20.625 6 17.65 36.9 26.775 18.675 7 13.900000000000002 24.575 44.1 17.424999999999997 8 17.549999999999997 26.174999999999997 31.75 24.525 9 17.125 22.875 35.199999999999996 24.8 10-14 19.46 30.275000000000002 27.62 22.645 15-19 18.955 29.715000000000003 28.015 23.315 20-24 19.295 29.79 27.905 23.01 25-29 19.35 29.12 28.15 23.380000000000003 30-34 19.345000000000002 29.054999999999996 28.29 23.31 35-39 19.85 29.615000000000002 27.61 22.925 40-44 19.450972548627433 29.51147557377869 28.41142057102855 22.626131306565327 45-49 19.655 28.99 27.650000000000002 23.705000000000002 50-54 19.335 29.34 28.165000000000003 23.16 55-59 19.62 29.294999999999998 28.000000000000004 23.085 60-64 20.22 29.759999999999998 27.32 22.7 65-69 19.645000000000003 29.425 27.77 23.16 70-74 20.16 29.075 27.955000000000002 22.81 75-79 19.665 28.475 28.515 23.345 80-84 20.369999999999997 28.985 27.66 22.985 85-89 19.695 28.49 28.215 23.599999999999998 90-94 20.18 28.685 28.199999999999996 22.935 95-99 20.28 28.765 27.805000000000003 23.150000000000002 100-104 20.44 29.18 27.93 22.45 105-109 19.865 28.225 28.255000000000003 23.655 110-114 20.785 28.12 28.060000000000002 23.035 115-119 20.32 28.660000000000004 27.83 23.189999999999998 120-124 20.064999999999998 28.815 27.284999999999997 23.835 125-129 20.585 28.645 27.105 23.665 130-134 20.14 28.57 27.689999999999998 23.599999999999998 135-139 20.849999999999998 28.83 26.61 23.71 140-144 19.939999999999998 28.945 27.725 23.39 145-149 20.285 27.925 28.115000000000002 23.674999999999997 150-151 20.1 27.750000000000004 28.749999999999996 23.400000000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 2.0 23 5.0 24 8.0 25 6.0 26 5.0 27 9.0 28 14.0 29 18.5 30 26.5 31 35.5 32 46.0 33 55.0 34 68.0 35 88.5 36 105.5 37 132.5 38 156.5 39 188.5 40 210.0 41 226.0 42 247.5 43 255.0 44 274.5 45 275.0 46 253.5 47 226.5 48 196.0 49 175.5 50 157.5 51 132.0 52 105.5 53 78.0 54 54.0 55 49.0 56 37.0 57 20.0 58 17.5 59 13.0 60 7.5 61 4.5 62 5.0 63 3.5 64 0.5 65 1.0 66 0.5 67 0.5 68 0.5 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.55000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59819186338524 99.15 2 0.3515821195379206 0.7000000000000001 3 0.05022601707684581 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.0625 0.0 0.0 0.0 0.0 64-65 0.075 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.125 0.0 0.0 0.0 0.0 72-73 0.15 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.25 0.0 0.0 0.0 0.0 78-79 0.2875 0.0 0.0 0.0 0.0 80-81 0.3375 0.0 0.0 0.0 0.0 82-83 0.4375 0.0 0.0 0.0 0.0 84-85 0.525 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.6 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.7749999999999999 0.0 0.0 0.0 0.0 94-95 0.95 0.0 0.0 0.0 0.0 96-97 1.075 0.0 0.0 0.0 0.0 98-99 1.25 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9 0.0 0.0 0.0 0.0 108-109 2.0375 0.0 0.0 0.0 0.0 110-111 2.2249999999999996 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.75 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.2249999999999996 0.0 0.0 0.0 0.0 120-121 3.3125 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.75 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.375 0.0 0.0 0.0 0.0 130-131 4.612500000000001 0.0 0.0 0.0 0.0 132-133 4.8125 0.0 0.0 0.0 0.0 134-135 5.0 0.0 0.0 0.0 0.0 136-137 5.362500000000001 0.0 0.0 0.0 0.0 138-139 5.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTATTCA 10 0.0068343505 144.975 4 CAATTCC 10 0.0068343505 144.975 4 >>END_MODULE SRR7170469 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170469_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.606 33.0 33.0 34.0 32.0 34.0 2 32.97525 33.0 33.0 34.0 32.0 34.0 3 31.1425 33.0 32.0 34.0 18.0 34.0 4 32.412 33.0 33.0 34.0 28.0 34.0 5 32.862 33.0 33.0 34.0 32.0 34.0 6 37.24425 38.0 38.0 38.0 37.0 38.0 7 37.01225 38.0 38.0 38.0 37.0 38.0 8 37.23 38.0 38.0 38.0 37.0 38.0 9 37.2815 38.0 38.0 38.0 37.0 38.0 10-14 37.29655 38.0 38.0 38.0 37.0 38.0 15-19 37.26865 38.0 38.0 38.0 37.0 38.0 20-24 37.06155 38.0 38.0 38.0 36.6 38.0 25-29 36.99185 38.0 38.0 38.0 36.4 38.0 30-34 37.1258 38.0 38.0 38.0 36.8 38.0 35-39 37.21595 38.0 38.0 38.0 37.0 38.0 40-44 36.536500000000004 38.0 37.8 38.0 33.6 38.0 45-49 37.1412 38.0 38.0 38.0 36.6 38.0 50-54 37.1492 38.0 38.0 38.0 36.8 38.0 55-59 36.11735 38.0 37.2 38.0 30.6 38.0 60-64 36.3983 38.0 37.6 38.0 33.4 38.0 65-69 36.2913 38.0 37.4 38.0 31.8 38.0 70-74 35.88680000000001 38.0 37.0 38.0 30.4 38.0 75-79 36.657799999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.826800000000006 38.0 38.0 38.0 35.6 38.0 85-89 36.658100000000005 38.0 38.0 38.0 34.8 38.0 90-94 36.678250000000006 38.0 38.0 38.0 35.0 38.0 95-99 36.5778 38.0 38.0 38.0 34.4 38.0 100-104 36.39639999999999 38.0 38.0 38.0 34.0 38.0 105-109 36.12105 38.0 37.8 38.0 33.6 38.0 110-114 36.05675 38.0 37.2 38.0 33.2 38.0 115-119 35.778200000000005 38.0 37.0 38.0 32.2 38.0 120-124 35.51350000000001 38.0 36.6 38.0 31.0 38.0 125-129 34.8981 38.0 36.0 38.0 28.2 38.0 130-134 34.792500000000004 38.0 35.6 38.0 28.6 38.0 135-139 34.252449999999996 38.0 33.6 38.0 25.2 38.0 140-144 33.470349999999996 38.0 33.0 38.0 21.4 38.0 145-149 32.681000000000004 38.0 33.0 38.0 13.6 38.0 150-151 26.6265 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 0.0 4 2.0 5 0.0 6 0.0 7 0.0 8 3.0 9 1.0 10 2.0 11 1.0 12 2.0 13 2.0 14 3.0 15 3.0 16 3.0 17 3.0 18 5.0 19 4.0 20 7.0 21 8.0 22 6.0 23 7.0 24 16.0 25 12.0 26 20.0 27 23.0 28 32.0 29 27.0 30 39.0 31 68.0 32 87.0 33 139.0 34 183.0 35 318.0 36 825.0 37 2145.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.35 21.4 13.325000000000001 24.925 2 26.25 27.375 29.925 16.45 3 20.45 28.675 33.0 17.875 4 23.375 35.6 22.125 18.9 5 23.275000000000002 37.15 21.4 18.175 6 20.349999999999998 38.025 23.625 18.0 7 18.775 21.099999999999998 39.75 20.375 8 21.525 26.05 27.700000000000003 24.725 9 21.375 25.25 29.425 23.95 10-14 23.16 29.044999999999998 27.18 20.615 15-19 22.86 28.470000000000002 27.85 20.82 20-24 22.705000000000002 28.73 28.225 20.34 25-29 23.015 28.194999999999997 28.105000000000004 20.685000000000002 30-34 23.244999999999997 28.285 27.97 20.5 35-39 23.150000000000002 28.38 28.199999999999996 20.27 40-44 22.975 28.435 28.015 20.575 45-49 23.275000000000002 27.725 28.605000000000004 20.395 50-54 23.655 27.71 28.095 20.54 55-59 22.695 28.51 27.965 20.830000000000002 60-64 23.015 28.475 27.915 20.595 65-69 23.830000000000002 27.944999999999997 27.38 20.845 70-74 23.044999999999998 28.084999999999997 28.035 20.835 75-79 24.04 27.66 27.61 20.69 80-84 23.044999999999998 28.33 27.595 21.029999999999998 85-89 23.77 27.815 27.57 20.845 90-94 23.455000000000002 28.38 27.884999999999998 20.28 95-99 23.98 28.415000000000003 27.87 19.735 100-104 23.64 28.335 27.38 20.645 105-109 23.705000000000002 27.560000000000002 28.349999999999998 20.385 110-114 23.39 28.08 28.175 20.355 115-119 23.794999999999998 28.215 27.845 20.145 120-124 23.825 28.055000000000003 28.075 20.044999999999998 125-129 24.11 28.804999999999996 27.785 19.3 130-134 24.07 27.825 28.18 19.925 135-139 24.305 27.839999999999996 28.335 19.52 140-144 24.41 27.205000000000002 28.565 19.82 145-149 24.75 27.82 27.650000000000002 19.78 150-151 24.962500000000002 28.1875 27.775 19.075 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 0.5 18 0.5 19 0.5 20 1.0 21 0.5 22 0.5 23 1.5 24 2.5 25 3.5 26 6.0 27 6.5 28 5.0 29 8.0 30 10.5 31 11.5 32 24.5 33 38.0 34 48.0 35 63.0 36 85.0 37 112.5 38 135.0 39 166.5 40 211.5 41 251.0 42 272.5 43 281.5 44 281.5 45 278.5 46 282.5 47 269.0 48 226.0 49 199.5 50 169.5 51 128.0 52 97.0 53 74.5 54 67.0 55 51.5 56 34.0 57 24.5 58 21.0 59 15.5 60 9.0 61 8.0 62 6.0 63 2.5 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49634852681945 98.775 2 0.35255603122639134 0.7000000000000001 3 0.1007302946361118 0.3 4 0.02518257365902795 0.1 5 0.02518257365902795 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.025 0.0 0.0 0.0 0.0 2 0.025 0.0 0.0 0.0 0.0 3 0.025 0.0 0.0 0.0 0.0 4 0.025 0.0 0.0 0.0 0.0 5 0.025 0.0 0.0 0.0 0.0 6 0.025 0.0 0.0 0.0 0.0 7 0.025 0.0 0.0 0.0 0.0 8 0.025 0.0 0.0 0.0 0.0 9 0.025 0.0 0.0 0.0 0.0 10-11 0.025 0.0 0.0 0.0 0.0 12-13 0.025 0.0 0.0 0.0 0.0 14-15 0.025 0.0 0.0 0.0 0.0 16-17 0.025 0.0 0.0 0.0 0.0 18-19 0.025 0.0 0.0 0.0 0.0 20-21 0.025 0.0 0.0 0.0 0.0 22-23 0.025 0.0 0.0 0.0 0.0 24-25 0.025 0.0 0.0 0.0 0.0 26-27 0.025 0.0 0.0 0.0 0.0 28-29 0.025 0.0 0.0 0.0 0.0 30-31 0.025 0.0 0.0 0.0 0.0 32-33 0.025 0.0 0.0 0.0 0.0 34-35 0.025 0.0 0.0 0.0 0.0 36-37 0.025 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.037500000000000006 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.125 0.0 0.0 0.0 0.0 74-75 0.175 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.2625 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.4125 0.0 0.0 0.0 0.0 84-85 0.5 0.0 0.0 0.0 0.0 86-87 0.5375000000000001 0.0 0.0 0.0 0.0 88-89 0.575 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.7375 0.0 0.0 0.0 0.0 94-95 0.9 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.2000000000000002 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.4875 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 1.9874999999999998 0.0 0.0 0.0 0.0 110-111 2.175 0.0 0.0 0.0 0.0 112-113 2.4625 0.0 0.0 0.0 0.0 114-115 2.6625 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.1500000000000004 0.0 0.0 0.0 0.0 120-121 3.2375 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.275 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.675 0.0 0.0 0.0 0.0 134-135 4.875 0.0 0.0 0.0 0.0 136-137 5.237500000000001 0.0 0.0 0.0 0.0 138-139 5.4875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTCCCCT 10 0.006830828 145.0 1 GAATCAA 10 0.006830828 145.0 145 >>END_MODULE Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra Read 634830 spots for SRR7170469.sra Written 634830 spots for SRR7170469.sra Read 634827 spots for SRR7170469.sra Written 634827 spots for SRR7170469.sra SRR ids: ['SRR7170469.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_l3joj3zm SRR7170469.sra spots: 12696543 blocks: [[1, 634827], [634828, 1269654], [1269655, 1904481], [1904482, 2539308], [2539309, 3174135], [3174136, 3808962], [3808963, 4443789], [4443790, 5078616], [5078617, 5713443], [5713444, 6348270], [6348271, 6983097], [6983098, 7617924], [7617925, 8252751], [8252752, 8887578], [8887579, 9522405], [9522406, 10157232], [10157233, 10792059], [10792060, 11426886], [11426887, 12061713], [12061714, 12696543]] SRR7170469 file size 4280741 SRR7170469 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170469 SRR7170469_1.fastq SRR7170469_2.fastq Input file: SRR7170469_1.fastq Paired file: SRR7170469_2.fastq trimmed: SRR7170469-trimmed-pair1.fastq, SRR7170469-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:57:35 2025 >> started Wed Feb 12 21:57:50 2025 >> done (14.794s) 12696543 read pairs processed; of these: 13607 ( 0.11%) short read pairs filtered out after trimming by size control 20565 ( 0.16%) empty read pairs filtered out after trimming by size control 12662371 (99.73%) read pairs available; of these: 6765655 (53.43%) trimmed read pairs available after processing 5896716 (46.57%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 7 0.00% 21 5 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 3 0.00% 26 7 0.00% 27 4 0.00% 28 7 0.00% 29 7 0.00% 30 5 0.00% 31 13 0.00% 32 7 0.00% 33 12 0.00% 34 5 0.00% 35 8 0.00% 36 17 0.00% 37 18 0.00% 38 12 0.00% 39 17 0.00% 40 35 0.00% 41 33 0.00% 42 41 0.00% 43 39 0.00% 44 33 0.00% 45 41 0.00% 46 57 0.00% 47 57 0.00% 48 68 0.00% 49 109 0.00% 50 98 0.00% 51 125 0.00% 52 130 0.00% 53 141 0.00% 54 141 0.00% 55 171 0.00% 56 170 0.00% 57 226 0.00% 58 237 0.00% 59 337 0.00% 60 344 0.00% 61 439 0.00% 62 508 0.00% 63 495 0.00% 64 554 0.00% 65 641 0.01% 66 683 0.01% 67 800 0.01% 68 905 0.01% 69 1012 0.01% 70 1205 0.01% 71 1330 0.01% 72 1528 0.01% 73 1772 0.01% 74 1896 0.01% 75 2026 0.02% 76 2337 0.02% 77 2461 0.02% 78 2648 0.02% 79 2855 0.02% 80 3238 0.03% 81 3596 0.03% 82 4009 0.03% 83 4543 0.04% 84 5475 0.04% 85 6011 0.05% 86 6420 0.05% 87 6660 0.05% 88 6978 0.06% 89 7203 0.06% 90 7704 0.06% 91 8151 0.06% 92 8611 0.07% 93 9257 0.07% 94 9915 0.08% 95 10283 0.08% 96 10722 0.08% 97 11036 0.09% 98 11277 0.09% 99 11562 0.09% 100 11799 0.09% 101 12455 0.10% 102 13399 0.11% 103 13662 0.11% 104 14496 0.11% 105 14840 0.12% 106 15298 0.12% 107 15548 0.12% 108 15689 0.12% 109 16038 0.13% 110 16224 0.13% 111 16908 0.13% 112 17576 0.14% 113 17996 0.14% 114 18840 0.15% 115 19291 0.15% 116 19952 0.16% 117 20479 0.16% 118 20603 0.16% 119 20919 0.17% 120 21561 0.17% 121 22117 0.17% 122 22789 0.18% 123 23998 0.19% 124 24769 0.20% 125 25449 0.20% 126 26720 0.21% 127 27380 0.22% 128 28117 0.22% 129 28960 0.23% 130 30484 0.24% 131 31957 0.25% 132 33289 0.26% 133 35459 0.28% 134 37928 0.30% 135 40494 0.32% 136 43623 0.34% 137 47346 0.37% 138 50662 0.40% 139 56071 0.44% 140 61975 0.49% 141 69974 0.55% 142 80340 0.63% 143 94947 0.75% 144 114168 0.90% 145 143128 1.13% 146 184657 1.46% 147 257340 2.03% 148 402130 3.18% 149 800586 6.32% 150 3383671 26.72% 151 5896716 46.57% 12662371 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=34 prefix-density=0.65 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=35 fanout-score=97.48 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.7 sequence=AAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAACGAAGCAACCCTAACAGATAGCTAGGGACTCATCAAATCTTGGAACCTAGACACCCTTCGGCTTGGAGGCGATAAAACTGATGCACTGCACTTGACGAGTGTTGTCGAATCCAATGATACGGATAAA criterion=sequence-density sequence-density=0.91 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=25 prefix-density=0.91 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=24.51 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=4.8 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAA SRR7170469 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:58:36 Started mapping on | Feb 12 21:58:36 Finished on | Feb 12 22:00:08 Mapping speed, Million of reads per hour | 495.48 Number of input reads | 12662371 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11852398 Uniquely mapped reads % | 93.60% Average mapped length | 293.25 Number of splices: Total | 11202027 Number of splices: Annotated (sjdb) | 10931123 Number of splices: GT/AG | 10995288 Number of splices: GC/AG | 160722 Number of splices: AT/AC | 7153 Number of splices: Non-canonical | 38864 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.10 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 414712 % of reads mapped to multiple loci | 3.28% Number of reads mapped to too many loci | 16537 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.96% % of reads unmapped: other | 0.03% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 406407 406407 406407 N_multimapping 414712 414712 414712 N_noFeature 381789 11648699 443350 N_ambiguous 248542 1080 105920 UnstrandedReadsAssigned:11222067 PositiveStrandReadsAssigned:202619 NegativeStrandReadsAssigned:11303128 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170469 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170469-trimmed-pair1.fastq SRR7170469-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,662,371 reads, 11,217,993 reads pseudoaligned [quant] estimated average fragment length: 272.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,052 rounds 52401 SRR7170469.ke.tsv 34699 SRR7170469.se.tsv 87100 total ==> SRR7170469.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1746.87 1265 56.8939 Potri.005G024800.1.v4.1 1035 763.87 508 52.2492 Potri.004G059700.1.v4.1 961 689.887 0 0 Potri.007G009000.2.v4.1 1416 1144.87 0 0 Potri.003G141000.2.v4.1 2943 2671.87 521.058 15.3217 Potri.016G087400.1.v4.1 270 78.1796 1136.78 1142.4 Potri.015G069301.1.v4.1 564 298.578 0 0 Potri.010G195200.1.v4.1 1773 1501.87 1300.99 68.0575 Potri.012G127500.1.v4.1 977 705.876 80 8.90425 ==> SRR7170469.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 230 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 236 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170469 completed mapping pipeline successfully