Starting /dee2/code/volunteer_pipeline.sh SRR7170470 current disk space = 3050548482048 free memory = 1522219572 SRR7170470 SRAfilesize 6099d211e26e4f82902056fd089bf61a SRR7170470.sra SRR7170470.sra file validated SRR7170470 is paired end SRR7170470 is conventional basespace SRR7170470 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170470_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.2705 28.0 18.0 33.0 18.0 33.0 2 29.81775 31.0 28.0 33.0 25.0 33.0 3 31.39625 33.0 31.0 33.0 28.0 33.0 4 31.381 33.0 31.0 33.0 29.0 33.0 5 32.29475 33.0 33.0 33.0 31.0 34.0 6 36.65975 38.0 37.0 38.0 34.0 38.0 7 37.18575 38.0 38.0 38.0 36.0 38.0 8 37.51 38.0 38.0 38.0 37.0 38.0 9 37.472 38.0 38.0 38.0 37.0 38.0 10-14 37.4984 38.0 38.0 38.0 37.0 38.0 15-19 37.553599999999996 38.0 38.0 38.0 37.6 38.0 20-24 37.53055 38.0 38.0 38.0 37.4 38.0 25-29 37.436 38.0 38.0 38.0 37.0 38.0 30-34 37.48455 38.0 38.0 38.0 37.0 38.0 35-39 37.44425 38.0 38.0 38.0 37.0 38.0 40-44 36.64005 38.0 37.0 38.0 32.8 38.0 45-49 36.0592 38.0 36.6 38.0 29.0 38.0 50-54 37.115449999999996 38.0 38.0 38.0 35.8 38.0 55-59 37.16185 38.0 38.0 38.0 36.0 38.0 60-64 37.08295 38.0 38.0 38.0 36.0 38.0 65-69 37.01285 38.0 38.0 38.0 36.0 38.0 70-74 36.844350000000006 38.0 38.0 38.0 35.0 38.0 75-79 36.80655 38.0 38.0 38.0 34.8 38.0 80-84 36.7792 38.0 38.0 38.0 35.0 38.0 85-89 36.416000000000004 38.0 37.8 38.0 33.8 38.0 90-94 36.1042 38.0 37.0 38.0 32.8 38.0 95-99 36.2453 38.0 37.0 38.0 33.4 38.0 100-104 36.15845 38.0 37.0 38.0 33.4 38.0 105-109 36.1175 38.0 37.0 38.0 33.2 38.0 110-114 35.835249999999995 38.0 36.8 38.0 31.8 38.0 115-119 35.28065 38.0 36.0 38.0 28.6 38.0 120-124 35.378699999999995 38.0 36.0 38.0 30.4 38.0 125-129 35.10955 38.0 35.4 38.0 28.6 38.0 130-134 34.74345 38.0 34.8 38.0 26.8 38.0 135-139 34.33 38.0 34.2 38.0 25.6 38.0 140-144 33.439350000000005 38.0 33.4 38.0 21.4 38.0 145-149 32.6756 38.0 33.0 38.0 16.4 38.0 150-151 27.339624999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 0.0 14 1.0 15 3.0 16 1.0 17 3.0 18 3.0 19 1.0 20 2.0 21 2.0 22 2.0 23 4.0 24 6.0 25 9.0 26 10.0 27 28.0 28 32.0 29 31.0 30 57.0 31 62.0 32 101.0 33 146.0 34 232.0 35 466.0 36 1130.0 37 1666.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.5 9.932572614107883 9.699170124481329 42.86825726141078 2 21.36602451838879 14.36077057793345 33.950462847135356 30.322742056542406 3 20.275000000000002 18.425 26.674999999999997 34.625 4 24.375 25.900000000000002 21.575 28.15 5 22.275 32.475 24.125 21.125 6 18.525 35.8 25.025 20.65 7 13.950000000000001 25.174999999999997 42.525 18.35 8 17.775 26.0 30.4 25.825 9 15.825 25.874999999999996 34.9 23.400000000000002 10-14 19.085 29.735 27.99 23.189999999999998 15-19 19.66 28.275 28.22 23.845 20-24 19.56 28.965000000000003 27.855 23.62 25-29 20.09 27.87 28.494999999999997 23.544999999999998 30-34 19.225 29.37 27.615000000000002 23.79 35-39 19.2 28.83 28.244999999999997 23.724999999999998 40-44 20.18302745411812 28.29924488673301 27.48412261839276 24.033605040756115 45-49 20.205000000000002 29.15 27.275 23.369999999999997 50-54 19.78 28.345 28.194999999999997 23.68 55-59 19.955000000000002 28.34 27.884999999999998 23.82 60-64 19.945 27.99 27.939999999999998 24.125 65-69 20.26 28.060000000000002 27.800000000000004 23.880000000000003 70-74 20.095 28.854999999999997 27.465 23.585 75-79 20.395 28.365000000000002 27.68 23.56 80-84 19.900000000000002 28.025 27.725 24.349999999999998 85-89 20.330000000000002 28.54 27.36 23.77 90-94 20.427042704270427 28.372837283728376 28.002800280028 23.1973197319732 95-99 20.395 27.955000000000002 28.065 23.585 100-104 20.03 28.849999999999998 26.855 24.265 105-109 20.375 27.529999999999998 28.095 24.0 110-114 20.43 27.88 27.689999999999998 24.0 115-119 20.18 27.865000000000002 27.939999999999998 24.015 120-124 20.165 27.860000000000003 27.800000000000004 24.175 125-129 20.482048204820483 28.512851285128516 27.19271927192719 23.812381238123812 130-134 20.635 28.15 27.325 23.89 135-139 20.84 27.650000000000002 27.605 23.905 140-144 20.985 28.23 26.784999999999997 24.0 145-149 20.935000000000002 27.67 27.544999999999998 23.849999999999998 150-151 20.9875 27.474999999999998 27.6 23.9375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 1.5 26 2.0 27 5.0 28 7.5 29 12.5 30 20.5 31 28.5 32 35.0 33 44.0 34 65.0 35 85.5 36 102.5 37 123.5 38 144.0 39 165.5 40 186.5 41 222.0 42 241.0 43 228.0 44 229.0 45 252.0 46 249.0 47 234.0 48 230.0 49 220.5 50 186.5 51 141.0 52 122.0 53 101.0 54 79.0 55 65.0 56 45.5 57 32.0 58 24.5 59 19.5 60 16.0 61 10.0 62 5.5 63 4.0 64 4.0 65 2.5 66 1.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.015 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.01 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5227329816629 99.05000000000001 2 0.4772670183371013 0.95 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5 0.0 0.0 0.0 0.0 110-111 1.7 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 1.9500000000000002 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.2375 0.0 0.0 0.0 0.0 120-121 2.4375 0.0 0.0 0.0 0.0 122-123 2.6125 0.0 0.0 0.0 0.0 124-125 2.825 0.0 0.0 0.0 0.0 126-127 3.1625 0.0 0.0 0.0 0.0 128-129 3.3875 0.0 0.0 0.0 0.0 130-131 3.6 0.0 0.0 0.0 0.0 132-133 3.9625 0.0 0.0 0.0 0.0 134-135 4.25 0.0 0.0 0.0 0.0 136-137 4.699999999999999 0.0 0.0 0.0 0.0 138-139 5.074999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAAGTTA 10 0.006836113 144.9625 2 AAGTTAA 10 0.006836113 144.9625 3 >>END_MODULE SRR7170470 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170470_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.268 33.0 32.0 34.0 30.0 34.0 2 32.707 33.0 33.0 34.0 32.0 34.0 3 30.05025 33.0 28.0 34.0 18.0 34.0 4 31.856 33.0 32.0 34.0 27.0 34.0 5 32.59925 33.0 33.0 34.0 32.0 34.0 6 37.04575 38.0 38.0 38.0 36.0 38.0 7 36.695 38.0 38.0 38.0 35.0 38.0 8 36.97775 38.0 38.0 38.0 36.0 38.0 9 37.08125 38.0 38.0 38.0 36.0 38.0 10-14 37.0995 38.0 38.0 38.0 36.4 38.0 15-19 37.0594 38.0 38.0 38.0 36.6 38.0 20-24 36.84435 38.0 38.0 38.0 35.8 38.0 25-29 36.66609999999999 38.0 38.0 38.0 34.8 38.0 30-34 36.8612 38.0 38.0 38.0 35.8 38.0 35-39 36.928250000000006 38.0 38.0 38.0 36.0 38.0 40-44 36.048049999999996 38.0 37.0 38.0 30.2 38.0 45-49 36.88435 38.0 38.0 38.0 35.8 38.0 50-54 36.903200000000005 38.0 38.0 38.0 36.0 38.0 55-59 35.53555000000001 38.0 35.6 38.0 29.4 38.0 60-64 36.31825 38.0 37.6 38.0 33.2 38.0 65-69 36.07805 38.0 37.6 38.0 32.2 38.0 70-74 35.7004 38.0 36.6 38.0 30.2 38.0 75-79 36.44255 38.0 38.0 38.0 33.8 38.0 80-84 36.522450000000006 38.0 38.0 38.0 34.4 38.0 85-89 36.3888 38.0 38.0 38.0 34.0 38.0 90-94 36.4664 38.0 38.0 38.0 34.0 38.0 95-99 36.22625000000001 38.0 37.6 38.0 33.8 38.0 100-104 36.00505 38.0 37.2 38.0 32.8 38.0 105-109 35.64065 38.0 37.0 38.0 30.6 38.0 110-114 35.62495 38.0 36.8 38.0 31.4 38.0 115-119 35.1786 38.0 36.2 38.0 29.0 38.0 120-124 34.95175 38.0 35.6 38.0 28.0 38.0 125-129 34.31325 38.0 34.2 38.0 24.4 38.0 130-134 34.14195 38.0 33.6 38.0 24.2 38.0 135-139 33.3996 38.0 33.0 38.0 20.8 38.0 140-144 32.5006 38.0 32.8 38.0 14.6 38.0 145-149 31.5831 38.0 32.2 38.0 8.4 38.0 150-151 25.68375 32.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 3.0 4 1.0 5 0.0 6 1.0 7 0.0 8 0.0 9 0.0 10 2.0 11 1.0 12 2.0 13 3.0 14 2.0 15 3.0 16 3.0 17 6.0 18 9.0 19 7.0 20 2.0 21 12.0 22 13.0 23 10.0 24 18.0 25 27.0 26 25.0 27 30.0 28 45.0 29 55.0 30 67.0 31 79.0 32 92.0 33 150.0 34 209.0 35 380.0 36 957.0 37 1782.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.699999999999996 21.525 14.825 28.95 2 25.424999999999997 25.575 31.624999999999996 17.375 3 21.65 26.775 31.974999999999998 19.6 4 23.125 33.550000000000004 24.625 18.7 5 24.425 35.449999999999996 22.7 17.424999999999997 6 20.375 38.375 24.825 16.425 7 20.8 21.275 37.35 20.575 8 22.25 24.9 26.900000000000002 25.95 9 21.6 25.15 29.925 23.325000000000003 10-14 23.715 28.65 26.245 21.39 15-19 22.925 28.705000000000002 27.32 21.05 20-24 23.080000000000002 28.33 27.584999999999997 21.005 25-29 23.015 28.910000000000004 27.47 20.605 30-34 23.325000000000003 28.49 27.57 20.615 35-39 23.155 28.144999999999996 27.889999999999997 20.810000000000002 40-44 23.13 27.810000000000002 28.194999999999997 20.865000000000002 45-49 23.565 28.050000000000004 27.98 20.405 50-54 23.73 27.894999999999996 27.779999999999998 20.595 55-59 23.32 28.01 27.860000000000003 20.810000000000002 60-64 23.105 27.575 27.744999999999997 21.575 65-69 23.785 27.605 27.485 21.125 70-74 23.705000000000002 27.87 27.644999999999996 20.78 75-79 23.315 27.894999999999996 27.705000000000002 21.085 80-84 23.474999999999998 27.77 27.075 21.68 85-89 23.79 28.51 27.025 20.674999999999997 90-94 23.595 27.905 27.639999999999997 20.86 95-99 23.45 28.105000000000004 27.284999999999997 21.16 100-104 23.845 27.939999999999998 27.33 20.885 105-109 23.29 28.27 27.575 20.865000000000002 110-114 23.794999999999998 27.77 28.21 20.225 115-119 23.77 27.955000000000002 27.725 20.549999999999997 120-124 24.365000000000002 28.125 27.310000000000002 20.200000000000003 125-129 24.16 28.265 27.169999999999998 20.405 130-134 24.13 28.000000000000004 27.35 20.52 135-139 24.625 27.725 27.375 20.275000000000002 140-144 24.88 27.685 27.075 20.36 145-149 25.405 27.74 27.055 19.8 150-151 25.0625 27.987499999999997 26.875 20.075000000000003 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.5 10 0.5 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 0.0 21 0.5 22 1.5 23 1.5 24 0.5 25 2.0 26 7.0 27 7.5 28 7.5 29 11.5 30 14.5 31 13.5 32 20.5 33 34.0 34 50.0 35 66.0 36 81.0 37 101.0 38 121.0 39 155.5 40 188.0 41 205.5 42 246.5 43 290.5 44 290.0 45 270.5 46 258.0 47 259.0 48 247.0 49 199.5 50 153.0 51 139.5 52 124.5 53 96.0 54 81.5 55 69.5 56 49.5 57 38.0 58 34.0 59 25.0 60 14.5 61 8.5 62 6.5 63 2.5 64 2.0 65 1.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34541792547836 98.65 2 0.6042296072507553 1.2 3 0.050352467270896276 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.375 0.0 0.0 0.0 0.0 94-95 0.3875 0.0 0.0 0.0 0.0 96-97 0.5125 0.0 0.0 0.0 0.0 98-99 0.6125 0.0 0.0 0.0 0.0 100-101 0.75 0.0 0.0 0.0 0.0 102-103 0.8625 0.0 0.0 0.0 0.0 104-105 1.1 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.5125000000000002 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.0 0.0 0.0 0.0 0.0 116-117 2.1125 0.0 0.0 0.0 0.0 118-119 2.2875 0.0 0.0 0.0 0.0 120-121 2.5 0.0 0.0 0.0 0.0 122-123 2.6875 0.0 0.0 0.0 0.0 124-125 2.875 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.4125 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 4.0125 0.0 0.0 0.0 0.0 134-135 4.3 0.0 0.0 0.0 0.0 136-137 4.75 0.0 0.0 0.0 0.0 138-139 5.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGTACGG 10 0.006830828 145.0 3 GACCAGA 10 0.006830828 145.0 9 >>END_MODULE Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra Read 751524 spots for SRR7170470.sra Written 751524 spots for SRR7170470.sra Read 751514 spots for SRR7170470.sra Written 751514 spots for SRR7170470.sra SRR ids: ['SRR7170470.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_gob86ukp SRR7170470.sra spots: 15030290 blocks: [[1, 751514], [751515, 1503028], [1503029, 2254542], [2254543, 3006056], [3006057, 3757570], [3757571, 4509084], [4509085, 5260598], [5260599, 6012112], [6012113, 6763626], [6763627, 7515140], [7515141, 8266654], [8266655, 9018168], [9018169, 9769682], [9769683, 10521196], [10521197, 11272710], [11272711, 12024224], [12024225, 12775738], [12775739, 13527252], [13527253, 14278766], [14278767, 15030290]] SRR7170470 file size 5071571 SRR7170470 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170470 SRR7170470_1.fastq SRR7170470_2.fastq Input file: SRR7170470_1.fastq Paired file: SRR7170470_2.fastq trimmed: SRR7170470-trimmed-pair1.fastq, SRR7170470-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:00:30 2025 >> started Wed Feb 12 22:00:47 2025 >> done (16.473s) 15030290 read pairs processed; of these: 11850 ( 0.08%) short read pairs filtered out after trimming by size control 14647 ( 0.10%) empty read pairs filtered out after trimming by size control 15003793 (99.82%) read pairs available; of these: 8162923 (54.41%) trimmed read pairs available after processing 6840870 (45.59%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 3 0.00% 21 5 0.00% 22 6 0.00% 23 4 0.00% 24 3 0.00% 25 4 0.00% 26 6 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 6 0.00% 31 4 0.00% 32 5 0.00% 33 9 0.00% 34 8 0.00% 35 7 0.00% 36 10 0.00% 37 16 0.00% 38 9 0.00% 39 15 0.00% 40 18 0.00% 41 28 0.00% 42 29 0.00% 43 31 0.00% 44 41 0.00% 45 30 0.00% 46 34 0.00% 47 49 0.00% 48 56 0.00% 49 66 0.00% 50 85 0.00% 51 106 0.00% 52 108 0.00% 53 105 0.00% 54 125 0.00% 55 116 0.00% 56 177 0.00% 57 170 0.00% 58 204 0.00% 59 203 0.00% 60 274 0.00% 61 344 0.00% 62 397 0.00% 63 400 0.00% 64 505 0.00% 65 550 0.00% 66 550 0.00% 67 642 0.00% 68 701 0.00% 69 808 0.01% 70 896 0.01% 71 1030 0.01% 72 1202 0.01% 73 1460 0.01% 74 1601 0.01% 75 1714 0.01% 76 1992 0.01% 77 2125 0.01% 78 2220 0.01% 79 2377 0.02% 80 2721 0.02% 81 2984 0.02% 82 3415 0.02% 83 3893 0.03% 84 4548 0.03% 85 5401 0.04% 86 5640 0.04% 87 5898 0.04% 88 6160 0.04% 89 6550 0.04% 90 7139 0.05% 91 7598 0.05% 92 8168 0.05% 93 8968 0.06% 94 9446 0.06% 95 10419 0.07% 96 10760 0.07% 97 10991 0.07% 98 11232 0.07% 99 11952 0.08% 100 12199 0.08% 101 12772 0.09% 102 13544 0.09% 103 14209 0.09% 104 15090 0.10% 105 15730 0.10% 106 16357 0.11% 107 16550 0.11% 108 17049 0.11% 109 17600 0.12% 110 18009 0.12% 111 18858 0.13% 112 19523 0.13% 113 20256 0.14% 114 20899 0.14% 115 22007 0.15% 116 22552 0.15% 117 23232 0.15% 118 23783 0.16% 119 24140 0.16% 120 25093 0.17% 121 25580 0.17% 122 26461 0.18% 123 27731 0.18% 124 29542 0.20% 125 30169 0.20% 126 31473 0.21% 127 32801 0.22% 128 34086 0.23% 129 35704 0.24% 130 37464 0.25% 131 38993 0.26% 132 41640 0.28% 133 44586 0.30% 134 47613 0.32% 135 51282 0.34% 136 55384 0.37% 137 59965 0.40% 138 65634 0.44% 139 71562 0.48% 140 79046 0.53% 141 89249 0.59% 142 103337 0.69% 143 122383 0.82% 144 147403 0.98% 145 183496 1.22% 146 236902 1.58% 147 327779 2.18% 148 507992 3.39% 149 1004540 6.70% 150 4016087 26.77% 151 6840870 45.59% 15003793 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=24 prefix-density=0.62 prefix-fanout=2.0 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=82.91 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.7 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACAT criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.13 fanout-score-rank=28 prefix-density=0.57 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=47.18 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.6 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170470 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:01:32 Started mapping on | Feb 12 22:01:32 Finished on | Feb 12 22:03:58 Mapping speed, Million of reads per hour | 369.96 Number of input reads | 15003793 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13869963 Uniquely mapped reads % | 92.44% Average mapped length | 293.76 Number of splices: Total | 13667621 Number of splices: Annotated (sjdb) | 13340558 Number of splices: GT/AG | 13403950 Number of splices: GC/AG | 210445 Number of splices: AT/AC | 9788 Number of splices: Non-canonical | 43438 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.08 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 416946 % of reads mapped to multiple loci | 2.78% Number of reads mapped to too many loci | 24833 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.56% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 728080 728080 728080 N_multimapping 416946 416946 416946 N_noFeature 438886 13647332 499076 N_ambiguous 286416 703 123665 UnstrandedReadsAssigned:13144661 PositiveStrandReadsAssigned:221928 NegativeStrandReadsAssigned:13247222 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170470 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170470-trimmed-pair1.fastq SRR7170470-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,003,793 reads, 13,190,427 reads pseudoaligned [quant] estimated average fragment length: 268.768 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,173 rounds 52401 SRR7170470.ke.tsv 34699 SRR7170470.se.tsv 87100 total ==> SRR7170470.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.23 508 17.9714 Potri.005G024800.1.v4.1 1035 767.232 416 33.5722 Potri.004G059700.1.v4.1 961 693.242 11 0.982474 Potri.007G009000.2.v4.1 1416 1148.23 0 0 Potri.003G141000.2.v4.1 2943 2675.23 539.299 12.4819 Potri.016G087400.1.v4.1 270 75.0888 1117 921.067 Potri.015G069301.1.v4.1 564 300.653 0 0 Potri.010G195200.1.v4.1 1773 1505.23 40 1.64539 Potri.012G127500.1.v4.1 977 709.237 162 14.1428 ==> SRR7170470.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 246 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 62 SRR7170470 completed mapping pipeline successfully