Starting /dee2/code/volunteer_pipeline.sh SRR7170471 current disk space = 3050542411776 free memory = 1507989940 SRR7170471 SRAfilesize e8d74cfb800a0dfca2d156d5037a590d SRR7170471.sra SRR7170471.sra file validated SRR7170471 is paired end SRR7170471 is conventional basespace SRR7170471 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170471_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.70675 18.0 18.0 28.0 18.0 32.0 2 30.03225 31.0 29.0 31.0 27.0 33.0 3 30.72925 31.0 29.0 33.0 27.0 33.0 4 32.08725 33.0 31.0 33.0 30.0 33.0 5 32.89 33.0 33.0 33.0 32.0 34.0 6 37.1085 38.0 37.0 38.0 36.0 38.0 7 37.37625 38.0 38.0 38.0 36.0 38.0 8 37.591 38.0 38.0 38.0 37.0 38.0 9 37.4235 38.0 38.0 38.0 37.0 38.0 10-14 37.56654999999999 38.0 38.0 38.0 37.4 38.0 15-19 37.554649999999995 38.0 38.0 38.0 37.4 38.0 20-24 37.609700000000004 38.0 38.0 38.0 38.0 38.0 25-29 37.47825 38.0 38.0 38.0 37.0 38.0 30-34 37.520500000000006 38.0 38.0 38.0 37.6 38.0 35-39 37.44690000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.39055 38.0 38.0 38.0 37.0 38.0 45-49 37.17855 38.0 38.0 38.0 36.6 38.0 50-54 37.1479 38.0 38.0 38.0 36.0 38.0 55-59 36.97085 38.0 38.0 38.0 35.4 38.0 60-64 36.9578 38.0 38.0 38.0 35.6 38.0 65-69 36.80155 38.0 38.0 38.0 34.8 38.0 70-74 36.7344 38.0 38.0 38.0 34.6 38.0 75-79 36.4628 38.0 37.8 38.0 33.8 38.0 80-84 36.23145 38.0 37.0 38.0 33.6 38.0 85-89 36.191449999999996 38.0 37.0 38.0 33.0 38.0 90-94 36.067 38.0 37.0 38.0 33.2 38.0 95-99 35.562400000000004 38.0 36.6 38.0 30.0 38.0 100-104 35.80225 38.0 36.8 38.0 31.8 38.0 105-109 35.49145 38.0 36.2 38.0 29.8 38.0 110-114 35.1531 38.0 35.8 38.0 28.6 38.0 115-119 34.7046 38.0 35.0 38.0 27.2 38.0 120-124 34.3802 38.0 34.6 38.0 25.0 38.0 125-129 33.82615 38.0 34.0 38.0 22.6 38.0 130-134 32.6562 37.2 31.8 38.0 16.2 38.0 135-139 32.09155 36.4 31.0 38.0 14.6 38.0 140-144 30.992849999999997 36.0 29.8 38.0 12.8 38.0 145-149 29.6493 36.0 27.4 38.0 5.8 38.0 150-151 23.750124999999997 31.0 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 13 1.0 14 4.0 15 1.0 16 1.0 17 2.0 18 6.0 19 5.0 20 6.0 21 8.0 22 9.0 23 7.0 24 14.0 25 19.0 26 24.0 27 44.0 28 30.0 29 46.0 30 49.0 31 99.0 32 130.0 33 186.0 34 314.0 35 584.0 36 1326.0 37 1085.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.8402489626556 10.658713692946058 12.266597510373444 41.2344398340249 2 22.075 15.45 35.225 27.250000000000004 3 20.225 20.825 25.174999999999997 33.775 4 21.95 29.099999999999998 22.325 26.625 5 21.9 33.45 24.474999999999998 20.175 6 17.8 35.3 26.775 20.125 7 13.375 25.6 42.975 18.05 8 16.900000000000002 25.75 33.15 24.2 9 17.4 25.2 34.5 22.900000000000002 10-14 19.744999999999997 29.75 27.615000000000002 22.89 15-19 19.125 28.235 28.694999999999997 23.945 20-24 19.61 28.585 28.634999999999998 23.169999999999998 25-29 19.765 29.160000000000004 28.000000000000004 23.075000000000003 30-34 19.617942691403712 28.819322898434763 28.074211131669752 23.488523278491773 35-39 19.451945194519453 28.222822282228222 28.28282828282828 24.04240424042404 40-44 19.72 29.035 28.4 22.845 45-49 20.04 28.675 27.884999999999998 23.400000000000002 50-54 19.400000000000002 29.310000000000002 27.950000000000003 23.34 55-59 19.765 28.505000000000003 28.285 23.445 60-64 19.31 28.73 28.044999999999998 23.915 65-69 20.244999999999997 28.1 28.125 23.53 70-74 19.66 28.895 27.815 23.630000000000003 75-79 20.170042510627656 28.722180545136283 27.731932983245812 23.37584396099025 80-84 20.601180354106233 28.283485045513657 27.748324497349202 23.367010103030907 85-89 19.575978798939946 28.48642432121606 28.54142707135357 23.396169808490423 90-94 20.025000000000002 28.384999999999998 28.46 23.13 95-99 20.26 28.955 27.47 23.315 100-104 20.07 28.415000000000003 28.189999999999998 23.325000000000003 105-109 20.544999999999998 28.615000000000002 27.200000000000003 23.64 110-114 20.625 28.904999999999998 27.425 23.044999999999998 115-119 20.18 29.07 27.13 23.62 120-124 20.615 28.349999999999998 27.705000000000002 23.330000000000002 125-129 19.885 28.775000000000002 27.284999999999997 24.055 130-134 20.515 28.110000000000003 27.839999999999996 23.535 135-139 20.674999999999997 28.305000000000003 27.46 23.56 140-144 20.145 28.53 27.800000000000004 23.525 145-149 20.59 29.060000000000002 26.834999999999997 23.515 150-151 19.3625 29.099999999999998 27.925 23.6125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 0.0 23 1.0 24 6.0 25 7.5 26 5.5 27 5.0 28 8.0 29 16.0 30 22.5 31 28.5 32 38.5 33 40.0 34 57.5 35 88.5 36 103.5 37 129.5 38 160.0 39 174.0 40 213.0 41 244.5 42 246.0 43 254.5 44 263.5 45 264.0 46 259.0 47 244.5 48 214.0 49 191.0 50 171.0 51 130.5 52 97.0 53 75.5 54 53.0 55 47.0 56 39.5 57 28.0 58 22.5 59 18.0 60 12.5 61 7.0 62 5.0 63 3.0 64 0.5 65 0.5 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.025 80-84 0.03 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72396486825596 99.35000000000001 2 0.2258469259723965 0.44999999999999996 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.02509410288582183 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6125 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.775 0.0 0.0 0.0 0.0 98-99 0.875 0.0 0.0 0.0 0.0 100-101 0.9875 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.5 0.0 0.0 0.0 0.0 108-109 1.6625 0.0 0.0 0.0 0.0 110-111 1.725 0.0 0.0 0.0 0.0 112-113 1.875 0.0 0.0 0.0 0.0 114-115 2.1625 0.0 0.0 0.0 0.0 116-117 2.5625 0.0 0.0 0.0 0.0 118-119 2.9000000000000004 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.3375 0.0 0.0 0.0 0.0 124-125 3.65 0.0 0.0 0.0 0.0 126-127 4.074999999999999 0.0 0.0 0.0 0.0 128-129 4.4125 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.9375 0.0 0.0 0.0 0.0 134-135 5.1625 0.0 0.0 0.0 0.0 136-137 5.4375 0.0 0.0 0.0 0.0 138-139 5.775 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170471 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170471_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05725 33.0 33.0 34.0 32.0 34.0 2 33.18475 34.0 33.0 34.0 33.0 34.0 3 33.25475 34.0 33.0 34.0 33.0 34.0 4 33.23875 34.0 33.0 34.0 33.0 34.0 5 33.2045 34.0 33.0 34.0 33.0 34.0 6 37.44575 38.0 38.0 38.0 38.0 38.0 7 37.48775 38.0 38.0 38.0 38.0 38.0 8 37.48925 38.0 38.0 38.0 38.0 38.0 9 37.453 38.0 38.0 38.0 38.0 38.0 10-14 37.48535 38.0 38.0 38.0 38.0 38.0 15-19 37.45785 38.0 38.0 38.0 38.0 38.0 20-24 37.46575 38.0 38.0 38.0 38.0 38.0 25-29 37.43775 38.0 38.0 38.0 38.0 38.0 30-34 37.4131 38.0 38.0 38.0 38.0 38.0 35-39 37.3716 38.0 38.0 38.0 37.8 38.0 40-44 37.408100000000005 38.0 38.0 38.0 37.6 38.0 45-49 37.4022 38.0 38.0 38.0 38.0 38.0 50-54 37.3525 38.0 38.0 38.0 37.2 38.0 55-59 37.299099999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.28085 38.0 38.0 38.0 37.0 38.0 65-69 37.21079999999999 38.0 38.0 38.0 37.0 38.0 70-74 37.1923 38.0 38.0 38.0 37.0 38.0 75-79 37.086850000000005 38.0 38.0 38.0 36.6 38.0 80-84 37.031850000000006 38.0 38.0 38.0 36.4 38.0 85-89 37.007349999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.90505 38.0 38.0 38.0 36.0 38.0 95-99 36.7823 38.0 38.0 38.0 35.4 38.0 100-104 36.6761 38.0 38.0 38.0 35.0 38.0 105-109 36.50075 38.0 38.0 38.0 34.0 38.0 110-114 36.387299999999996 38.0 38.0 38.0 34.0 38.0 115-119 36.2285 38.0 37.6 38.0 34.0 38.0 120-124 35.793549999999996 38.0 37.2 38.0 31.8 38.0 125-129 35.174099999999996 38.0 36.0 38.0 30.0 38.0 130-134 35.10515 38.0 36.0 38.0 30.0 38.0 135-139 34.5284 38.0 35.0 38.0 27.2 38.0 140-144 33.85585 38.0 33.6 38.0 23.0 38.0 145-149 33.31904999999999 38.0 33.0 38.0 21.2 38.0 150-151 27.532249999999998 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 2.0 4 0.0 5 1.0 6 0.0 7 1.0 8 1.0 9 0.0 10 1.0 11 0.0 12 1.0 13 2.0 14 1.0 15 0.0 16 3.0 17 3.0 18 8.0 19 3.0 20 0.0 21 5.0 22 5.0 23 6.0 24 9.0 25 11.0 26 9.0 27 14.0 28 13.0 29 22.0 30 35.0 31 47.0 32 60.0 33 77.0 34 119.0 35 261.0 36 695.0 37 2577.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 34.475856892669505 18.989241931448586 16.937703277458095 29.597197898423815 2 26.26970227670753 25.39404553415061 32.49937453089817 15.836877658243683 3 20.01501125844383 29.622216662496875 31.248436327245432 19.11433575181386 4 23.992994746059544 33.850387790843136 22.91718789091819 19.239429572179134 5 23.84884884884885 37.96296296296296 22.772772772772772 15.415415415415415 6 20.665499124343256 37.77833375031274 23.39254440830623 18.16362271703778 7 17.187890918188643 20.815611708781585 40.930698023517635 21.065799349512133 8 22.61696272204153 25.769326995246434 27.52064048036027 24.093069802351764 9 21.591193395046286 25.69427070302727 29.472104078058543 23.2424318238679 10-14 23.237780779428686 29.31612386812747 26.559607784281354 20.88648756816249 15-19 22.972229171878908 27.92594445834376 28.111083312484364 20.99074305729297 20-24 22.34175631723793 28.796597448086064 28.186139604703524 20.675506629972478 25-29 23.332165557279417 28.051649066613283 28.14673940243231 20.46944597367499 30-34 22.603733920616648 28.504930176685523 28.32474097802693 20.566594924670905 35-39 22.2133239901897 28.45988287702087 28.359777766654986 20.967015366134444 40-44 22.997247935951965 28.836627470602956 27.690768076057044 20.47535651738804 45-49 22.882161621215914 28.04603452589442 28.376282211658744 20.695521641230926 50-54 23.2424318238679 28.256192144108084 28.116087065298974 20.385288966725042 55-59 23.332499374530897 28.251188391293468 27.76582436827621 20.650487865899425 60-64 22.989541109943453 28.233998899064204 28.404143521993696 20.37231646899865 65-69 23.131601341542773 27.536667167242328 28.22746158081794 21.104269910396955 70-74 23.322987585102123 28.30396475770925 27.543051661994394 20.829995995194235 75-79 22.878598247809762 27.794743429286605 28.05006257822278 21.27659574468085 80-84 23.143929912390487 28.105131414267838 27.98498122653317 20.76595744680851 85-89 23.09887359198999 28.030037546933666 28.08010012515644 20.7909887359199 90-94 23.314142678347935 27.92991239048811 28.305381727158952 20.450563204005007 95-99 23.30796956347617 27.848418101722068 28.088706447737284 20.754905887064478 100-104 23.47847847847848 28.013013013013012 27.48748748748749 21.02102102102102 105-109 23.315647211933126 28.180999099008908 27.57533286615277 20.928020822905196 110-114 23.55326391670004 27.93352022426912 27.87845414497397 20.634761714056868 115-119 23.849812265331664 27.97997496871089 28.11013767209011 20.060075093867333 120-124 23.389236545682103 28.020025031289116 28.075093867334168 20.515644555694617 125-129 23.709637046307886 28.600750938673343 27.274092615769714 20.41551939924906 130-134 24.520650813516895 28.665832290362953 27.28911138923655 19.524405506883603 135-139 24.285356695869837 27.91989987484356 27.749687108886107 20.0450563204005 140-144 23.859824780976222 28.705882352941174 27.47434292866083 19.95994993742178 145-149 24.41551939924906 28.150187734668336 28.035043804755944 19.39924906132666 150-151 24.0990990990991 27.902902902902905 28.14064064064064 19.85735735735736 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 2.0 18 2.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 2.5 25 3.5 26 3.5 27 4.0 28 9.0 29 15.0 30 17.0 31 24.0 32 37.0 33 44.0 34 53.0 35 65.5 36 86.5 37 117.0 38 143.0 39 181.5 40 215.5 41 234.5 42 241.0 43 267.0 44 288.5 45 272.5 46 255.0 47 240.0 48 226.0 49 198.0 50 163.0 51 127.5 52 102.0 53 88.5 54 74.0 55 56.0 56 42.5 57 29.0 58 19.0 59 15.0 60 9.0 61 6.5 62 5.5 63 4.5 64 2.0 65 1.0 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.1 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.055 15-19 0.075 20-24 0.075 25-29 0.095 30-34 0.105 35-39 0.105 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.075 60-64 0.08499999999999999 65-69 0.11499999999999999 70-74 0.12 75-79 0.125 80-84 0.125 85-89 0.125 90-94 0.125 95-99 0.12 100-104 0.1 105-109 0.11 110-114 0.12 115-119 0.125 120-124 0.125 125-129 0.125 130-134 0.125 135-139 0.125 140-144 0.125 145-149 0.125 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2938209331652 98.425 2 0.5548549810844893 1.0999999999999999 3 0.12610340479192939 0.375 4 0.025220680958385876 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.35 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.525 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.825 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.1875 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.7875 0.0 0.0 0.0 0.0 110-111 1.8624999999999998 0.0 0.0 0.0 0.0 112-113 2.0250000000000004 0.0 0.0 0.0 0.0 114-115 2.3125 0.0 0.0 0.0 0.0 116-117 2.7125000000000004 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.3 0.0 0.0 0.0 0.0 122-123 3.5 0.0 0.0 0.0 0.0 124-125 3.825 0.0 0.0 0.0 0.0 126-127 4.275 0.0 0.0 0.0 0.0 128-129 4.65 0.0 0.0 0.0 0.0 130-131 4.8625 0.0 0.0 0.0 0.0 132-133 5.2125 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.775 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCCATCT 10 0.006830828 145.0 2 >>END_MODULE Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657882 spots for SRR7170471.sra Written 657882 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra Read 657880 spots for SRR7170471.sra Written 657880 spots for SRR7170471.sra SRR ids: ['SRR7170471.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_46u4tivr SRR7170471.sra spots: 13157602 blocks: [[1, 657880], [657881, 1315760], [1315761, 1973640], [1973641, 2631520], [2631521, 3289400], [3289401, 3947280], [3947281, 4605160], [4605161, 5263040], [5263041, 5920920], [5920921, 6578800], [6578801, 7236680], [7236681, 7894560], [7894561, 8552440], [8552441, 9210320], [9210321, 9868200], [9868201, 10526080], [10526081, 11183960], [11183961, 11841840], [11841841, 12499720], [12499721, 13157602]] SRR7170471 file size 4436979 SRR7170471 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170471 SRR7170471_1.fastq SRR7170471_2.fastq Input file: SRR7170471_1.fastq Paired file: SRR7170471_2.fastq trimmed: SRR7170471-trimmed-pair1.fastq, SRR7170471-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:00:07 2025 >> started Wed Feb 12 22:00:23 2025 >> done (16.389s) 13157602 read pairs processed; of these: 9821 ( 0.07%) short read pairs filtered out after trimming by size control 15271 ( 0.12%) empty read pairs filtered out after trimming by size control 13132510 (99.81%) read pairs available; of these: 8882224 (67.64%) trimmed read pairs available after processing 4250286 (32.36%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 2 0.00% 23 2 0.00% 24 2 0.00% 25 5 0.00% 26 2 0.00% 27 1 0.00% 28 5 0.00% 29 4 0.00% 30 1 0.00% 31 6 0.00% 32 2 0.00% 33 2 0.00% 34 5 0.00% 35 7 0.00% 36 9 0.00% 37 12 0.00% 38 11 0.00% 39 13 0.00% 40 9 0.00% 41 29 0.00% 42 25 0.00% 43 24 0.00% 44 35 0.00% 45 46 0.00% 46 30 0.00% 47 43 0.00% 48 44 0.00% 49 75 0.00% 50 65 0.00% 51 82 0.00% 52 79 0.00% 53 106 0.00% 54 108 0.00% 55 133 0.00% 56 158 0.00% 57 157 0.00% 58 180 0.00% 59 203 0.00% 60 259 0.00% 61 269 0.00% 62 354 0.00% 63 371 0.00% 64 393 0.00% 65 441 0.00% 66 466 0.00% 67 546 0.00% 68 643 0.00% 69 679 0.01% 70 793 0.01% 71 883 0.01% 72 1070 0.01% 73 1159 0.01% 74 1328 0.01% 75 1384 0.01% 76 1607 0.01% 77 1697 0.01% 78 1968 0.01% 79 2159 0.02% 80 2441 0.02% 81 2722 0.02% 82 3144 0.02% 83 3717 0.03% 84 4465 0.03% 85 4415 0.03% 86 4814 0.04% 87 4906 0.04% 88 5209 0.04% 89 5515 0.04% 90 5951 0.05% 91 6455 0.05% 92 6956 0.05% 93 7549 0.06% 94 8359 0.06% 95 8742 0.07% 96 9311 0.07% 97 9569 0.07% 98 10131 0.08% 99 10461 0.08% 100 11346 0.09% 101 11732 0.09% 102 12133 0.09% 103 13040 0.10% 104 13946 0.11% 105 14647 0.11% 106 15241 0.12% 107 15850 0.12% 108 16308 0.12% 109 16528 0.13% 110 16684 0.13% 111 17617 0.13% 112 18291 0.14% 113 19136 0.15% 114 19624 0.15% 115 21070 0.16% 116 21784 0.17% 117 22332 0.17% 118 23173 0.18% 119 23675 0.18% 120 24624 0.19% 121 25943 0.20% 122 26956 0.21% 123 27705 0.21% 124 29466 0.22% 125 30440 0.23% 126 32920 0.25% 127 34260 0.26% 128 35968 0.27% 129 38428 0.29% 130 40755 0.31% 131 43058 0.33% 132 46610 0.35% 133 50596 0.39% 134 54852 0.42% 135 60130 0.46% 136 66480 0.51% 137 73812 0.56% 138 81179 0.62% 139 91097 0.69% 140 104030 0.79% 141 118174 0.90% 142 138022 1.05% 143 162489 1.24% 144 199264 1.52% 145 250827 1.91% 146 327202 2.49% 147 456164 3.47% 148 692351 5.27% 149 1265503 9.64% 150 3763730 28.66% 151 4250286 32.36% 13132510 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.04 fanout-score-rank=21 prefix-density=0.42 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=26 fanout-score=303.97 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=15.1 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=17 prefix-density=0.53 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=42.42 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.1 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCTGTCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTATCCCGGGGAGCTCTCAACCCCCATAAACCAGTGTACGGTTGCGGAAGGGGTAATCGATATTGCGT SRR7170471 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:01:06 Started mapping on | Feb 12 22:01:06 Finished on | Feb 12 22:02:32 Mapping speed, Million of reads per hour | 549.73 Number of input reads | 13132510 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12456252 Uniquely mapped reads % | 94.85% Average mapped length | 292.24 Number of splices: Total | 12115573 Number of splices: Annotated (sjdb) | 11828649 Number of splices: GT/AG | 11884759 Number of splices: GC/AG | 186591 Number of splices: AT/AC | 7434 Number of splices: Non-canonical | 36789 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.65 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 376941 % of reads mapped to multiple loci | 2.87% Number of reads mapped to too many loci | 21950 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.07% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 305708 305708 305708 N_multimapping 376941 376941 376941 N_noFeature 488982 12273293 544091 N_ambiguous 226990 624 98863 UnstrandedReadsAssigned:11740280 PositiveStrandReadsAssigned:182335 NegativeStrandReadsAssigned:11813298 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170471 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170471-trimmed-pair1.fastq SRR7170471-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,132,510 reads, 11,747,964 reads pseudoaligned [quant] estimated average fragment length: 266.881 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 975 rounds 52401 SRR7170471.ke.tsv 34699 SRR7170471.se.tsv 87100 total ==> SRR7170471.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.12 1106 52.4221 Potri.005G024800.1.v4.1 1035 769.119 323 34.8764 Potri.004G059700.1.v4.1 961 695.135 7 0.836281 Potri.007G009000.2.v4.1 1416 1150.12 0 0 Potri.003G141000.2.v4.1 2943 2677.12 652.373 20.2373 Potri.016G087400.1.v4.1 270 77.5232 636 681.316 Potri.015G069301.1.v4.1 564 302.401 0 0 Potri.010G195200.1.v4.1 1773 1507.12 96 5.28989 Potri.012G127500.1.v4.1 977 711.124 114 13.3132 ==> SRR7170471.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 696 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 235 Potri.001G212900.v4.1 21 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 82 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170471 completed mapping pipeline successfully