Starting /dee2/code/volunteer_pipeline.sh SRR7170472 current disk space = 3050594590720 free memory = 1581469424 SRR7170472 SRAfilesize f49e14e1fdc407059d3bf0fbe2cc1aab SRR7170472.sra SRR7170472.sra file validated SRR7170472 is paired end SRR7170472 is conventional basespace SRR7170472 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170472_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 21.45775 18.0 18.0 28.0 18.0 32.0 2 29.94825 31.0 29.0 33.0 27.0 33.0 3 30.679 31.0 29.0 33.0 27.0 33.0 4 32.0375 33.0 31.0 33.0 29.0 33.0 5 32.8475 33.0 33.0 33.0 32.0 34.0 6 37.034 38.0 37.0 38.0 35.0 38.0 7 37.37225 38.0 38.0 38.0 36.0 38.0 8 37.52875 38.0 38.0 38.0 37.0 38.0 9 37.38375 38.0 38.0 38.0 37.0 38.0 10-14 37.5505 38.0 38.0 38.0 37.2 38.0 15-19 37.5082 38.0 38.0 38.0 37.2 38.0 20-24 37.5462 38.0 38.0 38.0 37.2 38.0 25-29 37.500099999999996 38.0 38.0 38.0 37.4 38.0 30-34 37.4827 38.0 38.0 38.0 37.4 38.0 35-39 37.3807 38.0 38.0 38.0 37.0 38.0 40-44 37.339650000000006 38.0 38.0 38.0 37.0 38.0 45-49 37.166900000000005 38.0 38.0 38.0 36.6 38.0 50-54 37.081950000000006 38.0 38.0 38.0 36.0 38.0 55-59 36.888650000000005 38.0 38.0 38.0 35.2 38.0 60-64 36.876200000000004 38.0 38.0 38.0 35.4 38.0 65-69 36.742200000000004 38.0 38.0 38.0 35.0 38.0 70-74 36.6545 38.0 38.0 38.0 34.2 38.0 75-79 36.4181 38.0 37.8 38.0 34.0 38.0 80-84 36.17445 38.0 37.0 38.0 33.4 38.0 85-89 36.2483 38.0 37.0 38.0 33.2 38.0 90-94 35.99525 38.0 37.0 38.0 33.0 38.0 95-99 35.568400000000004 38.0 36.6 38.0 30.4 38.0 100-104 35.73514999999999 38.0 36.4 38.0 31.0 38.0 105-109 35.4797 38.0 36.2 38.0 29.6 38.0 110-114 35.178900000000006 38.0 35.8 38.0 28.6 38.0 115-119 34.89545 38.0 35.0 38.0 27.8 38.0 120-124 34.490399999999994 38.0 34.8 38.0 26.2 38.0 125-129 33.9172 38.0 34.0 38.0 23.0 38.0 130-134 32.63065 37.4 31.8 38.0 16.2 38.0 135-139 31.79475 36.2 31.0 38.0 14.2 38.0 140-144 30.846449999999997 36.0 29.4 38.0 12.6 38.0 145-149 29.66175 36.0 27.6 38.0 5.8 38.0 150-151 23.90925 31.0 13.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 1.0 14 2.0 15 1.0 16 0.0 17 3.0 18 8.0 19 1.0 20 8.0 21 9.0 22 7.0 23 15.0 24 23.0 25 17.0 26 26.0 27 26.0 28 48.0 29 45.0 30 67.0 31 77.0 32 140.0 33 179.0 34 297.0 35 605.0 36 1258.0 37 1136.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.21937842778793 11.099503786889526 11.203969704883782 37.47714808043875 2 21.7 15.8 33.6 28.9 3 20.349999999999998 21.95 25.374999999999996 32.324999999999996 4 23.5 29.325000000000003 23.025000000000002 24.15 5 23.45 32.525 24.625 19.400000000000002 6 19.125 34.599999999999994 25.55 20.724999999999998 7 14.249999999999998 24.375 44.324999999999996 17.05 8 18.125 23.875 32.300000000000004 25.7 9 18.025 23.849999999999998 34.625 23.5 10-14 19.395 29.985 27.105 23.515 15-19 19.53 28.73 28.12 23.62 20-24 19.27 28.87 28.28 23.580000000000002 25-29 19.37 29.065 28.325 23.24 30-34 19.592938940841126 28.849327399109864 28.259238885832875 23.298494774216135 35-39 19.635981799089954 29.086454322716136 27.736386819340968 23.541177058852945 40-44 19.93 29.304999999999996 27.165 23.599999999999998 45-49 19.91 28.965000000000003 27.855 23.27 50-54 19.66 28.9 28.110000000000003 23.330000000000002 55-59 19.509999999999998 29.494999999999997 27.37 23.625 60-64 19.335 28.560000000000002 28.68 23.425 65-69 19.735 28.485 28.34 23.44 70-74 19.535 29.085 27.775 23.605 75-79 19.40388077615523 29.13582716543309 27.725545109021805 23.73474694938988 80-84 20.06901380276055 28.695739147829563 28.030606121224245 23.20464092818564 85-89 19.52597629881494 28.711435571778587 27.891394569728483 23.871193559677984 90-94 20.365 28.494999999999997 27.96 23.18 95-99 20.345 28.65 27.775 23.23 100-104 20.200000000000003 28.57 27.665 23.565 105-109 20.044999999999998 28.51 28.265 23.18 110-114 20.06 28.439999999999998 28.13 23.369999999999997 115-119 19.98 29.099999999999998 27.334999999999997 23.585 120-124 20.169999999999998 28.634999999999998 27.61 23.585 125-129 20.27 28.17 27.915 23.645 130-134 19.975 28.845 27.46 23.72 135-139 20.244999999999997 28.389999999999997 27.36 24.005000000000003 140-144 20.355 28.645 27.88 23.119999999999997 145-149 20.595 28.349999999999998 27.49 23.565 150-151 19.400000000000002 28.225 27.962500000000002 24.4125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 0.5 19 1.0 20 1.0 21 2.0 22 3.0 23 2.0 24 2.0 25 4.5 26 7.0 27 7.0 28 8.0 29 14.5 30 21.0 31 23.0 32 32.5 33 51.0 34 70.5 35 88.5 36 118.5 37 141.0 38 141.5 39 155.5 40 191.0 41 232.5 42 247.5 43 247.0 44 264.0 45 273.0 46 259.0 47 235.0 48 212.5 49 200.0 50 184.0 51 144.5 52 102.0 53 79.5 54 63.5 55 44.0 56 35.5 57 29.0 58 21.5 59 16.5 60 9.5 61 6.0 62 3.0 63 1.5 64 1.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.015 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.02 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.45 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47209653092006 98.925 2 0.5027652086475616 1.0 3 0.025138260432378077 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.325 0.0 0.0 0.0 0.0 92-93 0.48750000000000004 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.7875000000000001 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.9625 0.0 0.0 0.0 0.0 106-107 1.1124999999999998 0.0 0.0 0.0 0.0 108-109 1.225 0.0 0.0 0.0 0.0 110-111 1.425 0.0 0.0 0.0 0.0 112-113 1.55 0.0 0.0 0.0 0.0 114-115 1.85 0.0 0.0 0.0 0.0 116-117 2.0625 0.0 0.0 0.0 0.0 118-119 2.275 0.0 0.0 0.0 0.0 120-121 2.4000000000000004 0.0 0.0 0.0 0.0 122-123 2.5999999999999996 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.45 0.0 0.0 0.0 0.0 130-131 3.6375 0.0 0.0 0.0 0.0 132-133 3.8625 0.0 0.0 0.0 0.0 134-135 4.025 0.0 0.0 0.0 0.0 136-137 4.175000000000001 0.0 0.0 0.0 0.0 138-139 4.487500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170472 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170472_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0495 33.0 33.0 34.0 32.0 34.0 2 33.14875 34.0 33.0 34.0 33.0 34.0 3 33.17925 34.0 33.0 34.0 33.0 34.0 4 33.18625 34.0 33.0 34.0 33.0 34.0 5 33.14325 34.0 33.0 34.0 33.0 34.0 6 37.37425 38.0 38.0 38.0 38.0 38.0 7 37.421 38.0 38.0 38.0 38.0 38.0 8 37.38325 38.0 38.0 38.0 38.0 38.0 9 37.3775 38.0 38.0 38.0 38.0 38.0 10-14 37.3646 38.0 38.0 38.0 38.0 38.0 15-19 37.3541 38.0 38.0 38.0 37.8 38.0 20-24 37.358599999999996 38.0 38.0 38.0 37.8 38.0 25-29 37.3407 38.0 38.0 38.0 37.6 38.0 30-34 37.3177 38.0 38.0 38.0 37.6 38.0 35-39 37.28484999999999 38.0 38.0 38.0 37.4 38.0 40-44 37.307500000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.2721 38.0 38.0 38.0 37.0 38.0 50-54 37.2268 38.0 38.0 38.0 37.0 38.0 55-59 37.16745 38.0 38.0 38.0 37.0 38.0 60-64 37.13035 38.0 38.0 38.0 37.0 38.0 65-69 37.0998 38.0 38.0 38.0 37.0 38.0 70-74 36.97945 38.0 38.0 38.0 36.0 38.0 75-79 36.96365 38.0 38.0 38.0 36.0 38.0 80-84 36.846 38.0 38.0 38.0 36.0 38.0 85-89 36.882549999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.696 38.0 38.0 38.0 35.4 38.0 95-99 36.5873 38.0 38.0 38.0 35.0 38.0 100-104 36.56485 38.0 38.0 38.0 34.8 38.0 105-109 36.37615000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.2935 38.0 37.8 38.0 34.2 38.0 115-119 36.0428 38.0 37.2 38.0 33.8 38.0 120-124 35.7539 38.0 37.0 38.0 31.6 38.0 125-129 35.144800000000004 38.0 36.0 38.0 29.4 38.0 130-134 35.0013 38.0 36.0 38.0 29.8 38.0 135-139 34.511300000000006 38.0 35.0 38.0 27.0 38.0 140-144 33.8429 38.0 33.4 38.0 23.2 38.0 145-149 33.174699999999994 38.0 33.0 38.0 19.2 38.0 150-151 27.44725 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 1.0 5 0.0 6 1.0 7 3.0 8 1.0 9 0.0 10 1.0 11 3.0 12 3.0 13 1.0 14 1.0 15 3.0 16 1.0 17 5.0 18 4.0 19 1.0 20 4.0 21 2.0 22 6.0 23 4.0 24 7.0 25 8.0 26 9.0 27 19.0 28 14.0 29 25.0 30 36.0 31 48.0 32 61.0 33 77.0 34 148.0 35 261.0 36 674.0 37 2553.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.6688344172086 21.435717858929465 13.806903451725864 27.088544272136065 2 25.962981490745374 26.96348174087044 30.265132566283143 16.808404202101052 3 20.785392696348172 27.963981990995496 31.690845422711355 19.559779889944974 4 23.411705852926463 34.3671835917959 24.062031015507753 18.159079539769884 5 24.39329497122842 36.527395546659996 22.566925193895422 16.51238428821616 6 19.679919979995 38.40960240060015 23.55588897224306 18.35458864716179 7 19.579894973743436 21.680420105026258 38.85971492873218 19.879969992498125 8 21.205301325331334 25.456364091022753 28.432108027006752 24.90622655663916 9 21.280320080020005 25.881470367591895 29.957489372343087 22.88072018004501 10-14 22.758413762064308 28.52427864179627 27.459118867830174 21.258188728309246 15-19 23.274309723889555 28.416366546618647 28.021208483393355 20.28811524609844 20-24 22.896448224112056 28.024012006003 28.16408204102051 20.915457728864432 25-29 22.96878126876126 28.31699019411647 28.08184910946568 20.632379427656595 30-34 22.560792554788353 28.590013009106375 28.189732812969076 20.659461623136195 35-39 22.730911638146704 28.14970479335535 28.024617232062443 21.094766336435505 40-44 23.02151075537769 28.29414707353677 28.16408204102051 20.520260130065033 45-49 23.051525762881443 28.269134567283643 27.843921960980488 20.83541770885443 50-54 23.71185592796398 28.039019509754876 28.094047023511752 20.155077538769383 55-59 23.276638319159577 27.85892946473237 28.30415207603802 20.560280140070038 60-64 23.774264558735243 27.531518911346808 27.9467680608365 20.747448469081448 65-69 22.9672254190643 27.700775581686266 28.56642481861396 20.765574180635475 70-74 23.137353014761068 27.760820615461597 28.561421065799347 20.540405303977984 75-79 23.29096186567911 27.78500650585527 28.03022720448404 20.89380442398158 80-84 22.967561073287946 28.344012815378456 28.313976772126555 20.37444933920705 85-89 23.72898318654924 28.427742193755005 27.542033626901517 20.301240992794238 90-94 23.217413059794847 27.9459594696022 28.461346009507132 20.37528146109582 95-99 23.722792094070552 27.72079059294471 28.13109832374281 20.42531898924193 100-104 23.311317922545783 28.670069048333836 27.914540178124685 20.104072850995696 105-109 23.617713284963724 27.970978233675257 28.091068301225917 20.3202401801351 110-114 23.897923442581938 28.236177132849637 27.88591443582687 19.979984988741556 115-119 23.65892714171337 28.803042433947155 27.311849479583667 20.226180944755804 120-124 23.684605757196493 28.16520650813517 28.170212765957448 19.97997496871089 125-129 23.704111784444333 28.121400310512346 28.011218510542395 20.163269394500926 130-134 23.64783653846154 28.074919871794872 28.430488782051285 19.846754807692307 135-139 24.47405329593268 27.454417952314163 28.426167100781406 19.64536165097175 140-144 24.065912050485828 28.273064209155564 28.212962035460283 19.44806170489833 145-149 24.42040959391117 28.245956637123832 28.07070251865205 19.262931250312953 150-151 23.6986986986987 28.953953953953953 28.203203203203202 19.144144144144143 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 1.0 6 1.0 7 0.5 8 1.0 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.0 21 1.0 22 2.5 23 2.0 24 2.0 25 4.0 26 5.5 27 6.0 28 7.5 29 13.0 30 17.5 31 19.5 32 27.0 33 41.5 34 56.0 35 63.5 36 90.0 37 128.0 38 159.0 39 183.0 40 211.5 41 236.5 42 244.0 43 258.0 44 275.0 45 276.5 46 249.5 47 229.0 48 215.5 49 188.5 50 164.5 51 136.0 52 111.5 53 89.5 54 66.0 55 57.5 56 51.0 57 34.0 58 20.5 59 14.0 60 12.5 61 10.0 62 4.5 63 3.5 64 2.5 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 1.0 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.05 2 0.05 3 0.05 4 0.05 5 0.075 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.015 15-19 0.04 20-24 0.05 25-29 0.06 30-34 0.06999999999999999 35-39 0.06999999999999999 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.06 65-69 0.075 70-74 0.075 75-79 0.09 80-84 0.12 85-89 0.08 90-94 0.075 95-99 0.075 100-104 0.06999999999999999 105-109 0.075 110-114 0.075 115-119 0.08 120-124 0.125 125-129 0.165 130-134 0.16 135-139 0.18 140-144 0.16999999999999998 145-149 0.145 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.42799597180261834 0.8500000000000001 3 0.10070493454179255 0.3 4 0.025176233635448138 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.0875 0.0 0.0 0.0 0.0 82-83 0.1125 0.0 0.0 0.0 0.0 84-85 0.125 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.225 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.5375000000000001 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.7625 0.0 0.0 0.0 0.0 102-103 0.8 0.0 0.0 0.0 0.0 104-105 0.9375 0.0 0.0 0.0 0.0 106-107 1.0875 0.0 0.0 0.0 0.0 108-109 1.2 0.0 0.0 0.0 0.0 110-111 1.4 0.0 0.0 0.0 0.0 112-113 1.525 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 2.0125 0.0 0.0 0.0 0.0 118-119 2.225 0.0 0.0 0.0 0.0 120-121 2.375 0.0 0.0 0.0 0.0 122-123 2.5875 0.0 0.0 0.0 0.0 124-125 2.8625 0.0 0.0 0.0 0.0 126-127 3.2375 0.0 0.0 0.0 0.0 128-129 3.4625 0.0 0.0 0.0 0.0 130-131 3.675 0.0 0.0 0.0 0.0 132-133 3.9375 0.0 0.0 0.0 0.0 134-135 4.125 0.0 0.0 0.0 0.0 136-137 4.275 0.0 0.0 0.0 0.0 138-139 4.5875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TGTAGGG 40 0.0076550315 18.125 130-134 >>END_MODULE Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690631 spots for SRR7170472.sra Written 690631 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra Read 690617 spots for SRR7170472.sra Written 690617 spots for SRR7170472.sra SRR ids: ['SRR7170472.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u4g6z039 SRR7170472.sra spots: 13812354 blocks: [[1, 690617], [690618, 1381234], [1381235, 2071851], [2071852, 2762468], [2762469, 3453085], [3453086, 4143702], [4143703, 4834319], [4834320, 5524936], [5524937, 6215553], [6215554, 6906170], [6906171, 7596787], [7596788, 8287404], [8287405, 8978021], [8978022, 9668638], [9668639, 10359255], [10359256, 11049872], [11049873, 11740489], [11740490, 12431106], [12431107, 13121723], [13121724, 13812354]] SRR7170472 file size 4658853 SRR7170472 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170472 SRR7170472_1.fastq SRR7170472_2.fastq Input file: SRR7170472_1.fastq Paired file: SRR7170472_2.fastq trimmed: SRR7170472-trimmed-pair1.fastq, SRR7170472-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 21:44:40 2025 >> started Wed Feb 12 21:44:54 2025 >> done (14.317s) 13812354 read pairs processed; of these: 17378 ( 0.13%) short read pairs filtered out after trimming by size control 21930 ( 0.16%) empty read pairs filtered out after trimming by size control 13773046 (99.72%) read pairs available; of these: 9183493 (66.68%) trimmed read pairs available after processing 4589553 (33.32%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 2 0.00% 21 3 0.00% 22 3 0.00% 23 3 0.00% 24 1 0.00% 25 2 0.00% 26 5 0.00% 27 5 0.00% 28 3 0.00% 29 5 0.00% 30 4 0.00% 31 4 0.00% 32 9 0.00% 33 4 0.00% 34 4 0.00% 35 12 0.00% 36 16 0.00% 37 13 0.00% 38 13 0.00% 39 14 0.00% 40 19 0.00% 41 26 0.00% 42 23 0.00% 43 26 0.00% 44 27 0.00% 45 42 0.00% 46 35 0.00% 47 41 0.00% 48 67 0.00% 49 74 0.00% 50 95 0.00% 51 102 0.00% 52 133 0.00% 53 105 0.00% 54 133 0.00% 55 136 0.00% 56 167 0.00% 57 152 0.00% 58 203 0.00% 59 249 0.00% 60 279 0.00% 61 334 0.00% 62 380 0.00% 63 400 0.00% 64 449 0.00% 65 449 0.00% 66 477 0.00% 67 599 0.00% 68 666 0.00% 69 740 0.01% 70 828 0.01% 71 1030 0.01% 72 1128 0.01% 73 1326 0.01% 74 1439 0.01% 75 1545 0.01% 76 1695 0.01% 77 1906 0.01% 78 2086 0.02% 79 2320 0.02% 80 2603 0.02% 81 2964 0.02% 82 3401 0.02% 83 3853 0.03% 84 4938 0.04% 85 5190 0.04% 86 5293 0.04% 87 5413 0.04% 88 5864 0.04% 89 6095 0.04% 90 6450 0.05% 91 7008 0.05% 92 7434 0.05% 93 8086 0.06% 94 8723 0.06% 95 9283 0.07% 96 9721 0.07% 97 10039 0.07% 98 10442 0.08% 99 10876 0.08% 100 11292 0.08% 101 11796 0.09% 102 12690 0.09% 103 13198 0.10% 104 14016 0.10% 105 14793 0.11% 106 15412 0.11% 107 15568 0.11% 108 16115 0.12% 109 16236 0.12% 110 16550 0.12% 111 17458 0.13% 112 18320 0.13% 113 18838 0.14% 114 19793 0.14% 115 20603 0.15% 116 21169 0.15% 117 22032 0.16% 118 22880 0.17% 119 23209 0.17% 120 24205 0.18% 121 25319 0.18% 122 26631 0.19% 123 27975 0.20% 124 29324 0.21% 125 30813 0.22% 126 32676 0.24% 127 34425 0.25% 128 35880 0.26% 129 38220 0.28% 130 40622 0.29% 131 43646 0.32% 132 46916 0.34% 133 51123 0.37% 134 55528 0.40% 135 61180 0.44% 136 66525 0.48% 137 73756 0.54% 138 81760 0.59% 139 92012 0.67% 140 104459 0.76% 141 118462 0.86% 142 137897 1.00% 143 163410 1.19% 144 198999 1.44% 145 250739 1.82% 146 328921 2.39% 147 459650 3.34% 148 702300 5.10% 149 1305840 9.48% 150 3996576 29.02% 151 4589553 33.32% 13773046 reads passed initial QC criterion=sequence-density sequence-density=0.65 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=23 prefix-density=0.64 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.06 sequence-density-rank=26 fanout-score=12.28 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=3.2 sequence=ATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=19 prefix-density=0.64 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.14 sequence-density-rank=19 fanout-score=16.06 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=5.8 sequence=AGCAATGGCAGCA SRR7170472 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 21:45:47 Started mapping on | Feb 12 21:45:48 Finished on | Feb 12 21:47:26 Mapping speed, Million of reads per hour | 505.95 Number of input reads | 13773046 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12678863 Uniquely mapped reads % | 92.06% Average mapped length | 292.34 Number of splices: Total | 12447282 Number of splices: Annotated (sjdb) | 12147443 Number of splices: GT/AG | 12218034 Number of splices: GC/AG | 182702 Number of splices: AT/AC | 7311 Number of splices: Non-canonical | 39235 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359319 % of reads mapped to multiple loci | 2.61% Number of reads mapped to too many loci | 20521 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 5.14% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 747237 747237 747237 N_multimapping 359319 359319 359319 N_noFeature 455511 12463559 513022 N_ambiguous 266074 890 107847 UnstrandedReadsAssigned:11957278 PositiveStrandReadsAssigned:214414 NegativeStrandReadsAssigned:12057994 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=146 echo kmer=141 SRR7170472 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170472-trimmed-pair1.fastq SRR7170472-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,773,046 reads, 11,959,503 reads pseudoaligned [quant] estimated average fragment length: 270.202 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,142 rounds 52401 SRR7170472.ke.tsv 34699 SRR7170472.se.tsv 87100 total ==> SRR7170472.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.8 801 34.5026 Potri.005G024800.1.v4.1 1035 765.798 542 53.3143 Potri.004G059700.1.v4.1 961 691.809 6 0.653317 Potri.007G009000.2.v4.1 1416 1146.8 0 0 Potri.003G141000.2.v4.1 2943 2673.8 798.265 22.4894 Potri.016G087400.1.v4.1 270 75.5213 820.949 818.852 Potri.015G069301.1.v4.1 564 299.192 0 0 Potri.010G195200.1.v4.1 1773 1503.8 183 9.16686 Potri.012G127500.1.v4.1 977 707.809 125 13.3031 ==> SRR7170472.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 425 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 243 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 72 Potri.001G416900.v4.1 41 Potri.001G452600.v4.1 5 SRR7170472 completed mapping pipeline successfully