Starting /dee2/code/volunteer_pipeline.sh SRR7170473 current disk space = 3050486272000 free memory = 1579711804 SRR7170473 SRAfilesize f794553d772910b8844c6a1b656322fc SRR7170473.sra SRR7170473.sra file validated SRR7170473 is paired end SRR7170473 is conventional basespace SRR7170473 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170473_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.062 25.0 18.0 33.0 18.0 33.0 2 23.65625 25.0 18.0 29.0 18.0 33.0 3 27.91225 29.0 27.0 31.0 18.0 33.0 4 30.93875 31.0 30.0 33.0 29.0 33.0 5 32.17975 33.0 32.0 33.0 32.0 33.0 6 36.48425 38.0 36.0 38.0 34.0 38.0 7 37.02075 38.0 37.0 38.0 35.0 38.0 8 37.479 38.0 38.0 38.0 37.0 38.0 9 37.50225 38.0 38.0 38.0 37.0 38.0 10-14 37.638400000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.681349999999995 38.0 38.0 38.0 38.0 38.0 20-24 37.41115 38.0 38.0 38.0 37.2 38.0 25-29 36.8661 38.0 37.8 38.0 35.2 38.0 30-34 37.47625000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.57935 38.0 38.0 38.0 37.8 38.0 40-44 36.97315 38.0 37.8 38.0 35.4 38.0 45-49 34.97775 38.0 34.6 38.0 25.6 38.0 50-54 37.2856 38.0 37.8 38.0 36.4 38.0 55-59 37.4138 38.0 38.0 38.0 37.0 38.0 60-64 37.2922 38.0 38.0 38.0 36.4 38.0 65-69 37.18325 38.0 38.0 38.0 36.0 38.0 70-74 37.15945000000001 38.0 38.0 38.0 36.0 38.0 75-79 37.0977 38.0 38.0 38.0 36.0 38.0 80-84 36.9733 38.0 38.0 38.0 35.6 38.0 85-89 36.6896 38.0 38.0 38.0 34.8 38.0 90-94 36.4723 38.0 38.0 38.0 34.0 38.0 95-99 36.63825 38.0 38.0 38.0 34.4 38.0 100-104 36.6135 38.0 38.0 38.0 34.2 38.0 105-109 36.573350000000005 38.0 37.8 38.0 34.0 38.0 110-114 36.1082 38.0 37.0 38.0 32.8 38.0 115-119 35.61395 38.0 36.4 38.0 30.4 38.0 120-124 35.561499999999995 38.0 36.0 38.0 30.6 38.0 125-129 35.4187 38.0 36.0 38.0 30.6 38.0 130-134 35.1863 38.0 35.4 38.0 29.6 38.0 135-139 34.4922 38.0 33.8 38.0 26.8 38.0 140-144 29.232499999999998 33.4 23.4 37.0 17.0 38.0 145-149 26.043150000000004 31.4 15.8 37.6 4.2 38.0 150-151 16.310000000000002 8.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 3.0 16 2.0 17 0.0 18 1.0 19 4.0 20 4.0 21 3.0 22 3.0 23 5.0 24 10.0 25 6.0 26 9.0 27 19.0 28 17.0 29 44.0 30 57.0 31 82.0 32 123.0 33 186.0 34 390.0 35 749.0 36 1623.0 37 659.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.08259437547505 9.830250823410184 9.348872561439068 38.738282239675705 2 24.16208104052026 12.856428214107055 35.217608804402204 27.763881940970485 3 20.349999999999998 18.475 25.224999999999998 35.949999999999996 4 22.95 28.425 22.45 26.174999999999997 5 21.975 32.85 24.525 20.65 6 19.125 35.275 24.224999999999998 21.375 7 15.1 26.075 40.575 18.25 8 17.9 26.25 32.425 23.425 9 18.35 23.575 34.65 23.425 10-14 19.755 30.435000000000002 27.015 22.795 15-19 20.150000000000002 29.075 27.96 22.814999999999998 20-24 20.025000000000002 28.88 27.750000000000004 23.345 25-29 19.470000000000002 28.685 28.065 23.78 30-34 19.765 29.005 27.765 23.465 35-39 20.095 29.054999999999996 27.465 23.385 40-44 20.117011701170117 29.41794179417942 27.247724772477248 23.217321732173218 45-49 19.575 28.915000000000003 27.74 23.77 50-54 20.47 28.860000000000003 27.065 23.605 55-59 20.235 28.82 27.235 23.71 60-64 20.615 28.675 27.495000000000005 23.215 65-69 20.13 28.689999999999998 27.63 23.549999999999997 70-74 19.73493373343336 28.57214303575894 27.87696924231058 23.815953988497125 75-79 20.135 29.080000000000002 27.67 23.115 80-84 20.155 28.939999999999998 27.195000000000004 23.71 85-89 20.25202520252025 28.347834783478348 27.007700770077008 24.392439243924393 90-94 20.328131252501 27.951180472188874 27.906162464985997 23.81452581032413 95-99 20.611183355006503 28.37851355406622 27.353205961788536 23.65709712913874 100-104 20.04 28.87 27.235 23.855 105-109 20.1 28.544999999999998 27.71 23.645 110-114 20.41 28.134999999999998 27.73 23.724999999999998 115-119 20.525 28.27 27.145000000000003 24.060000000000002 120-124 20.895 27.955000000000002 26.875 24.275 125-129 20.23 28.16 27.589999999999996 24.02 130-134 20.91 27.97 27.665 23.455000000000002 135-139 21.59 27.79 27.065 23.555 140-144 20.625 27.98 27.445000000000004 23.95 145-149 20.345 28.749999999999996 26.650000000000002 24.255 150-151 21.25 28.1125 27.187499999999996 23.45 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 0.5 21 0.5 22 2.0 23 2.5 24 2.0 25 3.5 26 4.5 27 7.5 28 9.0 29 12.5 30 19.0 31 27.5 32 39.5 33 46.5 34 58.0 35 81.5 36 108.0 37 127.5 38 145.0 39 160.0 40 184.0 41 211.0 42 235.0 43 238.5 44 227.0 45 239.5 46 252.5 47 254.5 48 222.0 49 190.0 50 184.0 51 164.0 52 135.5 53 103.0 54 80.0 55 60.0 56 46.0 57 36.5 58 24.5 59 15.0 60 9.5 61 8.0 62 8.5 63 7.0 64 1.5 65 1.5 66 1.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.325 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.01 90-94 0.04 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3709109209864 98.725 2 0.6039255158530448 1.2 3 0.025163563160543533 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.175 0.0 0.0 0.0 0.0 84-85 0.2875 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.4875 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 1.0 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.75 0.0 0.0 0.0 0.0 108-109 2.0 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.4125 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.9625 0.0 0.0 0.0 0.0 118-119 3.175 0.0 0.0 0.0 0.0 120-121 3.3625 0.0 0.0 0.0 0.0 122-123 3.675 0.0 0.0 0.0 0.0 124-125 4.0 0.0 0.0 0.0 0.0 126-127 4.35 0.0 0.0 0.0 0.0 128-129 4.6125 0.0 0.0 0.0 0.0 130-131 5.05 0.0 0.0 0.0 0.0 132-133 5.3375 0.0 0.0 0.0 0.0 134-135 5.6125 0.0 0.0 0.0 0.0 136-137 5.800000000000001 0.0 0.0 0.0 0.0 138-139 5.9625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GATAATT 10 0.006832588 144.9875 9 >>END_MODULE SRR7170473 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170473_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0235 33.0 33.0 34.0 32.0 34.0 2 33.06425 34.0 33.0 34.0 32.0 34.0 3 33.0865 34.0 33.0 34.0 32.0 34.0 4 33.02525 34.0 33.0 34.0 32.0 34.0 5 33.07825 34.0 33.0 34.0 32.0 34.0 6 37.1145 38.0 38.0 38.0 37.0 38.0 7 37.27275 38.0 38.0 38.0 37.0 38.0 8 37.22675 38.0 38.0 38.0 37.0 38.0 9 37.24 38.0 38.0 38.0 37.0 38.0 10-14 36.48405 38.0 36.6 38.0 32.8 38.0 15-19 36.768600000000006 38.0 37.6 38.0 34.8 38.0 20-24 36.70934999999999 38.0 38.0 38.0 35.0 38.0 25-29 36.84135 38.0 38.0 38.0 35.6 38.0 30-34 37.051 38.0 38.0 38.0 36.4 38.0 35-39 37.044850000000004 38.0 38.0 38.0 36.4 38.0 40-44 37.034800000000004 38.0 38.0 38.0 36.0 38.0 45-49 35.849849999999996 38.0 35.8 38.0 30.6 38.0 50-54 36.0049 38.0 36.8 38.0 30.0 38.0 55-59 36.98755 38.0 38.0 38.0 36.0 38.0 60-64 36.78215 38.0 38.0 38.0 35.6 38.0 65-69 36.7466 38.0 38.0 38.0 35.4 38.0 70-74 36.6282 38.0 38.0 38.0 34.8 38.0 75-79 36.75115 38.0 38.0 38.0 35.0 38.0 80-84 36.693400000000004 38.0 38.0 38.0 35.0 38.0 85-89 36.618900000000004 38.0 38.0 38.0 34.6 38.0 90-94 36.540499999999994 38.0 38.0 38.0 34.0 38.0 95-99 36.39355 38.0 38.0 38.0 34.0 38.0 100-104 36.18415 38.0 37.8 38.0 33.8 38.0 105-109 35.915350000000004 38.0 37.0 38.0 32.6 38.0 110-114 36.017050000000005 38.0 37.0 38.0 33.0 38.0 115-119 35.734700000000004 38.0 37.0 38.0 32.0 38.0 120-124 35.264250000000004 38.0 36.0 38.0 29.6 38.0 125-129 34.6074 38.0 35.0 38.0 26.0 38.0 130-134 34.5284 38.0 34.8 38.0 27.0 38.0 135-139 33.7571 38.0 33.0 38.0 22.4 38.0 140-144 32.93514999999999 38.0 33.0 38.0 18.2 38.0 145-149 32.02235 38.0 33.0 38.0 10.8 38.0 150-151 25.979999999999997 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 2.0 4 2.0 5 2.0 6 0.0 7 2.0 8 0.0 9 1.0 10 0.0 11 0.0 12 1.0 13 2.0 14 1.0 15 2.0 16 5.0 17 5.0 18 5.0 19 5.0 20 7.0 21 11.0 22 9.0 23 13.0 24 12.0 25 8.0 26 23.0 27 28.0 28 35.0 29 37.0 30 58.0 31 73.0 32 115.0 33 129.0 34 196.0 35 359.0 36 841.0 37 2009.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.25 21.425 14.875 29.45 2 25.924999999999997 25.674999999999997 31.3 17.1 3 20.275000000000002 26.5 33.550000000000004 19.675 4 22.625 34.5 24.6 18.275 5 24.175 35.725 22.475 17.625 6 19.175 38.800000000000004 23.125 18.9 7 18.825 22.075 39.15 19.950000000000003 8 21.5 26.075 27.500000000000004 24.925 9 22.925 24.45 30.125 22.5 10-14 23.275000000000002 29.14 26.57 21.015 15-19 23.419999999999998 27.965 27.77 20.845 20-24 23.125 28.16 27.83 20.885 25-29 22.97 28.48 27.644999999999996 20.905 30-34 22.98 28.13 28.12 20.77 35-39 23.125 28.74 27.025 21.11 40-44 23.09 28.26 27.415 21.235 45-49 22.775000000000002 28.075 27.765 21.385 50-54 23.369999999999997 27.860000000000003 27.66 21.11 55-59 23.080000000000002 27.805000000000003 28.025 21.09 60-64 23.505000000000003 27.615000000000002 28.09 20.79 65-69 23.41 27.634999999999998 27.68 21.275 70-74 23.78 27.845 27.534999999999997 20.84 75-79 22.805 27.775 27.88 21.54 80-84 23.565 28.189999999999998 27.139999999999997 21.105 85-89 23.14 27.495000000000005 28.439999999999998 20.925 90-94 23.74 27.884999999999998 27.54 20.835 95-99 23.28 27.950000000000003 27.584999999999997 21.185000000000002 100-104 24.015 27.584999999999997 27.6 20.8 105-109 23.69 27.73 28.18 20.4 110-114 24.015 27.750000000000004 28.02 20.215 115-119 23.73 28.005000000000003 27.61 20.655 120-124 23.96 28.53 27.11 20.4 125-129 24.465 27.97 27.38 20.185 130-134 24.735 27.675 27.105 20.485 135-139 24.455 27.715 27.74 20.09 140-144 24.27 27.905 26.97 20.855 145-149 24.945 27.644999999999996 27.27 20.14 150-151 24.325 28.1625 26.75 20.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.5 23 1.0 24 2.0 25 2.5 26 2.0 27 4.0 28 7.0 29 8.5 30 13.0 31 21.0 32 27.0 33 35.0 34 47.5 35 68.0 36 87.5 37 97.5 38 127.0 39 160.0 40 191.5 41 235.0 42 247.0 43 254.5 44 278.5 45 285.5 46 275.5 47 265.0 48 235.5 49 198.0 50 173.5 51 146.5 52 114.0 53 90.0 54 74.5 55 53.5 56 43.5 57 34.5 58 25.0 59 22.5 60 17.5 61 12.0 62 8.0 63 4.5 64 1.5 65 0.0 66 0.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.4206549118388 98.675 2 0.4785894206549119 0.95 3 0.07556675062972291 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.025188916876574305 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.025 0.0 50-51 0.0 0.0 0.0 0.025 0.0 52-53 0.0 0.0 0.0 0.025 0.0 54-55 0.0 0.0 0.0 0.025 0.0 56-57 0.0 0.0 0.0 0.025 0.0 58-59 0.0 0.0 0.0 0.025 0.0 60-61 0.0 0.0 0.0 0.025 0.0 62-63 0.0 0.0 0.0 0.025 0.0 64-65 0.0 0.0 0.0 0.025 0.0 66-67 0.0 0.0 0.0 0.025 0.0 68-69 0.0 0.0 0.0 0.025 0.0 70-71 0.0125 0.0 0.0 0.025 0.0 72-73 0.037500000000000006 0.0 0.0 0.025 0.0 74-75 0.07500000000000001 0.0 0.0 0.025 0.0 76-77 0.1 0.0 0.0 0.025 0.0 78-79 0.1 0.0 0.0 0.025 0.0 80-81 0.125 0.0 0.0 0.025 0.0 82-83 0.2 0.0 0.0 0.025 0.0 84-85 0.3125 0.0 0.0 0.025 0.0 86-87 0.475 0.0 0.0 0.025 0.0 88-89 0.5125 0.0 0.0 0.025 0.0 90-91 0.5874999999999999 0.0 0.0 0.025 0.0 92-93 0.6625 0.0 0.0 0.025 0.0 94-95 0.825 0.0 0.0 0.025 0.0 96-97 0.9 0.0 0.0 0.025 0.0 98-99 1.025 0.0 0.0 0.025 0.0 100-101 1.15 0.0 0.0 0.025 0.0 102-103 1.2875 0.0 0.0 0.025 0.0 104-105 1.5375 0.0 0.0 0.025 0.0 106-107 1.775 0.0 0.0 0.025 0.0 108-109 2.0250000000000004 0.0 0.0 0.025 0.0 110-111 2.1875 0.0 0.0 0.025 0.0 112-113 2.4375 0.0 0.0 0.025 0.0 114-115 2.675 0.0 0.0 0.025 0.0 116-117 2.9875 0.0 0.0 0.025 0.0 118-119 3.2125 0.0 0.0 0.025 0.0 120-121 3.4124999999999996 0.0 0.0 0.025 0.0 122-123 3.725 0.0 0.0 0.025 0.0 124-125 4.050000000000001 0.0 0.0 0.025 0.0 126-127 4.4 0.0 0.0 0.025 0.0 128-129 4.6625 0.0 0.0 0.025 0.0 130-131 5.125 0.0 0.0 0.025 0.0 132-133 5.449999999999999 0.0 0.0 0.025 0.0 134-135 5.775 0.0 0.0 0.025 0.0 136-137 6.0625 0.0 0.0 0.025 0.0 138-139 6.325 0.0 0.0 0.025 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra Read 724739 spots for SRR7170473.sra Written 724739 spots for SRR7170473.sra Read 724722 spots for SRR7170473.sra Written 724722 spots for SRR7170473.sra SRR ids: ['SRR7170473.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_86d9h9_u SRR7170473.sra spots: 14494457 blocks: [[1, 724722], [724723, 1449444], [1449445, 2174166], [2174167, 2898888], [2898889, 3623610], [3623611, 4348332], [4348333, 5073054], [5073055, 5797776], [5797777, 6522498], [6522499, 7247220], [7247221, 7971942], [7971943, 8696664], [8696665, 9421386], [9421387, 10146108], [10146109, 10870830], [10870831, 11595552], [11595553, 12320274], [12320275, 13044996], [13044997, 13769718], [13769719, 14494457]] SRR7170473 file size 4889995 SRR7170473 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170473 SRR7170473_1.fastq SRR7170473_2.fastq Input file: SRR7170473_1.fastq Paired file: SRR7170473_2.fastq trimmed: SRR7170473-trimmed-pair1.fastq, SRR7170473-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:43:14 2025 >> started Wed Feb 12 22:43:29 2025 >> done (15.487s) 14494457 read pairs processed; of these: 7932 ( 0.05%) short read pairs filtered out after trimming by size control 9617 ( 0.07%) empty read pairs filtered out after trimming by size control 14476908 (99.88%) read pairs available; of these: 8159182 (56.36%) trimmed read pairs available after processing 6317726 (43.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 3 0.00% 24 5 0.00% 25 0 0.00% 26 2 0.00% 27 7 0.00% 28 3 0.00% 29 1 0.00% 30 4 0.00% 31 9 0.00% 32 10 0.00% 33 5 0.00% 34 6 0.00% 35 9 0.00% 36 12 0.00% 37 15 0.00% 38 12 0.00% 39 20 0.00% 40 22 0.00% 41 29 0.00% 42 26 0.00% 43 30 0.00% 44 38 0.00% 45 43 0.00% 46 46 0.00% 47 59 0.00% 48 76 0.00% 49 84 0.00% 50 92 0.00% 51 93 0.00% 52 125 0.00% 53 127 0.00% 54 153 0.00% 55 160 0.00% 56 208 0.00% 57 223 0.00% 58 233 0.00% 59 282 0.00% 60 337 0.00% 61 401 0.00% 62 460 0.00% 63 513 0.00% 64 548 0.00% 65 580 0.00% 66 609 0.00% 67 697 0.00% 68 801 0.01% 69 907 0.01% 70 1065 0.01% 71 1209 0.01% 72 1364 0.01% 73 1572 0.01% 74 1716 0.01% 75 1846 0.01% 76 2157 0.01% 77 2370 0.02% 78 2496 0.02% 79 2807 0.02% 80 2946 0.02% 81 3423 0.02% 82 3837 0.03% 83 4286 0.03% 84 5014 0.03% 85 5662 0.04% 86 6033 0.04% 87 6423 0.04% 88 6810 0.05% 89 7177 0.05% 90 7657 0.05% 91 8271 0.06% 92 8823 0.06% 93 9617 0.07% 94 10365 0.07% 95 10980 0.08% 96 11498 0.08% 97 11986 0.08% 98 12117 0.08% 99 12755 0.09% 100 13550 0.09% 101 13888 0.10% 102 14525 0.10% 103 15276 0.11% 104 15682 0.11% 105 16900 0.12% 106 17258 0.12% 107 17652 0.12% 108 18165 0.13% 109 18575 0.13% 110 19264 0.13% 111 19455 0.13% 112 20495 0.14% 113 20697 0.14% 114 21616 0.15% 115 22868 0.16% 116 23316 0.16% 117 24116 0.17% 118 24740 0.17% 119 25004 0.17% 120 25659 0.18% 121 26713 0.18% 122 27215 0.19% 123 27950 0.19% 124 29371 0.20% 125 30710 0.21% 126 31880 0.22% 127 33482 0.23% 128 34649 0.24% 129 35834 0.25% 130 37969 0.26% 131 39615 0.27% 132 41722 0.29% 133 44508 0.31% 134 47440 0.33% 135 50824 0.35% 136 55143 0.38% 137 60022 0.41% 138 65343 0.45% 139 72064 0.50% 140 79885 0.55% 141 90271 0.62% 142 103756 0.72% 143 121881 0.84% 144 147198 1.02% 145 181403 1.25% 146 237019 1.64% 147 327335 2.26% 148 513691 3.55% 149 1016166 7.02% 150 3957003 27.33% 151 6317726 43.64% 14476908 reads passed initial QC criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.25 fanout-score-rank=11 prefix-density=0.74 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=21 fanout-score=32.46 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=5.9 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.56 prefix-fanout=2.0 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.13 sequence-density-rank=25 fanout-score=20.60 fanout-score-rank=1 prefix-density=0.55 prefix-fanout=4.9 sequence=AATGGCAGCCTCAGTTATGGCTTCACTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCT SRR7170473 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:44:15 Started mapping on | Feb 12 22:44:15 Finished on | Feb 12 22:46:13 Mapping speed, Million of reads per hour | 441.67 Number of input reads | 14476908 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13533464 Uniquely mapped reads % | 93.48% Average mapped length | 293.39 Number of splices: Total | 13185319 Number of splices: Annotated (sjdb) | 12908394 Number of splices: GT/AG | 12931366 Number of splices: GC/AG | 212035 Number of splices: AT/AC | 7455 Number of splices: Non-canonical | 34463 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 368173 % of reads mapped to multiple loci | 2.54% Number of reads mapped to too many loci | 30711 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.70% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 583090 583090 583090 N_multimapping 368173 368173 368173 N_noFeature 420679 13290138 491541 N_ambiguous 271167 921 98187 UnstrandedReadsAssigned:12841618 PositiveStrandReadsAssigned:242405 NegativeStrandReadsAssigned:12943736 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170473 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170473-trimmed-pair1.fastq SRR7170473-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,476,908 reads, 12,902,517 reads pseudoaligned [quant] estimated average fragment length: 274.778 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,111 rounds 52401 SRR7170473.ke.tsv 34699 SRR7170473.se.tsv 87100 total ==> SRR7170473.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.22 307 11.7206 Potri.005G024800.1.v4.1 1035 761.222 195 17.0584 Potri.004G059700.1.v4.1 961 687.253 22 2.13167 Potri.007G009000.2.v4.1 1416 1142.22 1 0.0582994 Potri.003G141000.2.v4.1 2943 2669.22 494 12.3241 Potri.016G087400.1.v4.1 270 78.7245 644 544.741 Potri.015G069301.1.v4.1 564 296.433 0 0 Potri.010G195200.1.v4.1 1773 1499.22 7 0.310918 Potri.012G127500.1.v4.1 977 703.238 157 14.8666 ==> SRR7170473.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 896 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 255 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 3 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 171 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170473 completed mapping pipeline successfully