Starting /dee2/code/volunteer_pipeline.sh SRR7170474 current disk space = 3050471165952 free memory = 1579695080 SRR7170474 SRAfilesize 024f7b56d2bb25d8738801539f9ba934 SRR7170474.sra SRR7170474.sra file validated SRR7170474 is paired end SRR7170474 is conventional basespace SRR7170474 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170474_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.45125 27.0 18.0 33.0 18.0 33.0 2 28.29875 29.0 27.0 31.0 18.0 33.0 3 31.50275 33.0 31.0 33.0 29.0 33.0 4 32.25375 33.0 33.0 33.0 31.0 33.0 5 32.6455 33.0 33.0 33.0 31.0 34.0 6 37.05225 38.0 37.0 38.0 36.0 38.0 7 37.37075 38.0 38.0 38.0 37.0 38.0 8 37.53225 38.0 38.0 38.0 37.0 38.0 9 37.5995 38.0 38.0 38.0 38.0 38.0 10-14 37.53625 38.0 38.0 38.0 37.2 38.0 15-19 37.49250000000001 38.0 38.0 38.0 37.6 38.0 20-24 37.4958 38.0 38.0 38.0 37.4 38.0 25-29 37.189049999999995 38.0 38.0 38.0 36.2 38.0 30-34 37.4331 38.0 38.0 38.0 37.0 38.0 35-39 37.4238 38.0 38.0 38.0 37.0 38.0 40-44 37.02285 38.0 37.8 38.0 35.2 38.0 45-49 36.78455 38.0 38.0 38.0 34.4 38.0 50-54 36.65115 38.0 37.8 38.0 34.2 38.0 55-59 37.02395 38.0 38.0 38.0 36.0 38.0 60-64 36.988550000000004 38.0 38.0 38.0 36.0 38.0 65-69 36.967 38.0 38.0 38.0 35.8 38.0 70-74 36.7517 38.0 38.0 38.0 34.8 38.0 75-79 36.685249999999996 38.0 38.0 38.0 34.6 38.0 80-84 36.574799999999996 38.0 38.0 38.0 34.4 38.0 85-89 36.20385 38.0 37.2 38.0 33.6 38.0 90-94 36.15425 38.0 37.0 38.0 33.0 38.0 95-99 36.1836 38.0 37.0 38.0 33.2 38.0 100-104 36.0475 38.0 37.0 38.0 33.2 38.0 105-109 35.8728 38.0 37.0 38.0 31.8 38.0 110-114 35.634049999999995 38.0 36.6 38.0 30.8 38.0 115-119 35.29005 38.0 36.0 38.0 28.8 38.0 120-124 35.186699999999995 38.0 35.8 38.0 28.6 38.0 125-129 34.94355 38.0 35.4 38.0 28.2 38.0 130-134 34.47745 38.0 34.8 38.0 26.0 38.0 135-139 34.0424 38.0 34.0 38.0 24.2 38.0 140-144 33.41315 38.0 33.4 38.0 20.6 38.0 145-149 32.394549999999995 38.0 32.4 38.0 16.2 38.0 150-151 25.424875 30.5 16.5 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 1.0 11 0.0 12 1.0 13 2.0 14 4.0 15 2.0 16 0.0 17 3.0 18 4.0 19 9.0 20 3.0 21 4.0 22 4.0 23 4.0 24 11.0 25 12.0 26 23.0 27 17.0 28 17.0 29 35.0 30 59.0 31 51.0 32 98.0 33 159.0 34 249.0 35 443.0 36 1206.0 37 1578.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.29190971341618 10.246005579507989 10.14455997971088 36.317524727364955 2 22.13053263315829 14.253563390847713 32.58314578644661 31.032758189547387 3 19.45 19.425 26.200000000000003 34.925 4 21.375 26.974999999999998 23.549999999999997 28.1 5 22.725 31.225 25.05 21.0 6 18.275 35.099999999999994 25.7 20.925 7 15.475 27.725 40.050000000000004 16.75 8 17.125 26.950000000000003 29.925 26.0 9 16.675 26.0 33.75 23.575 10-14 18.57 31.435000000000002 26.825 23.169999999999998 15-19 19.189999999999998 29.654999999999998 27.515 23.64 20-24 19.125 29.854999999999997 27.375 23.645 25-29 19.075 30.404999999999998 27.045 23.474999999999998 30-34 19.220000000000002 29.880000000000003 27.48 23.419999999999998 35-39 19.18 30.055 26.71 24.055 40-44 20.07100355017751 29.26146307315366 26.911345567278367 23.756187809390468 45-49 19.16 29.235 27.355 24.25 50-54 19.155 29.94 27.36 23.544999999999998 55-59 19.345000000000002 29.759999999999998 26.705000000000002 24.19 60-64 19.52 29.12 27.229999999999997 24.13 65-69 19.575 29.2 27.355 23.87 70-74 19.575 29.349999999999998 27.415 23.66 75-79 20.055 28.895 27.334999999999997 23.715 80-84 19.925 28.51 27.625 23.94 85-89 19.28 29.445 27.38 23.895 90-94 19.715985799289964 29.011450572528624 27.35136756837842 23.92119605980299 95-99 19.88 28.689999999999998 27.115000000000002 24.315 100-104 20.36 29.585 26.974999999999998 23.080000000000002 105-109 20.635 28.625 27.0 23.74 110-114 19.830000000000002 28.544999999999998 27.63 23.995 115-119 20.794999999999998 28.555000000000003 26.825 23.825 120-124 20.025000000000002 28.935 26.490000000000002 24.55 125-129 20.695 28.595 26.795 23.915 130-134 20.61 28.74 26.674999999999997 23.974999999999998 135-139 21.015 27.785 26.875 24.325 140-144 21.154999999999998 27.96 27.01 23.875 145-149 20.36 27.439999999999998 27.22 24.98 150-151 21.075 27.287499999999998 26.887499999999996 24.75 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 0.5 20 1.0 21 2.5 22 4.0 23 3.5 24 3.0 25 8.5 26 9.0 27 7.5 28 11.0 29 20.0 30 32.5 31 44.0 32 51.0 33 58.0 34 78.0 35 95.0 36 118.5 37 134.5 38 156.5 39 169.5 40 177.0 41 212.0 42 218.5 43 219.0 44 225.5 45 225.0 46 223.5 47 215.0 48 198.0 49 182.5 50 162.5 51 142.0 52 121.0 53 95.5 54 86.0 55 75.5 56 53.0 57 41.0 58 37.5 59 24.0 60 12.0 61 10.5 62 14.0 63 9.5 64 3.0 65 3.0 66 1.5 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.425 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.3 #Duplication Level Percentage of deduplicated Percentage of total 1 98.72838250254323 97.05 2 1.093591047812818 2.15 3 0.0762970498474059 0.22499999999999998 4 0.025432349949135298 0.1 5 0.025432349949135298 0.125 6 0.025432349949135298 0.15 7 0.0 0.0 8 0.025432349949135298 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCTCGCGCATCTCGTAT 8 0.2 TruSeq Adapter, Index 8 (97% over 36bp) CACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACACA 6 0.15 No Hit CCACACCAGAGGCCACAGACATGGCCAATACATAACAATGAAGAAGACAC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.7875 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.55 0.0 0.0 0.0 0.0 104-105 1.775 0.0 0.0 0.0 0.0 106-107 1.975 0.0 0.0 0.0 0.0 108-109 2.1875 0.0 0.0 0.0 0.0 110-111 2.475 0.0 0.0 0.0 0.0 112-113 2.8875 0.0 0.0 0.0 0.0 114-115 3.05 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.725 0.0 0.0 0.0 0.0 120-121 4.1625 0.0 0.0 0.0 0.0 122-123 4.575 0.0 0.0 0.0 0.0 124-125 4.85 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.55 0.0 0.0 0.0 0.0 130-131 5.949999999999999 0.0 0.0 0.0 0.0 132-133 6.4125 0.0 0.0 0.0 0.0 134-135 6.75 0.0 0.0 0.0 0.0 136-137 7.0375 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTTACAT 10 0.006830828 145.0 5 TCAAGAA 20 0.00593511 29.0 115-119 >>END_MODULE SRR7170474 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170474_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.55675 33.0 33.0 34.0 32.0 34.0 2 32.7405 33.0 33.0 34.0 32.0 34.0 3 31.62325 33.0 33.0 34.0 27.0 34.0 4 32.2715 33.0 33.0 34.0 30.0 34.0 5 32.61575 33.0 33.0 34.0 32.0 34.0 6 36.894 38.0 38.0 38.0 36.0 38.0 7 36.66225 38.0 38.0 38.0 35.0 38.0 8 36.88675 38.0 38.0 38.0 36.0 38.0 9 36.859 38.0 38.0 38.0 36.0 38.0 10-14 36.860850000000006 38.0 38.0 38.0 36.0 38.0 15-19 36.7767 38.0 38.0 38.0 36.0 38.0 20-24 36.166450000000005 38.0 37.8 38.0 32.8 38.0 25-29 36.2178 38.0 37.8 38.0 31.6 38.0 30-34 36.6001 38.0 38.0 38.0 35.4 38.0 35-39 36.755849999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.19685 38.0 37.8 38.0 33.4 38.0 45-49 36.609500000000004 38.0 38.0 38.0 35.8 38.0 50-54 36.57315 38.0 38.0 38.0 35.6 38.0 55-59 35.87814999999999 38.0 37.6 38.0 29.8 38.0 60-64 35.38035 38.0 37.0 38.0 27.6 38.0 65-69 35.8283 38.0 37.6 38.0 30.4 38.0 70-74 35.48855 38.0 36.6 38.0 30.4 38.0 75-79 35.44625 38.0 36.6 38.0 29.2 38.0 80-84 36.1955 38.0 38.0 38.0 34.0 38.0 85-89 36.07855 38.0 38.0 38.0 34.0 38.0 90-94 36.02235 38.0 38.0 38.0 34.0 38.0 95-99 35.8175 38.0 37.6 38.0 33.4 38.0 100-104 35.588649999999994 38.0 37.0 38.0 31.4 38.0 105-109 35.47565 38.0 37.0 38.0 31.4 38.0 110-114 35.2236 38.0 36.6 38.0 30.0 38.0 115-119 34.9473 38.0 36.0 38.0 28.8 38.0 120-124 34.71925 38.0 36.0 38.0 27.4 38.0 125-129 34.21535 38.0 34.6 38.0 24.8 38.0 130-134 33.9736 38.0 33.8 38.0 23.6 38.0 135-139 33.136900000000004 38.0 33.0 38.0 19.2 38.0 140-144 32.0879 38.0 31.8 38.0 13.0 38.0 145-149 31.1834 38.0 31.2 38.0 6.0 38.0 150-151 25.737625 33.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 21.0 3 10.0 4 8.0 5 0.0 6 4.0 7 5.0 8 4.0 9 2.0 10 1.0 11 3.0 12 3.0 13 5.0 14 3.0 15 6.0 16 7.0 17 6.0 18 9.0 19 8.0 20 5.0 21 12.0 22 10.0 23 15.0 24 12.0 25 19.0 26 16.0 27 22.0 28 27.0 29 30.0 30 47.0 31 76.0 32 97.0 33 153.0 34 250.0 35 377.0 36 946.0 37 1781.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.8 21.75 17.125 24.325 2 27.150000000000002 24.725 28.675 19.45 3 21.675 27.450000000000003 31.900000000000002 18.975 4 24.6 33.5 22.825 19.075 5 26.650000000000002 34.075 21.65 17.625 6 21.2 37.55 23.325000000000003 17.925 7 21.275 22.8 36.425000000000004 19.5 8 23.3 25.55 27.200000000000003 23.95 9 22.1 25.75 28.549999999999997 23.599999999999998 10-14 24.975 28.24 26.040000000000003 20.745 15-19 23.880000000000003 28.144999999999996 27.384999999999998 20.59 20-24 24.38 28.165000000000003 27.034999999999997 20.419999999999998 25-29 24.515 27.865000000000002 27.284999999999997 20.335 30-34 24.055 28.1 27.35 20.495 35-39 23.580000000000002 28.634999999999998 27.315 20.47 40-44 23.5 28.544999999999998 27.07 20.885 45-49 23.775 28.625 27.150000000000002 20.45 50-54 24.665 27.625 27.21 20.5 55-59 23.895 27.810000000000002 27.465 20.830000000000002 60-64 24.47 27.529999999999998 27.445000000000004 20.555 65-69 24.315 27.334999999999997 27.79 20.560000000000002 70-74 23.474999999999998 28.065 27.650000000000002 20.810000000000002 75-79 23.95 28.13 27.334999999999997 20.585 80-84 24.395 27.865000000000002 27.075 20.665 85-89 23.830000000000002 27.42 27.57 21.18 90-94 24.91 27.845 26.895000000000003 20.349999999999998 95-99 24.349999999999998 27.400000000000002 27.800000000000004 20.45 100-104 24.665 27.83 26.924999999999997 20.580000000000002 105-109 24.255 27.66 27.639999999999997 20.445 110-114 25.05 27.810000000000002 27.325 19.814999999999998 115-119 24.545 27.925 27.91 19.62 120-124 24.745 28.24 26.86 20.155 125-129 25.245 27.985 26.895000000000003 19.875 130-134 25.525 27.925 27.065 19.485 135-139 25.155 26.919999999999998 27.529999999999998 20.395 140-144 25.77 27.62 27.63 18.98 145-149 26.31 27.215 26.935 19.54 150-151 25.8625 27.6625 28.050000000000004 18.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.5 4 0.5 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 0.5 18 0.0 19 1.0 20 1.5 21 0.5 22 0.5 23 2.0 24 3.0 25 3.0 26 2.5 27 4.5 28 7.0 29 7.0 30 10.5 31 15.5 32 21.5 33 25.5 34 33.5 35 48.5 36 66.5 37 100.0 38 133.5 39 148.5 40 171.5 41 205.5 42 241.5 43 266.0 44 276.5 45 279.0 46 274.5 47 258.0 48 232.0 49 214.0 50 187.5 51 154.0 52 129.0 53 106.0 54 86.5 55 70.5 56 51.5 57 45.0 58 32.5 59 22.0 60 18.5 61 9.0 62 7.0 63 7.5 64 5.5 65 2.0 66 2.0 67 1.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 1.0 77 0.5 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.5 85 0.5 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.225 #Duplication Level Percentage of deduplicated Percentage of total 1 98.88012216849071 97.125 2 0.8908119114278442 1.7500000000000002 3 0.12725884448969205 0.375 4 0.0 0.0 5 0.0 0.0 6 0.050903537795876815 0.3 7 0.0 0.0 8 0.025451768897938407 0.2 9 0.0 0.0 >10 0.025451768897938407 0.25 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTGTCAGTACGTGTAGATCT 10 0.25 Illumina Single End PCR Primer 1 (96% over 32bp) AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 8 0.2 No Hit GTTTGATCATGGCTCAGATTGAACGCTGGCGGCAGGCCTAACACATGCAA 6 0.15 No Hit CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.0625 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.1875 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.325 0.0 0.0 0.0 0.0 86-87 0.44999999999999996 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.5375000000000001 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.8375 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.2 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.825 0.0 0.0 0.0 0.0 106-107 2.075 0.0 0.0 0.0 0.0 108-109 2.3375 0.0 0.0 0.0 0.0 110-111 2.6125 0.0 0.0 0.0 0.0 112-113 3.0125 0.0 0.0 0.0 0.0 114-115 3.175 0.0 0.0 0.0 0.0 116-117 3.5875 0.0 0.0 0.0 0.0 118-119 3.8375000000000004 0.0 0.0 0.0 0.0 120-121 4.25 0.0 0.0 0.0 0.0 122-123 4.625 0.0 0.0 0.0 0.0 124-125 4.925 0.0 0.0 0.0 0.0 126-127 5.4 0.0 0.0 0.0 0.0 128-129 5.625 0.0 0.0 0.0 0.0 130-131 6.025 0.0 0.0 0.0 0.0 132-133 6.5 0.0 0.0 0.0 0.0 134-135 6.775 0.0 0.0 0.0 0.0 136-137 7.050000000000001 0.0 0.0 0.0 0.0 138-139 7.375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGCAAAT 10 0.006830828 145.0 2 >>END_MODULE Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356475 spots for SRR7170474.sra Written 356475 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra Read 356465 spots for SRR7170474.sra Written 356465 spots for SRR7170474.sra SRR ids: ['SRR7170474.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qfby459u SRR7170474.sra spots: 7129310 blocks: [[1, 356465], [356466, 712930], [712931, 1069395], [1069396, 1425860], [1425861, 1782325], [1782326, 2138790], [2138791, 2495255], [2495256, 2851720], [2851721, 3208185], [3208186, 3564650], [3564651, 3921115], [3921116, 4277580], [4277581, 4634045], [4634046, 4990510], [4990511, 5346975], [5346976, 5703440], [5703441, 6059905], [6059906, 6416370], [6416371, 6772835], [6772836, 7129310]] SRR7170474 file size 2399795 SRR7170474 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170474 SRR7170474_1.fastq SRR7170474_2.fastq Input file: SRR7170474_1.fastq Paired file: SRR7170474_2.fastq trimmed: SRR7170474-trimmed-pair1.fastq, SRR7170474-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:41:00 2025 >> started Wed Feb 12 22:41:11 2025 >> done (10.663s) 7129310 read pairs processed; of these: 19222 ( 0.27%) short read pairs filtered out after trimming by size control 36260 ( 0.51%) empty read pairs filtered out after trimming by size control 7073828 (99.22%) read pairs available; of these: 3979407 (56.26%) trimmed read pairs available after processing 3094421 (43.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 2 0.00% 24 3 0.00% 25 4 0.00% 26 0 0.00% 27 4 0.00% 28 3 0.00% 29 3 0.00% 30 6 0.00% 31 12 0.00% 32 10 0.00% 33 7 0.00% 34 11 0.00% 35 15 0.00% 36 16 0.00% 37 15 0.00% 38 19 0.00% 39 13 0.00% 40 16 0.00% 41 25 0.00% 42 36 0.00% 43 37 0.00% 44 38 0.00% 45 32 0.00% 46 46 0.00% 47 66 0.00% 48 57 0.00% 49 84 0.00% 50 78 0.00% 51 106 0.00% 52 121 0.00% 53 118 0.00% 54 123 0.00% 55 136 0.00% 56 144 0.00% 57 168 0.00% 58 204 0.00% 59 256 0.00% 60 329 0.00% 61 345 0.00% 62 374 0.01% 63 371 0.01% 64 417 0.01% 65 514 0.01% 66 497 0.01% 67 543 0.01% 68 618 0.01% 69 711 0.01% 70 898 0.01% 71 930 0.01% 72 1094 0.02% 73 1236 0.02% 74 1341 0.02% 75 1604 0.02% 76 2207 0.03% 77 2430 0.03% 78 2041 0.03% 79 2038 0.03% 80 2299 0.03% 81 2586 0.04% 82 2934 0.04% 83 3291 0.05% 84 4313 0.06% 85 4956 0.07% 86 5075 0.07% 87 5341 0.08% 88 5523 0.08% 89 5883 0.08% 90 5934 0.08% 91 6314 0.09% 92 6553 0.09% 93 7074 0.10% 94 7438 0.11% 95 8061 0.11% 96 8198 0.12% 97 8518 0.12% 98 8573 0.12% 99 8812 0.12% 100 9292 0.13% 101 9280 0.13% 102 9622 0.14% 103 10329 0.15% 104 10851 0.15% 105 11148 0.16% 106 11513 0.16% 107 11755 0.17% 108 11971 0.17% 109 12358 0.17% 110 12578 0.18% 111 12761 0.18% 112 13122 0.19% 113 13905 0.20% 114 14061 0.20% 115 14689 0.21% 116 15248 0.22% 117 15325 0.22% 118 15688 0.22% 119 15847 0.22% 120 15833 0.22% 121 16270 0.23% 122 17045 0.24% 123 17653 0.25% 124 17931 0.25% 125 18405 0.26% 126 19244 0.27% 127 19862 0.28% 128 20605 0.29% 129 21068 0.30% 130 21624 0.31% 131 22330 0.32% 132 23427 0.33% 133 24840 0.35% 134 26038 0.37% 135 27843 0.39% 136 29369 0.42% 137 32228 0.46% 138 34046 0.48% 139 36970 0.52% 140 40367 0.57% 141 44783 0.63% 142 50308 0.71% 143 58025 0.82% 144 69453 0.98% 145 85343 1.21% 146 108080 1.53% 147 149183 2.11% 148 230324 3.26% 149 454741 6.43% 150 1834564 25.93% 151 3094421 43.74% 7073828 reads passed initial QC criterion=sequence-density sequence-density=0.27 sequence-density-rank=1 fanout-score=6.08 fanout-score-rank=14 prefix-density=0.33 prefix-fanout=5.0 sequence=TGTAAACAAGAAGTGCACCTCC criterion=fanout-score sequence-density=0.01 sequence-density-rank=47 fanout-score=64.10 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=3.2 sequence=CAGATTTCAAGTGCATGGATTAAGGTTAATCGCCCGGTAACACCTTGAAATATCTCAATGAGATGTACAGTGCATTTAGATTATGAGTAGGGAACATCAAGAAAAGTAAAATCACAGAGAAGGAGCTCTCTCAGCAGAACCAGCAATGACAGTGAGCAAGTTGTTGCCAAAAGGATCGCTGAGATGTTTTGCGAGGTTCTCCACGGGACCTTCTCCAGTAACATAAGCTTGGAAGAAGAAACCCAGCATGGCAAACATTGCAAGTCTACCATTCTTAATCTCCTTCACCTT criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=2.72 fanout-score-rank=32 prefix-density=0.43 prefix-fanout=2.3 sequence=GCTGACGAGTGGCGGACGGGTGAGTAATGTCTGGGAAACTGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCAAAGAGGGGGACCTTCGGGCCTCTTGCCATCGGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAACGGCTCACCTAGGCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=73.03 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=5.4 sequence=AGCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTC SRR7170474 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:41:55 Started mapping on | Feb 12 22:41:55 Finished on | Feb 12 22:42:51 Mapping speed, Million of reads per hour | 454.75 Number of input reads | 7073828 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 6430224 Uniquely mapped reads % | 90.90% Average mapped length | 291.69 Number of splices: Total | 5707661 Number of splices: Annotated (sjdb) | 5577627 Number of splices: GT/AG | 5600770 Number of splices: GC/AG | 84275 Number of splices: AT/AC | 4901 Number of splices: Non-canonical | 17715 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.03 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 177041 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 16621 % of reads mapped to too many loci | 0.23% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.02% % of reads unmapped: other | 0.34% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 479308 479308 479308 N_multimapping 177041 177041 177041 N_noFeature 158343 6271440 193356 N_ambiguous 178818 395 54870 UnstrandedReadsAssigned:6093063 PositiveStrandReadsAssigned:158389 NegativeStrandReadsAssigned:6181998 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170474 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170474-trimmed-pair1.fastq SRR7170474-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,073,828 reads, 6,175,809 reads pseudoaligned [quant] estimated average fragment length: 246.577 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,134 rounds 52401 SRR7170474.ke.tsv 34699 SRR7170474.se.tsv 87100 total ==> SRR7170474.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1772.42 132 8.18709 Potri.005G024800.1.v4.1 1035 789.423 78 10.8619 Potri.004G059700.1.v4.1 961 715.429 3 0.460975 Potri.007G009000.2.v4.1 1416 1170.42 0 0 Potri.003G141000.2.v4.1 2943 2697.42 190.255 7.75373 Potri.016G087400.1.v4.1 270 80.3812 457 625.007 Potri.015G069301.1.v4.1 564 320.993 0 0 Potri.010G195200.1.v4.1 1773 1527.42 8 0.575776 Potri.012G127500.1.v4.1 977 731.429 344 51.7022 ==> SRR7170474.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 136 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 241 Potri.001G212900.v4.1 33 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 129 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170474 completed mapping pipeline successfully