Starting /dee2/code/volunteer_pipeline.sh SRR7170475 current disk space = 3050459492352 free memory = 1572772084 SRR7170475 SRAfilesize fa85e7eb9d6f0b679215aa1f46f96079 SRR7170475.sra SRR7170475.sra file validated SRR7170475 is paired end SRR7170475 is conventional basespace SRR7170475 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170475_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.282 25.0 18.0 33.0 18.0 33.0 2 23.105 18.0 18.0 29.0 18.0 33.0 3 28.63675 29.0 27.0 31.0 25.0 33.0 4 30.88475 31.0 30.0 33.0 28.0 33.0 5 32.3225 33.0 32.0 33.0 32.0 33.0 6 36.669 38.0 37.0 38.0 34.0 38.0 7 37.19575 38.0 38.0 38.0 36.0 38.0 8 37.48975 38.0 38.0 38.0 37.0 38.0 9 37.26875 38.0 38.0 38.0 36.0 38.0 10-14 37.53605 38.0 38.0 38.0 37.2 38.0 15-19 37.574149999999996 38.0 38.0 38.0 38.0 38.0 20-24 37.54275 38.0 38.0 38.0 38.0 38.0 25-29 37.47769999999999 38.0 38.0 38.0 37.4 38.0 30-34 37.465 38.0 38.0 38.0 37.4 38.0 35-39 37.3426 38.0 38.0 38.0 37.0 38.0 40-44 37.34995 38.0 38.0 38.0 37.0 38.0 45-49 37.146899999999995 38.0 38.0 38.0 36.6 38.0 50-54 37.11925 38.0 38.0 38.0 36.0 38.0 55-59 37.00175 38.0 38.0 38.0 35.8 38.0 60-64 37.0149 38.0 38.0 38.0 35.8 38.0 65-69 36.8025 38.0 38.0 38.0 35.2 38.0 70-74 36.74699999999999 38.0 38.0 38.0 34.4 38.0 75-79 36.49885 38.0 37.8 38.0 34.0 38.0 80-84 36.252 38.0 37.0 38.0 33.4 38.0 85-89 36.2349 38.0 37.0 38.0 33.4 38.0 90-94 36.0475 38.0 37.0 38.0 32.8 38.0 95-99 35.5666 38.0 36.6 38.0 30.6 38.0 100-104 35.8317 38.0 37.0 38.0 31.4 38.0 105-109 35.426300000000005 38.0 36.2 38.0 29.8 38.0 110-114 35.2162 38.0 35.8 38.0 28.4 38.0 115-119 34.817449999999994 38.0 35.0 38.0 27.6 38.0 120-124 34.54455 38.0 34.8 38.0 26.2 38.0 125-129 34.0706 38.0 34.0 38.0 23.2 38.0 130-134 32.8008 37.6 31.8 38.0 16.2 38.0 135-139 32.17575000000001 36.6 31.0 38.0 14.6 38.0 140-144 31.02335 36.0 29.2 38.0 13.0 38.0 145-149 29.79835 36.0 28.0 38.0 5.8 38.0 150-151 23.613625 30.5 12.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 2.0 12 0.0 13 0.0 14 0.0 15 1.0 16 5.0 17 5.0 18 4.0 19 2.0 20 3.0 21 8.0 22 9.0 23 8.0 24 16.0 25 15.0 26 25.0 27 39.0 28 34.0 29 55.0 30 65.0 31 86.0 32 139.0 33 164.0 34 332.0 35 615.0 36 1325.0 37 1041.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.468140442132636 9.206762028608582 13.133940182054616 37.19115734720416 2 25.7 11.825 36.125 26.35 3 20.25 18.65 23.625 37.475 4 23.075000000000003 26.575 22.375 27.975 5 22.525000000000002 32.1 23.95 21.425 6 18.975 35.925000000000004 24.775 20.325 7 14.774999999999999 25.924999999999997 41.175 18.125 8 18.0 27.025 31.474999999999998 23.5 9 17.625 24.175 35.05 23.150000000000002 10-14 19.055 29.794999999999998 27.825 23.325000000000003 15-19 19.365 29.015 27.955000000000002 23.665 20-24 19.79 28.88 27.834999999999997 23.494999999999997 25-29 19.86 29.005 27.650000000000002 23.485 30-34 19.566956695669564 29.07790779077908 27.702770277027707 23.652365236523654 35-39 19.950997549877496 29.106455322766138 27.36136806840342 23.581179058952948 40-44 20.055 29.12 27.605 23.22 45-49 20.31 28.7 27.384999999999998 23.605 50-54 19.505 28.560000000000002 27.805000000000003 24.13 55-59 19.744999999999997 28.535 27.72 24.0 60-64 19.98 29.07 27.275 23.674999999999997 65-69 19.79 29.005 27.66 23.544999999999998 70-74 20.335 29.025000000000002 27.089999999999996 23.549999999999997 75-79 19.68295244286643 29.039355903385506 27.829174376156423 23.448517277591638 80-84 19.82396479295859 28.685737147429485 27.365473094618924 24.124824964993 85-89 20.025000000000002 29.07 27.49 23.415 90-94 20.485 28.660000000000004 27.200000000000003 23.655 95-99 20.305 29.385 26.75 23.56 100-104 20.015 29.325000000000003 27.250000000000004 23.41 105-109 20.380000000000003 28.845 27.075 23.7 110-114 20.115 28.28 27.944999999999997 23.66 115-119 20.015 28.994999999999997 27.250000000000004 23.74 120-124 20.625 28.470000000000002 27.05 23.855 125-129 20.005 28.395 27.32 24.279999999999998 130-134 20.785 28.37 26.93 23.915 135-139 20.745 28.315 27.215 23.724999999999998 140-144 20.16 28.249999999999996 27.57 24.02 145-149 20.169999999999998 28.95 27.08 23.799999999999997 150-151 20.6125 28.8625 26.825 23.7 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.0 19 1.0 20 2.5 21 2.5 22 2.0 23 2.0 24 3.0 25 5.0 26 5.5 27 4.5 28 8.5 29 17.0 30 18.5 31 23.0 32 35.5 33 46.5 34 60.0 35 79.0 36 102.0 37 122.5 38 135.0 39 158.0 40 183.0 41 216.5 42 243.5 43 257.5 44 263.0 45 252.0 46 250.5 47 235.5 48 217.5 49 207.0 50 183.5 51 149.5 52 129.5 53 100.0 54 73.5 55 59.0 56 39.0 57 32.0 58 22.0 59 15.0 60 11.5 61 5.5 62 2.0 63 3.0 64 3.0 65 2.5 66 3.5 67 1.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.625 0.0 0.0 0.0 0.0 92-93 0.75 0.0 0.0 0.0 0.0 94-95 0.825 0.0 0.0 0.0 0.0 96-97 0.975 0.0 0.0 0.0 0.0 98-99 1.2625 0.0 0.0 0.0 0.0 100-101 1.45 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.8875 0.0 0.0 0.0 0.0 106-107 2.1375 0.0 0.0 0.0 0.0 108-109 2.5375 0.0 0.0 0.0 0.0 110-111 2.7 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.55 0.0 0.0 0.0 0.0 118-119 3.9375 0.0 0.0 0.0 0.0 120-121 4.225 0.0 0.0 0.0 0.0 122-123 4.637499999999999 0.0 0.0 0.0 0.0 124-125 4.987500000000001 0.0 0.0 0.0 0.0 126-127 5.2375 0.0 0.0 0.0 0.0 128-129 5.725 0.0 0.0 0.0 0.0 130-131 6.1375 0.0 0.0 0.0 0.0 132-133 6.487500000000001 0.0 0.0 0.0 0.0 134-135 6.8375 0.0 0.0 0.0 0.0 136-137 7.15 0.0 0.0 0.0 0.0 138-139 7.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTCTGAT 10 0.0056249425 154.6 1 >>END_MODULE SRR7170475 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170475_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.953 33.0 33.0 34.0 32.0 34.0 2 33.131 34.0 33.0 34.0 33.0 34.0 3 33.102 34.0 33.0 34.0 33.0 34.0 4 33.0365 34.0 33.0 34.0 32.0 34.0 5 33.07125 34.0 33.0 34.0 32.0 34.0 6 37.2055 38.0 38.0 38.0 37.0 38.0 7 37.24525 38.0 38.0 38.0 37.0 38.0 8 37.278 38.0 38.0 38.0 37.0 38.0 9 37.33225 38.0 38.0 38.0 37.0 38.0 10-14 37.2672 38.0 38.0 38.0 37.0 38.0 15-19 37.2372 38.0 38.0 38.0 37.0 38.0 20-24 37.24665 38.0 38.0 38.0 37.0 38.0 25-29 37.2368 38.0 38.0 38.0 37.0 38.0 30-34 37.2266 38.0 38.0 38.0 37.0 38.0 35-39 37.22825 38.0 38.0 38.0 37.0 38.0 40-44 37.1824 38.0 38.0 38.0 37.0 38.0 45-49 37.164550000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.110699999999994 38.0 38.0 38.0 36.6 38.0 55-59 37.0998 38.0 38.0 38.0 36.2 38.0 60-64 37.055049999999994 38.0 38.0 38.0 36.2 38.0 65-69 37.0013 38.0 38.0 38.0 36.0 38.0 70-74 36.88845 38.0 38.0 38.0 36.0 38.0 75-79 36.8322 38.0 38.0 38.0 35.6 38.0 80-84 36.80555 38.0 38.0 38.0 35.4 38.0 85-89 36.764599999999994 38.0 38.0 38.0 35.4 38.0 90-94 36.6281 38.0 38.0 38.0 34.8 38.0 95-99 36.4283 38.0 38.0 38.0 34.0 38.0 100-104 36.326800000000006 38.0 38.0 38.0 34.0 38.0 105-109 36.132799999999996 38.0 37.4 38.0 33.4 38.0 110-114 35.97045 38.0 37.0 38.0 32.6 38.0 115-119 35.75485 38.0 37.0 38.0 31.0 38.0 120-124 35.374300000000005 38.0 36.4 38.0 30.2 38.0 125-129 34.64305 38.0 34.8 38.0 26.8 38.0 130-134 34.36710000000001 38.0 34.4 38.0 25.4 38.0 135-139 33.771699999999996 38.0 33.2 38.0 22.6 38.0 140-144 32.95635 38.0 33.0 38.0 15.2 38.0 145-149 32.2531 38.0 33.0 38.0 10.6 38.0 150-151 26.608249999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 0.0 5 1.0 6 1.0 7 0.0 8 0.0 9 2.0 10 0.0 11 2.0 12 1.0 13 4.0 14 3.0 15 2.0 16 3.0 17 1.0 18 4.0 19 7.0 20 3.0 21 6.0 22 6.0 23 9.0 24 13.0 25 14.0 26 18.0 27 22.0 28 36.0 29 30.0 30 50.0 31 50.0 32 95.0 33 120.0 34 175.0 35 275.0 36 758.0 37 2283.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 31.98299574893723 19.229807451862964 18.829707426856714 29.957489372343087 2 27.781945486371594 23.85596399099775 31.83295823955989 16.52913228307077 3 21.48037009252313 27.93198299574894 30.257564391097773 20.330082520630157 4 23.63090772693173 34.858714678669664 22.780695173793447 18.72968242060515 5 26.356589147286826 36.30907726931733 21.880470117529384 15.453863465866466 6 20.455113778444613 38.009502375593904 23.1807951987997 18.35458864716179 7 20.505126281570394 20.630157539384847 39.68492123030758 19.179794948737182 8 23.655913978494624 24.956239059764943 26.981745436359088 24.406101525381345 9 22.53063265816454 25.656414103525883 29.607401850462615 22.20555138784696 10-14 23.53588397099275 29.417354338584644 26.18154538634659 20.86521630407602 15-19 22.99574893723431 28.49212303075769 28.08702175543886 20.425106276569142 20-24 22.96574143535884 28.287071767941985 27.84196049012253 20.905226306576644 25-29 23.176953085925778 28.293488046413923 27.768330499149744 20.761228368510555 30-34 22.79297754213975 28.294903216125643 28.10983844345521 20.802280798279398 35-39 23.43937575030012 28.49139655862345 27.345938375350144 20.72328931572629 40-44 23.20080020005001 28.032008002000502 27.741935483870968 21.02525631407852 45-49 23.380845211302827 27.33183295823956 28.377094273568392 20.91022755688922 50-54 23.585896474118528 27.811952988247064 28.212053013253314 20.390097524381094 55-59 23.605901475368842 27.811952988247064 27.796949237309327 20.78519629907477 60-64 23.215803950987745 27.97199299824956 27.93198299574894 20.880220055013755 65-69 23.152734003702037 28.02541397768773 28.5006753714543 20.321176647155937 70-74 23.830255717359755 27.21813541510284 28.484211579842867 20.467397287694542 75-79 23.113113113113112 28.01801801801802 28.033033033033032 20.835835835835837 80-84 23.274438160068073 27.899294258971917 27.95935732519145 20.866910255768556 85-89 23.403403403403402 27.982982982982985 27.62262262262262 20.99099099099099 90-94 23.217056203393224 27.901506431109553 27.856463640458433 21.024973725038787 95-99 23.449069441665 28.29697818691215 27.576545927556534 20.67740644386632 100-104 23.83453381352541 27.916166466586635 27.73109243697479 20.518207282913163 105-109 24.173295312421832 28.02541397768773 27.805292911101105 19.995997798789332 110-114 24.3233778578218 28.030416729201065 27.700235129321126 19.94597028365601 115-119 24.3931735148391 28.221810720184177 27.636254441719633 19.748761323257096 120-124 25.032535789368303 27.565321854039443 27.129842827109822 20.272299529482428 125-129 24.62439903846154 28.104967948717945 27.23858173076923 20.032051282051285 130-134 24.817225838758137 28.03204807210816 27.165748622934398 19.9849774661993 135-139 24.735814093253868 27.700706165172534 27.555466519757598 20.008013221815997 140-144 24.4866272663528 28.47841330261445 27.38154863267555 19.653410798357207 145-149 25.09387673359035 27.767486106243428 27.296850748510487 19.841786411655736 150-151 25.794345759319487 27.23292469352014 27.45809357017763 19.514635976982735 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 1.5 23 2.0 24 4.0 25 3.5 26 3.0 27 4.0 28 5.5 29 9.0 30 12.0 31 17.0 32 25.5 33 42.0 34 57.5 35 65.0 36 86.0 37 110.0 38 137.0 39 168.5 40 197.5 41 221.5 42 239.5 43 265.0 44 285.0 45 298.0 46 290.0 47 250.0 48 218.0 49 200.0 50 161.5 51 126.0 52 107.0 53 93.5 54 78.5 55 59.0 56 43.5 57 30.5 58 21.0 59 17.0 60 13.0 61 7.5 62 6.0 63 6.0 64 4.5 65 1.5 66 0.5 67 0.5 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.025 20-24 0.025 25-29 0.03 30-34 0.034999999999999996 35-39 0.04 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.055 70-74 0.08499999999999999 75-79 0.1 80-84 0.105 85-89 0.1 90-94 0.095 95-99 0.06 100-104 0.04 105-109 0.055 110-114 0.055 115-119 0.095 120-124 0.11 125-129 0.16 130-134 0.15 135-139 0.165 140-144 0.16999999999999998 145-149 0.135 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.49710837314558 98.925 2 0.4274578828262509 0.8500000000000001 3 0.07543374402816193 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.2375 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3875 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.725 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.95 0.0 0.0 0.0 0.0 98-99 1.2125 0.0 0.0 0.0 0.0 100-101 1.4 0.0 0.0 0.0 0.0 102-103 1.5875 0.0 0.0 0.0 0.0 104-105 1.8375 0.0 0.0 0.0 0.0 106-107 2.1125 0.0 0.0 0.0 0.0 108-109 2.5125 0.0 0.0 0.0 0.0 110-111 2.675 0.0 0.0 0.0 0.0 112-113 2.975 0.0 0.0 0.0 0.0 114-115 3.3 0.0 0.0 0.0 0.0 116-117 3.5625 0.0 0.0 0.0 0.0 118-119 3.9625 0.0 0.0 0.0 0.0 120-121 4.275 0.0 0.0 0.0 0.0 122-123 4.7 0.0 0.0 0.0 0.0 124-125 5.0625 0.0 0.0 0.0 0.0 126-127 5.325 0.0 0.0 0.0 0.0 128-129 5.8125 0.0 0.0 0.0 0.0 130-131 6.2625 0.0 0.0 0.0 0.0 132-133 6.625 0.0 0.0 0.0 0.0 134-135 6.9625 0.0 0.0 0.0 0.0 136-137 7.275 0.0 0.0 0.0 0.0 138-139 7.574999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAGTAA 10 0.006830828 145.0 3 >>END_MODULE Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 804000 spots for SRR7170475.sra Written 804000 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra Read 803993 spots for SRR7170475.sra Written 803993 spots for SRR7170475.sra SRR ids: ['SRR7170475.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_i8apd1fb SRR7170475.sra spots: 16079867 blocks: [[1, 803993], [803994, 1607986], [1607987, 2411979], [2411980, 3215972], [3215973, 4019965], [4019966, 4823958], [4823959, 5627951], [5627952, 6431944], [6431945, 7235937], [7235938, 8039930], [8039931, 8843923], [8843924, 9647916], [9647917, 10451909], [10451910, 11255902], [11255903, 12059895], [12059896, 12863888], [12863889, 13667881], [13667882, 14471874], [14471875, 15275867], [15275868, 16079867]] SRR7170475 file size 5427238 SRR7170475 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170475 SRR7170475_1.fastq SRR7170475_2.fastq Input file: SRR7170475_1.fastq Paired file: SRR7170475_2.fastq trimmed: SRR7170475-trimmed-pair1.fastq, SRR7170475-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:47:04 2025 >> started Wed Feb 12 22:47:21 2025 >> done (17.036s) 16079867 read pairs processed; of these: 12759 ( 0.08%) short read pairs filtered out after trimming by size control 22223 ( 0.14%) empty read pairs filtered out after trimming by size control 16044885 (99.78%) read pairs available; of these: 10833373 (67.52%) trimmed read pairs available after processing 5211512 (32.48%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 1 0.00% 21 2 0.00% 22 3 0.00% 23 1 0.00% 24 4 0.00% 25 3 0.00% 26 2 0.00% 27 7 0.00% 28 4 0.00% 29 7 0.00% 30 6 0.00% 31 16 0.00% 32 11 0.00% 33 7 0.00% 34 18 0.00% 35 15 0.00% 36 24 0.00% 37 25 0.00% 38 34 0.00% 39 37 0.00% 40 39 0.00% 41 55 0.00% 42 48 0.00% 43 66 0.00% 44 70 0.00% 45 81 0.00% 46 85 0.00% 47 108 0.00% 48 136 0.00% 49 159 0.00% 50 153 0.00% 51 192 0.00% 52 206 0.00% 53 238 0.00% 54 230 0.00% 55 302 0.00% 56 293 0.00% 57 351 0.00% 58 438 0.00% 59 487 0.00% 60 521 0.00% 61 688 0.00% 62 718 0.00% 63 769 0.00% 64 836 0.01% 65 941 0.01% 66 979 0.01% 67 1083 0.01% 68 1269 0.01% 69 1369 0.01% 70 1563 0.01% 71 1802 0.01% 72 1963 0.01% 73 2185 0.01% 74 2441 0.02% 75 2656 0.02% 76 2954 0.02% 77 3318 0.02% 78 3518 0.02% 79 3895 0.02% 80 4150 0.03% 81 4789 0.03% 82 5477 0.03% 83 6007 0.04% 84 7453 0.05% 85 7561 0.05% 86 8135 0.05% 87 8362 0.05% 88 8805 0.05% 89 9434 0.06% 90 9948 0.06% 91 10717 0.07% 92 11347 0.07% 93 12268 0.08% 94 13155 0.08% 95 14170 0.09% 96 14779 0.09% 97 15641 0.10% 98 16309 0.10% 99 16750 0.10% 100 17700 0.11% 101 18381 0.11% 102 19527 0.12% 103 20251 0.13% 104 21231 0.13% 105 22040 0.14% 106 23578 0.15% 107 24031 0.15% 108 24632 0.15% 109 25145 0.16% 110 25591 0.16% 111 26143 0.16% 112 27386 0.17% 113 28352 0.18% 114 29270 0.18% 115 30694 0.19% 116 31683 0.20% 117 33164 0.21% 118 34043 0.21% 119 34886 0.22% 120 35534 0.22% 121 37534 0.23% 122 38435 0.24% 123 40573 0.25% 124 42347 0.26% 125 43878 0.27% 126 46619 0.29% 127 48806 0.30% 128 51321 0.32% 129 53923 0.34% 130 57286 0.36% 131 60171 0.38% 132 64599 0.40% 133 68863 0.43% 134 73679 0.46% 135 79577 0.50% 136 86875 0.54% 137 94486 0.59% 138 103216 0.64% 139 113660 0.71% 140 127948 0.80% 141 143190 0.89% 142 163949 1.02% 143 192623 1.20% 144 233727 1.46% 145 290237 1.81% 146 377771 2.35% 147 523804 3.26% 148 799625 4.98% 149 1486636 9.27% 150 4490063 27.98% 151 5211512 32.48% 16044885 reads passed initial QC criterion=sequence-density sequence-density=0.17 sequence-density-rank=1 fanout-score=6.67 fanout-score-rank=13 prefix-density=0.32 prefix-fanout=3.7 sequence=TTGCAGCCATTCTCAGCACCAAAGTTCATCTCAGAGCTCTCGTAGAACATCCTAACTGGAGCTACACCAGCAATGATTGTCTGACTTGTGGTGGTCTCGGAGAAACTCAAGTCTGGGTACATGCTGCATCCATTGCAGCCACTGCCGCACTTGCA criterion=fanout-score sequence-density=0.07 sequence-density-rank=36 fanout-score=48.74 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=12.1 sequence=CCATCTTCTTCATCT criterion=sequence-density sequence-density=0.24 sequence-density-rank=1 fanout-score=2.09 fanout-score-rank=35 prefix-density=0.24 prefix-fanout=2.1 sequence=TGCAAGTGCGGCAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=55.38 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=6.3 sequence=CTTCAAGGGCAGTAGTCTTAAACCATACTCTAAAATCTTCTTATAATTCCAGTTGTAATATTCTGCTAGCATATAATGGCTTCTTCAATGAGCTTGAAGCTGGCCTGTGCCATGCTTGTAGCGATGGTTGTTAGTGCACCACTAGCAGAAGCTGCCATCTCATGTGGCCAGGTGTCAAGCAGCTTGGCACAATGTATAACCTACCTCCAGAAGGGTGGGGCTGTGCCTGCAGCTTGCTGCAGTGGGTTGAAAGGACTTAATTCTGCAGCCACGACCACCGCCGACCGCCAAGGGGTCTGCAACTGTTTGAAATCCTTGGCTGGTAAGATCTCTGGCATCAACTATGGCGTGGCTGCTGGCCTCCCTTCAAAGTGTGGTGTATCCATCTCCTACAAAATCAGTCCTTCCACAGA SRR7170475 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:48:04 Started mapping on | Feb 12 22:48:04 Finished on | Feb 12 22:49:45 Mapping speed, Million of reads per hour | 571.90 Number of input reads | 16044885 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 15177139 Uniquely mapped reads % | 94.59% Average mapped length | 291.00 Number of splices: Total | 14253396 Number of splices: Annotated (sjdb) | 13929809 Number of splices: GT/AG | 13989639 Number of splices: GC/AG | 210672 Number of splices: AT/AC | 8840 Number of splices: Non-canonical | 44245 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.07 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 470198 % of reads mapped to multiple loci | 2.93% Number of reads mapped to too many loci | 40710 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.17% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 405654 405654 405654 N_multimapping 470198 470198 470198 N_noFeature 495945 14957498 560418 N_ambiguous 279816 841 124377 UnstrandedReadsAssigned:14401378 PositiveStrandReadsAssigned:218800 NegativeStrandReadsAssigned:14492344 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170475 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170475-trimmed-pair1.fastq SRR7170475-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,044,885 reads, 14,435,363 reads pseudoaligned [quant] estimated average fragment length: 258.114 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,082 rounds 52401 SRR7170475.ke.tsv 34699 SRR7170475.se.tsv 87100 total ==> SRR7170475.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.89 1262 47.182 Potri.005G024800.1.v4.1 1035 777.886 419 35.4606 Potri.004G059700.1.v4.1 961 703.907 4 0.374105 Potri.007G009000.2.v4.1 1416 1158.89 0 0 Potri.003G141000.2.v4.1 2943 2685.89 573 14.0448 Potri.016G087400.1.v4.1 270 80.8485 1112 905.485 Potri.015G069301.1.v4.1 564 310.433 0 0 Potri.010G195200.1.v4.1 1773 1515.89 384.789 16.7111 Potri.012G127500.1.v4.1 977 719.897 134 12.2541 ==> SRR7170475.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1077 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 356 Potri.001G212900.v4.1 35 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 103 Potri.001G416900.v4.1 14 Potri.001G452600.v4.1 9 SRR7170475 completed mapping pipeline successfully