Starting /dee2/code/volunteer_pipeline.sh SRR7170476 current disk space = 3050476318720 free memory = 1580522220 SRR7170476 SRAfilesize 7781bf3c6c5e29ec040e988e1083c531 SRR7170476.sra SRR7170476.sra file validated SRR7170476 is paired end SRR7170476 is conventional basespace SRR7170476 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170476_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.294 18.0 18.0 18.0 18.0 32.0 2 26.23775 27.0 25.0 28.0 18.0 30.0 3 28.38 29.0 27.0 31.0 25.0 33.0 4 31.11975 31.0 31.0 33.0 29.0 33.0 5 31.9915 33.0 31.0 33.0 30.0 33.0 6 35.87875 37.0 36.0 38.0 33.0 38.0 7 36.7435 38.0 37.0 38.0 34.0 38.0 8 37.2225 38.0 38.0 38.0 36.0 38.0 9 37.40025 38.0 38.0 38.0 37.0 38.0 10-14 36.785000000000004 38.0 37.4 38.0 34.4 38.0 15-19 37.45345 38.0 38.0 38.0 37.0 38.0 20-24 37.56035000000001 38.0 38.0 38.0 37.4 38.0 25-29 36.529799999999994 38.0 37.2 38.0 32.0 38.0 30-34 37.150150000000004 38.0 38.0 38.0 36.2 38.0 35-39 37.343450000000004 38.0 38.0 38.0 36.8 38.0 40-44 37.45870000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.413050000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.37675 38.0 38.0 38.0 37.0 38.0 55-59 37.3002 38.0 38.0 38.0 36.8 38.0 60-64 37.2469 38.0 38.0 38.0 36.0 38.0 65-69 37.16055 38.0 38.0 38.0 36.0 38.0 70-74 36.59590000000001 38.0 37.8 38.0 33.6 38.0 75-79 37.0024 38.0 38.0 38.0 35.8 38.0 80-84 36.94780000000001 38.0 38.0 38.0 35.4 38.0 85-89 36.79925 38.0 38.0 38.0 35.0 38.0 90-94 36.70435 38.0 38.0 38.0 34.6 38.0 95-99 36.57335 38.0 38.0 38.0 34.0 38.0 100-104 36.6227 38.0 38.0 38.0 34.2 38.0 105-109 36.5271 38.0 37.8 38.0 34.0 38.0 110-114 36.30125 38.0 37.0 38.0 33.8 38.0 115-119 35.837599999999995 38.0 37.0 38.0 31.8 38.0 120-124 35.8658 38.0 37.0 38.0 31.8 38.0 125-129 35.68745 38.0 36.4 38.0 31.8 38.0 130-134 35.34925 38.0 36.0 38.0 29.6 38.0 135-139 34.64505 38.0 34.6 38.0 25.8 38.0 140-144 34.688649999999996 38.0 35.0 38.0 27.6 38.0 145-149 34.09735 38.0 34.2 38.0 25.8 38.0 150-151 29.965875 35.5 27.0 38.0 11.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 12 1.0 13 0.0 14 0.0 15 1.0 16 0.0 17 0.0 18 2.0 19 3.0 20 1.0 21 4.0 22 3.0 23 4.0 24 9.0 25 6.0 26 8.0 27 11.0 28 25.0 29 31.0 30 55.0 31 51.0 32 92.0 33 121.0 34 184.0 35 396.0 36 1077.0 37 1915.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 28.231914337947245 30.6346304518151 8.27892400104466 32.854531209193 2 20.68017004251063 16.454113528382095 34.70867716929232 28.157039259814955 3 17.275 23.05 26.25 33.425 4 21.925 30.45 22.900000000000002 24.725 5 23.45 32.275 24.474999999999998 19.8 6 19.375 35.325 25.974999999999998 19.325 7 13.450000000000001 26.900000000000002 42.35 17.299999999999997 8 18.0 24.95 30.925000000000004 26.125 9 17.474999999999998 25.525 33.425 23.575 10-14 19.1 30.445 27.505000000000003 22.95 15-19 20.080000000000002 28.060000000000002 28.38 23.48 20-24 19.77 29.104999999999997 28.16 22.965 25-29 19.67 29.18 28.005000000000003 23.145 30-34 19.825 29.020000000000003 27.62 23.535 35-39 19.97 28.754999999999995 27.925 23.35 40-44 19.84 29.565 27.839999999999996 22.755 45-49 19.75 28.46 27.87 23.919999999999998 50-54 20.27 29.175 27.43 23.125 55-59 19.509999999999998 28.895 27.98 23.615 60-64 19.82 28.95 27.865000000000002 23.365 65-69 19.825 28.29 27.900000000000002 23.985 70-74 19.86 28.53 27.88 23.73 75-79 19.715 28.599999999999998 28.035 23.65 80-84 20.044999999999998 28.435 27.595 23.925 85-89 20.45 28.675 27.339999999999996 23.535 90-94 20.474999999999998 28.605000000000004 27.495000000000005 23.425 95-99 19.85 28.775000000000002 27.389999999999997 23.985 100-104 20.200000000000003 28.87 27.62 23.31 105-109 20.47 29.04 27.22 23.27 110-114 20.369999999999997 28.634999999999998 27.67 23.325000000000003 115-119 20.76 28.67 27.295 23.275000000000002 120-124 20.09 28.945 27.26 23.705000000000002 125-129 20.26 28.155 27.595 23.990000000000002 130-134 20.53 28.37 27.445000000000004 23.655 135-139 20.455000000000002 28.16 27.74 23.645 140-144 20.674999999999997 28.27 27.36 23.695 145-149 20.82 28.37 27.134999999999998 23.674999999999997 150-151 21.0 28.549999999999997 26.05 24.4 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 1.0 22 1.0 23 1.0 24 2.0 25 4.5 26 4.0 27 5.0 28 8.0 29 16.0 30 24.0 31 29.0 32 39.0 33 58.5 34 71.0 35 80.0 36 97.5 37 128.5 38 164.5 39 169.0 40 197.0 41 232.0 42 247.5 43 271.5 44 289.5 45 279.0 46 255.5 47 239.0 48 204.5 49 174.0 50 157.5 51 126.0 52 88.0 53 77.0 54 67.5 55 48.5 56 35.0 57 23.5 58 20.5 59 18.5 60 14.5 61 10.5 62 5.0 63 2.0 64 2.0 65 3.0 66 1.5 67 1.0 68 1.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.275 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2625 0.0 0.0 0.0 0.0 90-91 0.32499999999999996 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.44999999999999996 0.0 0.0 0.0 0.0 96-97 0.525 0.0 0.0 0.0 0.0 98-99 0.6499999999999999 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.9 0.0 0.0 0.0 0.0 104-105 1.025 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.4 0.0 0.0 0.0 0.0 110-111 1.65 0.0 0.0 0.0 0.0 112-113 1.9874999999999998 0.0 0.0 0.0 0.0 114-115 2.2249999999999996 0.0 0.0 0.0 0.0 116-117 2.3875 0.0 0.0 0.0 0.0 118-119 2.6500000000000004 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.1375 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.2 0.0 0.0 0.0 0.0 132-133 4.4875 0.0 0.0 0.0 0.0 134-135 4.7625 0.0 0.0 0.0 0.0 136-137 5.0625 0.0 0.0 0.0 0.0 138-139 5.475 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ACAAGTC 10 0.006836113 144.9625 7 >>END_MODULE SRR7170476 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170476_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.92325 33.0 33.0 34.0 32.0 34.0 2 32.96975 34.0 33.0 34.0 32.0 34.0 3 33.00025 34.0 33.0 34.0 32.0 34.0 4 32.954 34.0 33.0 34.0 32.0 34.0 5 32.89675 34.0 33.0 34.0 32.0 34.0 6 37.17925 38.0 38.0 38.0 37.0 38.0 7 37.16025 38.0 38.0 38.0 37.0 38.0 8 37.17875 38.0 38.0 38.0 37.0 38.0 9 37.11925 38.0 38.0 38.0 37.0 38.0 10-14 37.0627 38.0 38.0 38.0 36.8 38.0 15-19 37.005700000000004 38.0 38.0 38.0 36.6 38.0 20-24 36.92165 38.0 38.0 38.0 36.0 38.0 25-29 36.90814999999999 38.0 38.0 38.0 36.2 38.0 30-34 37.027699999999996 38.0 38.0 38.0 36.8 38.0 35-39 36.99025 38.0 38.0 38.0 36.4 38.0 40-44 36.961149999999996 38.0 38.0 38.0 36.4 38.0 45-49 36.839650000000006 38.0 38.0 38.0 36.0 38.0 50-54 36.5955 38.0 38.0 38.0 35.0 38.0 55-59 36.7182 38.0 38.0 38.0 35.6 38.0 60-64 36.2195 38.0 37.6 38.0 32.8 38.0 65-69 36.63199999999999 38.0 38.0 38.0 35.2 38.0 70-74 36.22430000000001 38.0 38.0 38.0 33.4 38.0 75-79 36.43175 38.0 38.0 38.0 34.2 38.0 80-84 35.619299999999996 38.0 36.8 38.0 29.4 38.0 85-89 34.9978 38.0 35.8 38.0 27.2 38.0 90-94 36.12755 38.0 37.6 38.0 33.2 38.0 95-99 36.065250000000006 38.0 37.6 38.0 33.6 38.0 100-104 35.69545 38.0 37.2 38.0 30.2 38.0 105-109 35.34349999999999 38.0 36.2 38.0 29.6 38.0 110-114 35.2456 38.0 36.2 38.0 28.2 38.0 115-119 35.394099999999995 38.0 36.6 38.0 30.4 38.0 120-124 35.202600000000004 38.0 36.0 38.0 29.0 38.0 125-129 34.793600000000005 38.0 35.8 38.0 26.8 38.0 130-134 34.19855 38.0 33.8 38.0 23.6 38.0 135-139 34.0647 38.0 33.4 38.0 24.4 38.0 140-144 33.1192 38.0 32.6 38.0 19.0 38.0 145-149 32.057300000000005 38.0 33.0 38.0 10.6 38.0 150-151 26.576999999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 3.0 4 5.0 5 1.0 6 4.0 7 3.0 8 0.0 9 0.0 10 2.0 11 4.0 12 2.0 13 4.0 14 3.0 15 3.0 16 0.0 17 3.0 18 4.0 19 2.0 20 3.0 21 7.0 22 5.0 23 12.0 24 11.0 25 17.0 26 25.0 27 28.0 28 35.0 29 37.0 30 59.0 31 83.0 32 88.0 33 129.0 34 225.0 35 366.0 36 823.0 37 1993.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.325 19.900000000000002 15.775 27.0 2 26.474999999999998 26.700000000000003 29.975 16.85 3 19.1 27.625 32.5 20.775 4 23.325000000000003 32.7 24.425 19.55 5 24.275 35.225 23.425 17.075000000000003 6 19.925 38.125 24.224999999999998 17.724999999999998 7 20.8 21.275 39.25 18.675 8 22.375 25.974999999999998 27.525 24.125 9 21.4 25.424999999999997 30.049999999999997 23.125 10-14 22.825 28.79 27.24 21.145 15-19 22.865 27.800000000000004 28.185 21.15 20-24 23.169999999999998 28.449999999999996 27.825 20.555 25-29 23.355 27.85 28.825 19.97 30-34 23.03 28.065 28.22 20.685000000000002 35-39 22.855 28.144999999999996 28.29 20.71 40-44 22.975 27.99 27.944999999999997 21.09 45-49 23.04 28.115000000000002 27.74 21.105 50-54 22.55 28.95 28.144999999999996 20.355 55-59 23.24 28.105000000000004 28.299999999999997 20.355 60-64 23.1 28.17 27.944999999999997 20.785 65-69 22.865 27.834999999999997 28.33 20.97 70-74 23.265 27.939999999999998 28.32 20.474999999999998 75-79 23.395 27.555000000000003 28.53 20.52 80-84 22.985 27.97 28.050000000000004 20.995 85-89 23.75 27.605 28.075 20.57 90-94 22.95 27.865000000000002 28.26 20.925 95-99 22.78 28.165000000000003 28.08 20.974999999999998 100-104 23.65 28.035 27.52 20.794999999999998 105-109 23.595 27.51 28.549999999999997 20.345 110-114 23.72 27.82 27.97 20.49 115-119 24.335 28.384999999999998 27.205000000000002 20.075000000000003 120-124 23.635 27.950000000000003 28.07 20.345 125-129 24.055 28.315 27.425 20.205000000000002 130-134 24.060000000000002 27.839999999999996 27.865000000000002 20.235 135-139 24.310000000000002 27.905 28.27 19.515 140-144 23.880000000000003 27.87 28.27 19.98 145-149 24.64 28.110000000000003 27.42 19.830000000000002 150-151 25.525 27.737499999999997 26.650000000000002 20.0875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.5 6 0.5 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.5 16 0.5 17 0.0 18 0.0 19 0.0 20 1.5 21 2.5 22 2.5 23 2.0 24 1.0 25 2.5 26 5.0 27 8.5 28 8.0 29 10.5 30 20.5 31 21.5 32 23.0 33 35.5 34 56.5 35 77.0 36 86.0 37 107.0 38 147.5 39 175.5 40 203.5 41 242.5 42 248.0 43 261.0 44 290.0 45 283.5 46 250.5 47 240.0 48 227.5 49 183.0 50 155.5 51 139.0 52 114.5 53 88.5 54 69.0 55 60.0 56 44.5 57 30.5 58 23.0 59 13.5 60 10.0 61 7.5 62 7.0 63 3.0 64 0.5 65 2.0 66 2.0 67 1.0 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.5547150781643975 1.0999999999999999 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.0 0.0 6 0.02521432173474534 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0125 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.05 0.0 0.0 0.0 0.0 82-83 0.1 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.16249999999999998 0.0 0.0 0.0 0.0 88-89 0.2125 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.42500000000000004 0.0 0.0 0.0 0.0 96-97 0.5 0.0 0.0 0.0 0.0 98-99 0.6000000000000001 0.0 0.0 0.0 0.0 100-101 0.7125 0.0 0.0 0.0 0.0 102-103 0.825 0.0 0.0 0.0 0.0 104-105 0.925 0.0 0.0 0.0 0.0 106-107 1.0625 0.0 0.0 0.0 0.0 108-109 1.3 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.8875 0.0 0.0 0.0 0.0 114-115 2.125 0.0 0.0 0.0 0.0 116-117 2.2875 0.0 0.0 0.0 0.0 118-119 2.5625 0.0 0.0 0.0 0.0 120-121 2.85 0.0 0.0 0.0 0.0 122-123 3.0375 0.0 0.0 0.0 0.0 124-125 3.2625 0.0 0.0 0.0 0.0 126-127 3.425 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 4.0375 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.5375 0.0 0.0 0.0 0.0 136-137 4.85 0.0 0.0 0.0 0.0 138-139 5.275 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCTCG 10 0.006830828 145.0 8 >>END_MODULE Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698680 spots for SRR7170476.sra Written 698680 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra Read 698672 spots for SRR7170476.sra Written 698672 spots for SRR7170476.sra SRR ids: ['SRR7170476.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_1g0d81ie SRR7170476.sra spots: 13973448 blocks: [[1, 698672], [698673, 1397344], [1397345, 2096016], [2096017, 2794688], [2794689, 3493360], [3493361, 4192032], [4192033, 4890704], [4890705, 5589376], [5589377, 6288048], [6288049, 6986720], [6986721, 7685392], [7685393, 8384064], [8384065, 9082736], [9082737, 9781408], [9781409, 10480080], [10480081, 11178752], [11178753, 11877424], [11877425, 12576096], [12576097, 13274768], [13274769, 13973448]] SRR7170476 file size 4713442 SRR7170476 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170476 SRR7170476_1.fastq SRR7170476_2.fastq Input file: SRR7170476_1.fastq Paired file: SRR7170476_2.fastq trimmed: SRR7170476-trimmed-pair1.fastq, SRR7170476-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:32:15 2025 >> started Wed Feb 12 22:32:29 2025 >> done (14.477s) 13973448 read pairs processed; of these: 13804 ( 0.10%) short read pairs filtered out after trimming by size control 14144 ( 0.10%) empty read pairs filtered out after trimming by size control 13945500 (99.80%) read pairs available; of these: 7769915 (55.72%) trimmed read pairs available after processing 6175585 (44.28%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 2 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 3 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 4 0.00% 28 5 0.00% 29 5 0.00% 30 3 0.00% 31 8 0.00% 32 6 0.00% 33 10 0.00% 34 13 0.00% 35 4 0.00% 36 10 0.00% 37 14 0.00% 38 12 0.00% 39 18 0.00% 40 21 0.00% 41 22 0.00% 42 18 0.00% 43 35 0.00% 44 39 0.00% 45 34 0.00% 46 45 0.00% 47 49 0.00% 48 49 0.00% 49 55 0.00% 50 82 0.00% 51 94 0.00% 52 115 0.00% 53 127 0.00% 54 117 0.00% 55 153 0.00% 56 144 0.00% 57 162 0.00% 58 206 0.00% 59 244 0.00% 60 262 0.00% 61 301 0.00% 62 397 0.00% 63 385 0.00% 64 442 0.00% 65 444 0.00% 66 513 0.00% 67 553 0.00% 68 644 0.00% 69 728 0.01% 70 777 0.01% 71 933 0.01% 72 1101 0.01% 73 1209 0.01% 74 1393 0.01% 75 1595 0.01% 76 2093 0.02% 77 2133 0.02% 78 2097 0.02% 79 2172 0.02% 80 2439 0.02% 81 2722 0.02% 82 3227 0.02% 83 3518 0.03% 84 4376 0.03% 85 5127 0.04% 86 5354 0.04% 87 5719 0.04% 88 5955 0.04% 89 6288 0.05% 90 6682 0.05% 91 7024 0.05% 92 7743 0.06% 93 8373 0.06% 94 8862 0.06% 95 9265 0.07% 96 9962 0.07% 97 10379 0.07% 98 10609 0.08% 99 11097 0.08% 100 11831 0.08% 101 12079 0.09% 102 13104 0.09% 103 13788 0.10% 104 14655 0.11% 105 15192 0.11% 106 15538 0.11% 107 16121 0.12% 108 16246 0.12% 109 17070 0.12% 110 17519 0.13% 111 17937 0.13% 112 18718 0.13% 113 19453 0.14% 114 20400 0.15% 115 21192 0.15% 116 21869 0.16% 117 22510 0.16% 118 22811 0.16% 119 23263 0.17% 120 24041 0.17% 121 24730 0.18% 122 25636 0.18% 123 26683 0.19% 124 27776 0.20% 125 28744 0.21% 126 30250 0.22% 127 31816 0.23% 128 33266 0.24% 129 34397 0.25% 130 35869 0.26% 131 37556 0.27% 132 39706 0.28% 133 42620 0.31% 134 45889 0.33% 135 49454 0.35% 136 53359 0.38% 137 58318 0.42% 138 63071 0.45% 139 70361 0.50% 140 77712 0.56% 141 88202 0.63% 142 101154 0.73% 143 118742 0.85% 144 144814 1.04% 145 188088 1.35% 146 230544 1.65% 147 327481 2.35% 148 498390 3.57% 149 956768 6.86% 150 3746344 26.86% 151 6175585 44.28% 13945500 reads passed initial QC criterion=sequence-density sequence-density=0.37 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=35 prefix-density=0.36 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGGGGACTGGTGGTGCTCGCGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=41.77 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.3 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=sequence-density sequence-density=0.80 sequence-density-rank=1 fanout-score=2.06 fanout-score-rank=36 prefix-density=0.80 prefix-fanout=2.1 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.02 sequence-density-rank=35 fanout-score=54.09 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=9.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170476 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:33:11 Started mapping on | Feb 12 22:33:11 Finished on | Feb 12 22:35:02 Mapping speed, Million of reads per hour | 452.29 Number of input reads | 13945500 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12883287 Uniquely mapped reads % | 92.38% Average mapped length | 293.37 Number of splices: Total | 12440993 Number of splices: Annotated (sjdb) | 12128262 Number of splices: GT/AG | 12205888 Number of splices: GC/AG | 185988 Number of splices: AT/AC | 7830 Number of splices: Non-canonical | 41287 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366371 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 27187 % of reads mapped to too many loci | 0.19% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.73% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 708216 708216 708216 N_multimapping 366371 366371 366371 N_noFeature 477471 12659678 547616 N_ambiguous 265704 1084 111637 UnstrandedReadsAssigned:12140112 PositiveStrandReadsAssigned:222525 NegativeStrandReadsAssigned:12224034 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170476 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170476-trimmed-pair1.fastq SRR7170476-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,945,500 reads, 12,189,052 reads pseudoaligned [quant] estimated average fragment length: 274.517 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,091 rounds 52401 SRR7170476.ke.tsv 34699 SRR7170476.se.tsv 87100 total ==> SRR7170476.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.48 740 31.0949 Potri.005G024800.1.v4.1 1035 761.483 449 43.2225 Potri.004G059700.1.v4.1 961 687.505 2 0.213245 Potri.007G009000.2.v4.1 1416 1142.48 0 0 Potri.003G141000.2.v4.1 2943 2669.48 549.308 15.0839 Potri.016G087400.1.v4.1 270 77.7128 692 652.737 Potri.015G069301.1.v4.1 564 296.821 0 0 Potri.010G195200.1.v4.1 1773 1499.48 246 12.0259 Potri.012G127500.1.v4.1 977 703.494 433 45.1182 ==> SRR7170476.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 397 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 327 Potri.001G212900.v4.1 2 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 5 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 7 SRR7170476 completed mapping pipeline successfully