Starting /dee2/code/volunteer_pipeline.sh SRR7170477 current disk space = 3050449244160 free memory = 1573210636 SRR7170477 SRAfilesize 7a95a08b9b2ba905eb085a83cc62e6f3 SRR7170477.sra SRR7170477.sra file validated SRR7170477 is paired end SRR7170477 is conventional basespace SRR7170477 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170477_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.3775 18.0 18.0 30.0 18.0 32.0 2 30.6085 31.0 30.0 33.0 27.0 33.0 3 31.50475 33.0 31.0 33.0 28.0 33.0 4 31.96425 33.0 31.0 33.0 29.0 33.0 5 32.7635 33.0 33.0 33.0 31.0 34.0 6 36.532 38.0 37.0 38.0 34.0 38.0 7 36.98425 38.0 38.0 38.0 35.0 38.0 8 37.26525 38.0 38.0 38.0 36.0 38.0 9 37.467 38.0 38.0 38.0 37.0 38.0 10-14 36.721900000000005 38.0 37.4 38.0 33.6 38.0 15-19 37.509699999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.52595 38.0 38.0 38.0 37.2 38.0 25-29 36.56165 38.0 37.2 38.0 32.0 38.0 30-34 37.270599999999995 38.0 38.0 38.0 36.6 38.0 35-39 37.3586 38.0 38.0 38.0 36.8 38.0 40-44 37.482499999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.406949999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.352 38.0 38.0 38.0 37.0 38.0 55-59 37.26925 38.0 38.0 38.0 36.6 38.0 60-64 37.21470000000001 38.0 38.0 38.0 36.0 38.0 65-69 37.12265000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.619 38.0 37.8 38.0 34.0 38.0 75-79 36.970600000000005 38.0 38.0 38.0 36.0 38.0 80-84 36.91844999999999 38.0 38.0 38.0 35.6 38.0 85-89 36.795249999999996 38.0 38.0 38.0 35.0 38.0 90-94 36.6475 38.0 38.0 38.0 34.4 38.0 95-99 36.6516 38.0 38.0 38.0 34.4 38.0 100-104 36.634 38.0 38.0 38.0 34.2 38.0 105-109 36.52975 38.0 38.0 38.0 34.0 38.0 110-114 36.36729999999999 38.0 37.6 38.0 33.8 38.0 115-119 35.957899999999995 38.0 37.0 38.0 32.4 38.0 120-124 35.8433 38.0 37.0 38.0 31.6 38.0 125-129 35.67595 38.0 36.4 38.0 31.4 38.0 130-134 35.360850000000006 38.0 36.0 38.0 30.6 38.0 135-139 34.7253 38.0 35.2 38.0 26.8 38.0 140-144 34.637449999999994 38.0 35.0 38.0 27.8 38.0 145-149 34.242799999999995 38.0 34.2 38.0 27.2 38.0 150-151 30.221875 35.5 28.0 38.0 12.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 4.0 19 0.0 20 5.0 21 3.0 22 5.0 23 5.0 24 8.0 25 8.0 26 13.0 27 12.0 28 23.0 29 26.0 30 34.0 31 42.0 32 79.0 33 122.0 34 159.0 35 362.0 36 940.0 37 2144.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.98172323759791 10.966057441253264 12.140992167101828 37.911227154047 2 22.828535669586984 14.868585732165208 32.46558197747184 29.837296620775973 3 18.425 21.4 26.450000000000003 33.725 4 22.625 27.400000000000002 23.9 26.075 5 23.549999999999997 32.275 24.275 19.900000000000002 6 19.625 34.849999999999994 24.4 21.125 7 13.775 26.6 41.5 18.125 8 16.675 26.85 31.15 25.324999999999996 9 16.575 24.425 35.099999999999994 23.9 10-14 19.415 30.09 27.305 23.189999999999998 15-19 19.314999999999998 29.04 27.765 23.880000000000003 20-24 19.384999999999998 29.325000000000003 27.29 24.0 25-29 19.6 28.9 27.48 24.02 30-34 19.895 28.595 27.955000000000002 23.555 35-39 19.665 28.765 27.77 23.799999999999997 40-44 19.905 29.270000000000003 26.96 23.865 45-49 20.055 29.160000000000004 27.450000000000003 23.335 50-54 20.215 28.465 27.93 23.39 55-59 20.05 28.794999999999998 27.715 23.44 60-64 19.72 28.925 27.295 24.060000000000002 65-69 20.200000000000003 29.345 27.284999999999997 23.169999999999998 70-74 19.919999999999998 28.655 27.055 24.37 75-79 20.41 29.360000000000003 27.229999999999997 23.0 80-84 19.655 28.74 27.815 23.79 85-89 19.975 28.595 27.175 24.255 90-94 20.365 28.055000000000003 27.49 24.09 95-99 20.44 29.080000000000002 26.68 23.799999999999997 100-104 20.575 28.860000000000003 26.840000000000003 23.724999999999998 105-109 20.845 28.78 27.034999999999997 23.34 110-114 20.26 28.799999999999997 27.215 23.724999999999998 115-119 20.255000000000003 28.275 27.46 24.01 120-124 20.424999999999997 28.575 26.740000000000002 24.26 125-129 20.615 28.720000000000002 26.965 23.7 130-134 21.044999999999998 27.83 27.134999999999998 23.990000000000002 135-139 20.93 28.199999999999996 27.150000000000002 23.72 140-144 20.595 27.944999999999997 27.21 24.25 145-149 20.73 28.125 26.810000000000002 24.335 150-151 21.025 28.3875 26.875 23.7125 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.0 20 1.0 21 0.0 22 1.5 23 3.0 24 3.0 25 4.0 26 5.0 27 6.5 28 10.0 29 14.0 30 16.5 31 28.5 32 46.0 33 53.5 34 62.0 35 84.0 36 103.5 37 115.5 38 133.0 39 166.5 40 189.0 41 205.0 42 227.0 43 243.0 44 262.5 45 245.5 46 239.0 47 268.5 48 238.5 49 202.5 50 180.5 51 134.5 52 103.5 53 89.5 54 73.0 55 57.0 56 48.0 57 33.5 58 22.0 59 21.0 60 18.0 61 12.0 62 10.0 63 4.5 64 3.0 65 2.5 66 0.5 67 2.0 68 2.0 69 2.0 70 1.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.25 2 0.125 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.25 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4375 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8500000000000001 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.275 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.625 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.45 0.0 0.0 0.0 0.0 116-117 2.7750000000000004 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.375 0.0 0.0 0.0 0.0 124-125 3.6625 0.0 0.0 0.0 0.0 126-127 4.0 0.0 0.0 0.0 0.0 128-129 4.425000000000001 0.0 0.0 0.0 0.0 130-131 4.65 0.0 0.0 0.0 0.0 132-133 4.9875 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 6.075 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170477 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170477_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.10125 33.0 33.0 34.0 32.0 34.0 2 33.1815 34.0 33.0 34.0 33.0 34.0 3 33.1925 34.0 33.0 34.0 33.0 34.0 4 33.207 34.0 33.0 34.0 33.0 34.0 5 33.211 34.0 33.0 34.0 33.0 34.0 6 37.40925 38.0 38.0 38.0 38.0 38.0 7 37.4325 38.0 38.0 38.0 38.0 38.0 8 37.40625 38.0 38.0 38.0 38.0 38.0 9 37.374 38.0 38.0 38.0 37.0 38.0 10-14 37.341800000000006 38.0 38.0 38.0 37.6 38.0 15-19 37.31155 38.0 38.0 38.0 37.2 38.0 20-24 37.24135 38.0 38.0 38.0 37.0 38.0 25-29 37.2256 38.0 38.0 38.0 37.0 38.0 30-34 37.267 38.0 38.0 38.0 37.0 38.0 35-39 37.26345 38.0 38.0 38.0 37.0 38.0 40-44 37.196 38.0 38.0 38.0 37.0 38.0 45-49 37.161649999999995 38.0 38.0 38.0 37.0 38.0 50-54 36.93305 38.0 38.0 38.0 36.0 38.0 55-59 37.02175 38.0 38.0 38.0 36.6 38.0 60-64 36.54805 38.0 37.8 38.0 34.0 38.0 65-69 36.9621 38.0 38.0 38.0 36.2 38.0 70-74 36.56125 38.0 38.0 38.0 34.8 38.0 75-79 36.7299 38.0 38.0 38.0 35.6 38.0 80-84 35.9793 38.0 37.0 38.0 30.4 38.0 85-89 35.3281 38.0 36.0 38.0 27.8 38.0 90-94 36.56165 38.0 37.8 38.0 34.8 38.0 95-99 36.48755 38.0 38.0 38.0 34.6 38.0 100-104 36.1871 38.0 37.6 38.0 32.4 38.0 105-109 35.76355 38.0 37.0 38.0 31.4 38.0 110-114 35.72285 38.0 37.0 38.0 30.8 38.0 115-119 35.923199999999994 38.0 37.0 38.0 33.2 38.0 120-124 35.72735 38.0 37.0 38.0 32.4 38.0 125-129 35.5356 38.0 36.4 38.0 30.6 38.0 130-134 34.743449999999996 38.0 35.0 38.0 27.6 38.0 135-139 34.7039 38.0 35.2 38.0 28.0 38.0 140-144 33.95625 38.0 33.6 38.0 23.2 38.0 145-149 33.10695 38.0 33.0 38.0 18.8 38.0 150-151 27.811875 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 6.0 4 2.0 5 1.0 6 0.0 7 5.0 8 1.0 9 3.0 10 0.0 11 2.0 12 2.0 13 0.0 14 3.0 15 1.0 16 1.0 17 0.0 18 1.0 19 3.0 20 1.0 21 6.0 22 6.0 23 7.0 24 8.0 25 9.0 26 7.0 27 20.0 28 22.0 29 32.0 30 48.0 31 59.0 32 76.0 33 104.0 34 184.0 35 344.0 36 798.0 37 2232.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.325 19.35 15.425 28.9 2 25.45 26.55 30.599999999999998 17.4 3 19.475 28.999999999999996 31.724999999999998 19.8 4 24.3 32.6 24.325 18.775 5 23.625 36.95 23.175 16.25 6 20.95 37.325 23.65 18.075 7 19.900000000000002 20.974999999999998 39.074999999999996 20.05 8 22.0 25.05 27.400000000000002 25.55 9 21.9 24.375 30.8 22.925 10-14 23.405 28.835 26.595000000000002 21.165 15-19 22.375 27.985 28.144999999999996 21.495 20-24 23.64 27.750000000000004 27.98 20.630000000000003 25-29 23.1911595579779 28.271413570678533 27.296364818240914 21.241062053102656 30-34 23.161158057902895 27.636381819090953 27.461373068653433 21.741087054352718 35-39 23.647364736473648 27.722772277227726 27.677767776777678 20.95209520952095 40-44 23.756187809390468 28.41142057102855 27.431371568578427 20.40102005100255 45-49 23.656182809140457 27.896394819740987 27.91639581979099 20.531026551327567 50-54 23.405 27.700000000000003 28.015 20.880000000000003 55-59 23.65 27.310000000000002 27.99 21.05 60-64 23.43617180859043 27.496374818740936 27.646382319115958 21.42107105355268 65-69 23.095 27.389999999999997 28.155 21.36 70-74 23.528529279391908 27.859178876831525 27.634145121768267 20.9781467220083 75-79 23.975993998499625 27.671917979494875 28.037009252313077 20.315078769692423 80-84 23.344668933786757 27.740548109621926 27.690538107621528 21.224244848969796 85-89 23.605 28.09 27.634999999999998 20.669999999999998 90-94 23.256162808140406 27.376368818440923 28.38641932096605 20.981049052452622 95-99 23.669999999999998 27.889999999999997 27.685 20.755000000000003 100-104 23.22232223222322 27.367736773677372 28.432843284328435 20.977097709770977 105-109 23.645 27.985 28.244999999999997 20.125 110-114 24.261213060653034 28.126406320316015 27.1963598179909 20.41602080104005 115-119 24.019803960792157 27.925585117023406 27.50550110022004 20.549109821964393 120-124 24.53745374537454 27.86278627862786 26.767676767676768 20.83208320832083 125-129 23.982194658397518 28.423527058117436 27.563268980694204 20.031009302790835 130-134 24.73494698939788 27.535507101420286 27.905581116223242 19.82396479295859 135-139 24.532453245324533 28.272827282728276 27.26772677267727 19.926992699269928 140-144 24.301215060753037 28.061403070153506 27.83639181959098 19.800990049502477 145-149 24.663699554933242 27.819172875931393 27.554133119967993 19.962994449167375 150-151 24.3935983995999 28.369592398099524 27.79444861215304 19.442360590147537 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 3.0 22 3.0 23 2.5 24 1.5 25 2.0 26 4.0 27 5.5 28 8.0 29 9.0 30 12.5 31 15.0 32 17.0 33 30.0 34 43.5 35 57.0 36 77.0 37 95.0 38 120.0 39 160.0 40 205.5 41 228.0 42 258.5 43 284.5 44 270.0 45 268.5 46 274.5 47 259.5 48 232.5 49 213.0 50 173.5 51 130.5 52 117.5 53 101.0 54 76.0 55 57.0 56 46.5 57 35.0 58 27.0 59 20.5 60 16.5 61 13.5 62 7.0 63 6.0 64 6.0 65 2.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.005 35-39 0.01 40-44 0.005 45-49 0.005 50-54 0.0 55-59 0.0 60-64 0.005 65-69 0.0 70-74 0.015 75-79 0.025 80-84 0.02 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.01 105-109 0.0 110-114 0.005 115-119 0.02 120-124 0.01 125-129 0.03 130-134 0.02 135-139 0.01 140-144 0.005 145-149 0.015 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42109237352128 98.75 2 0.47822803926503904 0.95 3 0.10067958721369243 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.05 0.0 0.0 0.0 0.0 80-81 0.0625 0.0 0.0 0.0 0.0 82-83 0.075 0.0 0.0 0.0 0.0 84-85 0.1 0.0 0.0 0.0 0.0 86-87 0.125 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.275 0.0 0.0 0.0 0.0 92-93 0.36250000000000004 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.575 0.0 0.0 0.0 0.0 98-99 0.675 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.1 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3875000000000002 0.0 0.0 0.0 0.0 108-109 1.6125 0.0 0.0 0.0 0.0 110-111 1.875 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.4625 0.0 0.0 0.0 0.0 116-117 2.8 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.1500000000000004 0.0 0.0 0.0 0.0 122-123 3.3625 0.0 0.0 0.0 0.0 124-125 3.6375 0.0 0.0 0.0 0.0 126-127 3.975 0.0 0.0 0.0 0.0 128-129 4.4 0.0 0.0 0.0 0.0 130-131 4.625 0.0 0.0 0.0 0.0 132-133 4.9625 0.0 0.0 0.0 0.0 134-135 5.2875 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 6.125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCAACCT 10 0.006830828 145.0 1 TTGGTGG 10 0.006830828 145.0 1 >>END_MODULE Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673944 spots for SRR7170477.sra Written 673944 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra Read 673929 spots for SRR7170477.sra Written 673929 spots for SRR7170477.sra SRR ids: ['SRR7170477.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_jg7rrobl SRR7170477.sra spots: 13478595 blocks: [[1, 673929], [673930, 1347858], [1347859, 2021787], [2021788, 2695716], [2695717, 3369645], [3369646, 4043574], [4043575, 4717503], [4717504, 5391432], [5391433, 6065361], [6065362, 6739290], [6739291, 7413219], [7413220, 8087148], [8087149, 8761077], [8761078, 9435006], [9435007, 10108935], [10108936, 10782864], [10782865, 11456793], [11456794, 12130722], [12130723, 12804651], [12804652, 13478595]] SRR7170477 file size 4545753 SRR7170477 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170477 SRR7170477_1.fastq SRR7170477_2.fastq Input file: SRR7170477_1.fastq Paired file: SRR7170477_2.fastq trimmed: SRR7170477-trimmed-pair1.fastq, SRR7170477-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:44:45 2025 >> started Wed Feb 12 22:44:59 2025 >> done (14.188s) 13478595 read pairs processed; of these: 12793 ( 0.09%) short read pairs filtered out after trimming by size control 13959 ( 0.10%) empty read pairs filtered out after trimming by size control 13451843 (99.80%) read pairs available; of these: 7353210 (54.66%) trimmed read pairs available after processing 6098633 (45.34%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 2 0.00% 20 5 0.00% 21 2 0.00% 22 4 0.00% 23 2 0.00% 24 2 0.00% 25 2 0.00% 26 1 0.00% 27 3 0.00% 28 5 0.00% 29 4 0.00% 30 3 0.00% 31 7 0.00% 32 11 0.00% 33 7 0.00% 34 12 0.00% 35 9 0.00% 36 14 0.00% 37 9 0.00% 38 16 0.00% 39 22 0.00% 40 16 0.00% 41 23 0.00% 42 25 0.00% 43 32 0.00% 44 28 0.00% 45 40 0.00% 46 39 0.00% 47 43 0.00% 48 52 0.00% 49 71 0.00% 50 84 0.00% 51 112 0.00% 52 108 0.00% 53 132 0.00% 54 124 0.00% 55 148 0.00% 56 172 0.00% 57 188 0.00% 58 238 0.00% 59 267 0.00% 60 308 0.00% 61 345 0.00% 62 454 0.00% 63 472 0.00% 64 490 0.00% 65 525 0.00% 66 600 0.00% 67 606 0.00% 68 751 0.01% 69 798 0.01% 70 893 0.01% 71 1087 0.01% 72 1284 0.01% 73 1485 0.01% 74 1590 0.01% 75 1705 0.01% 76 2039 0.02% 77 2195 0.02% 78 2248 0.02% 79 2475 0.02% 80 2691 0.02% 81 3088 0.02% 82 3597 0.03% 83 4016 0.03% 84 4951 0.04% 85 5528 0.04% 86 5867 0.04% 87 6100 0.05% 88 6614 0.05% 89 6914 0.05% 90 7172 0.05% 91 7765 0.06% 92 8228 0.06% 93 9073 0.07% 94 9935 0.07% 95 10177 0.08% 96 10951 0.08% 97 11110 0.08% 98 11626 0.09% 99 11887 0.09% 100 12465 0.09% 101 13000 0.10% 102 13811 0.10% 103 14495 0.11% 104 15160 0.11% 105 15820 0.12% 106 16501 0.12% 107 16905 0.13% 108 17247 0.13% 109 17646 0.13% 110 17792 0.13% 111 18655 0.14% 112 19420 0.14% 113 19900 0.15% 114 20618 0.15% 115 21580 0.16% 116 22046 0.16% 117 22543 0.17% 118 23215 0.17% 119 23495 0.17% 120 24143 0.18% 121 24348 0.18% 122 25054 0.19% 123 26352 0.20% 124 27113 0.20% 125 28082 0.21% 126 29599 0.22% 127 30381 0.23% 128 31891 0.24% 129 32709 0.24% 130 34245 0.25% 131 35669 0.27% 132 37224 0.28% 133 39428 0.29% 134 41885 0.31% 135 45492 0.34% 136 48765 0.36% 137 51989 0.39% 138 56680 0.42% 139 62886 0.47% 140 69243 0.51% 141 78677 0.58% 142 89828 0.67% 143 105371 0.78% 144 127876 0.95% 145 168415 1.25% 146 204971 1.52% 147 292315 2.17% 148 450744 3.35% 149 876488 6.52% 150 3621304 26.92% 151 6098633 45.34% 13451843 reads passed initial QC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=33 prefix-density=0.43 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=79.04 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.8 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.40 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=32 prefix-density=0.40 prefix-fanout=2.0 sequence=TACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTTCCAAGATTTGATGAGTCCCTAGCTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=48.46 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170477 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:45:43 Started mapping on | Feb 12 22:45:43 Finished on | Feb 12 22:47:04 Mapping speed, Million of reads per hour | 597.86 Number of input reads | 13451843 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12539880 Uniquely mapped reads % | 93.22% Average mapped length | 293.18 Number of splices: Total | 11844637 Number of splices: Annotated (sjdb) | 11585024 Number of splices: GT/AG | 11624080 Number of splices: GC/AG | 178500 Number of splices: AT/AC | 6891 Number of splices: Non-canonical | 35166 Mismatch rate per base, % | 0.43% Deletion rate per base | 0.03% Deletion average length | 2.55 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 359056 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 46304 % of reads mapped to too many loci | 0.34% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.67% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 564671 564671 564671 N_multimapping 359056 359056 359056 N_noFeature 408763 12332291 462338 N_ambiguous 242758 952 88301 UnstrandedReadsAssigned:11888359 PositiveStrandReadsAssigned:206637 NegativeStrandReadsAssigned:11989241 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170477 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170477-trimmed-pair1.fastq SRR7170477-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,451,843 reads, 11,973,854 reads pseudoaligned [quant] estimated average fragment length: 263.439 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,060 rounds 52401 SRR7170477.ke.tsv 34699 SRR7170477.se.tsv 87100 total ==> SRR7170477.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.56 671 28.7828 Potri.005G024800.1.v4.1 1035 772.561 272 26.5132 Potri.004G059700.1.v4.1 961 698.577 6 0.64679 Potri.007G009000.2.v4.1 1416 1153.56 0 0 Potri.003G141000.2.v4.1 2943 2680.56 562.341 15.7979 Potri.016G087400.1.v4.1 270 78.0015 858 828.343 Potri.015G069301.1.v4.1 564 305.698 0 0 Potri.010G195200.1.v4.1 1773 1510.56 81 4.03806 Potri.012G127500.1.v4.1 977 714.561 282 29.7191 ==> SRR7170477.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 951 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 265 Potri.001G212900.v4.1 25 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 10 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170477 completed mapping pipeline successfully