Starting /dee2/code/volunteer_pipeline.sh SRR7170478 current disk space = 3050488619008 free memory = 1581664044 SRR7170478 SRAfilesize 90536d9b0882db2e22e504d3e5b3e658 SRR7170478.sra SRR7170478.sra file validated SRR7170478 is paired end SRR7170478 is conventional basespace SRR7170478 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170478_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.48475 18.0 18.0 18.0 18.0 32.0 2 29.62 30.0 27.0 31.0 27.0 33.0 3 31.5945 33.0 31.0 33.0 29.0 33.0 4 32.1215 33.0 33.0 33.0 31.0 33.0 5 32.91 33.0 33.0 33.0 32.0 34.0 6 36.83875 38.0 37.0 38.0 35.0 38.0 7 37.214 38.0 38.0 38.0 36.0 38.0 8 37.3555 38.0 38.0 38.0 36.0 38.0 9 37.39975 38.0 38.0 38.0 37.0 38.0 10-14 37.508050000000004 38.0 38.0 38.0 37.0 38.0 15-19 37.516200000000005 38.0 38.0 38.0 37.2 38.0 20-24 37.3305 38.0 38.0 38.0 36.6 38.0 25-29 36.819599999999994 38.0 37.8 38.0 34.8 38.0 30-34 37.370799999999996 38.0 38.0 38.0 36.6 38.0 35-39 37.4402 38.0 38.0 38.0 37.0 38.0 40-44 36.8285 38.0 37.8 38.0 34.6 38.0 45-49 34.76005 37.8 34.6 38.0 25.0 38.0 50-54 37.0384 38.0 37.8 38.0 35.6 38.0 55-59 37.15955 38.0 38.0 38.0 36.0 38.0 60-64 37.02135 38.0 38.0 38.0 35.8 38.0 65-69 36.95385 38.0 38.0 38.0 35.4 38.0 70-74 36.89175 38.0 38.0 38.0 35.0 38.0 75-79 36.83365 38.0 38.0 38.0 35.0 38.0 80-84 36.7392 38.0 38.0 38.0 34.4 38.0 85-89 36.41345 38.0 37.0 38.0 34.0 38.0 90-94 36.19840000000001 38.0 37.0 38.0 33.4 38.0 95-99 36.3902 38.0 37.0 38.0 33.8 38.0 100-104 36.28015 38.0 37.0 38.0 33.6 38.0 105-109 36.16225 38.0 37.0 38.0 33.2 38.0 110-114 35.605 38.0 36.2 38.0 30.6 38.0 115-119 35.24175 38.0 35.4 38.0 29.2 38.0 120-124 35.03875 38.0 35.0 38.0 28.0 38.0 125-129 34.768100000000004 38.0 34.8 38.0 27.6 38.0 130-134 34.494550000000004 38.0 34.6 38.0 26.6 38.0 135-139 33.588800000000006 38.0 33.2 38.0 22.4 38.0 140-144 28.436299999999996 32.4 23.0 37.0 10.2 38.0 145-149 25.206400000000002 31.4 12.6 37.4 2.0 38.0 150-151 15.63125 7.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 16 1.0 17 3.0 18 0.0 19 2.0 20 4.0 21 5.0 22 5.0 23 7.0 24 5.0 25 17.0 26 21.0 27 32.0 28 41.0 29 44.0 30 73.0 31 89.0 32 144.0 33 258.0 34 412.0 35 827.0 36 1482.0 37 528.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.784253578732105 9.713701431492842 13.113496932515337 40.38854805725972 2 21.725 15.775 33.525 28.975 3 20.375 19.225 25.525 34.875 4 23.625 27.05 22.875 26.450000000000003 5 22.55 32.824999999999996 24.474999999999998 20.150000000000002 6 19.075 35.6 25.924999999999997 19.400000000000002 7 14.75 26.85 41.325 17.075000000000003 8 18.425 25.124999999999996 31.424999999999997 25.025 9 17.5 24.45 34.4 23.65 10-14 19.355 30.7 27.229999999999997 22.715 15-19 19.384999999999998 28.810000000000002 28.000000000000004 23.805 20-24 19.425 28.84 27.955000000000002 23.78 25-29 19.895 28.83 28.28 22.994999999999997 30-34 19.84 28.9 28.060000000000002 23.200000000000003 35-39 19.8 28.845 28.265 23.09 40-44 20.041002050102506 29.321466073303665 26.916345817290864 23.721186059302966 45-49 19.93 29.134999999999998 27.405 23.53 50-54 20.32 28.794999999999998 27.744999999999997 23.14 55-59 19.725 28.715000000000003 27.794999999999998 23.765 60-64 20.45 28.804999999999996 27.185 23.56 65-69 20.11 28.799999999999997 28.000000000000004 23.09 70-74 20.065016254063515 28.592148037009252 27.45686421605401 23.885971492873217 75-79 20.13 29.01 27.47 23.39 80-84 20.21 28.485 27.855 23.45 85-89 20.386019300965046 28.38641932096605 27.51637581879094 23.711185559277965 90-94 20.0 28.8344172086043 27.668834417208604 23.496748374187092 95-99 20.156046814044213 28.543563068920676 27.293187956386916 24.007202160648195 100-104 20.165 28.77 27.66 23.405 105-109 20.34 29.160000000000004 27.345000000000002 23.155 110-114 20.674999999999997 28.549999999999997 27.37 23.405 115-119 20.560000000000002 28.605000000000004 27.375 23.46 120-124 20.119999999999997 28.73 27.279999999999998 23.87 125-129 20.465 28.265 27.015 24.255 130-134 20.715 28.64 27.125 23.52 135-139 20.625 28.055000000000003 27.155 24.165 140-144 20.53 28.115000000000002 27.495000000000005 23.86 145-149 20.985 28.21 27.175 23.630000000000003 150-151 20.599999999999998 28.849999999999998 26.787499999999998 23.7625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 1.0 18 1.0 19 0.0 20 0.5 21 2.0 22 2.0 23 1.0 24 1.5 25 4.5 26 5.5 27 5.5 28 8.5 29 13.5 30 21.0 31 27.5 32 34.0 33 52.5 34 64.0 35 78.0 36 98.0 37 118.5 38 149.5 39 178.5 40 196.5 41 218.5 42 233.0 43 243.0 44 256.0 45 248.0 46 252.0 47 260.0 48 236.5 49 199.0 50 176.5 51 148.5 52 114.0 53 89.5 54 63.5 55 44.0 56 40.0 57 32.5 58 23.5 59 21.0 60 15.0 61 8.5 62 4.0 63 1.0 64 1.0 65 1.0 66 1.0 67 1.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.1999999999999997 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.025 75-79 0.0 80-84 0.0 85-89 0.005 90-94 0.05 95-99 0.03 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.77449260836883 99.55000000000001 2 0.22550739163117012 0.44999999999999996 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.4125 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.0875 0.0 0.0 0.0 0.0 114-115 2.2375 0.0 0.0 0.0 0.0 116-117 2.4625 0.0 0.0 0.0 0.0 118-119 2.675 0.0 0.0 0.0 0.0 120-121 2.9375 0.0 0.0 0.0 0.0 122-123 3.1625 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.9125 0.0 0.0 0.0 0.0 128-129 4.2 0.0 0.0 0.0 0.0 130-131 4.3375 0.0 0.0 0.0 0.0 132-133 4.575 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.1625 0.0 0.0 0.0 0.0 138-139 5.3625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATATGT 10 0.0068343505 144.975 7 GCCTATT 10 0.0068343505 144.975 2 ATATATG 10 0.0068343505 144.975 6 >>END_MODULE SRR7170478 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170478_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.21975 34.0 33.0 34.0 33.0 34.0 2 33.26875 34.0 33.0 34.0 33.0 34.0 3 33.31 34.0 33.0 34.0 33.0 34.0 4 33.2615 34.0 33.0 34.0 33.0 34.0 5 33.31725 34.0 33.0 34.0 33.0 34.0 6 37.466 38.0 38.0 38.0 38.0 38.0 7 37.57925 38.0 38.0 38.0 38.0 38.0 8 37.55225 38.0 38.0 38.0 38.0 38.0 9 37.5805 38.0 38.0 38.0 38.0 38.0 10-14 36.759800000000006 38.0 37.0 38.0 33.6 38.0 15-19 37.12115 38.0 37.8 38.0 35.6 38.0 20-24 37.135749999999994 38.0 38.0 38.0 36.6 38.0 25-29 37.2242 38.0 38.0 38.0 36.8 38.0 30-34 37.35895000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.36815 38.0 38.0 38.0 37.4 38.0 40-44 37.40695 38.0 38.0 38.0 37.4 38.0 45-49 36.348 38.0 36.4 38.0 32.2 38.0 50-54 36.53355 38.0 37.4 38.0 33.0 38.0 55-59 37.38375 38.0 38.0 38.0 37.0 38.0 60-64 37.223400000000005 38.0 38.0 38.0 36.8 38.0 65-69 37.17845 38.0 38.0 38.0 36.6 38.0 70-74 37.16805 38.0 38.0 38.0 36.8 38.0 75-79 37.1733 38.0 38.0 38.0 36.6 38.0 80-84 37.11465 38.0 38.0 38.0 36.0 38.0 85-89 37.0846 38.0 38.0 38.0 36.0 38.0 90-94 36.9959 38.0 38.0 38.0 36.0 38.0 95-99 36.85665 38.0 38.0 38.0 35.2 38.0 100-104 36.66270000000001 38.0 38.0 38.0 34.8 38.0 105-109 36.53734999999999 38.0 38.0 38.0 34.0 38.0 110-114 36.520950000000006 38.0 38.0 38.0 34.0 38.0 115-119 36.29695 38.0 37.8 38.0 34.0 38.0 120-124 35.99640000000001 38.0 37.0 38.0 32.4 38.0 125-129 35.4409 38.0 36.0 38.0 30.8 38.0 130-134 35.3236 38.0 36.0 38.0 30.4 38.0 135-139 34.792449999999995 38.0 35.2 38.0 28.4 38.0 140-144 33.92735 38.0 33.2 38.0 24.0 38.0 145-149 33.1971 38.0 33.0 38.0 19.8 38.0 150-151 27.408250000000002 34.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 3.0 4 0.0 5 0.0 6 1.0 7 0.0 8 1.0 9 0.0 10 1.0 11 2.0 12 2.0 13 3.0 14 1.0 15 1.0 16 1.0 17 2.0 18 2.0 19 1.0 20 2.0 21 3.0 22 4.0 23 3.0 24 6.0 25 15.0 26 11.0 27 7.0 28 21.0 29 27.0 30 42.0 31 51.0 32 61.0 33 93.0 34 157.0 35 305.0 36 844.0 37 2326.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.699999999999996 19.0 16.05 30.25 2 25.874999999999996 25.525 31.4 17.2 3 20.5 26.974999999999998 33.125 19.400000000000002 4 24.6 33.425 23.474999999999998 18.5 5 24.125 35.6 23.075000000000003 17.2 6 19.8 38.824999999999996 23.125 18.25 7 19.725 21.099999999999998 39.300000000000004 19.875 8 21.825 24.75 28.725 24.7 9 21.45 25.05 31.275 22.225 10-14 23.150000000000002 28.83 26.87 21.15 15-19 22.875 28.32 27.965 20.84 20-24 23.080000000000002 28.439999999999998 27.534999999999997 20.945 25-29 23.215 28.125 27.644999999999996 21.015 30-34 22.564999999999998 28.03 28.294999999999998 21.11 35-39 22.725 28.215 28.04 21.02 40-44 22.825 28.1 28.425 20.65 45-49 23.02 27.805000000000003 28.12 21.055 50-54 22.835 27.76 28.13 21.275 55-59 23.56 27.150000000000002 28.21 21.08 60-64 22.875 28.095 27.950000000000003 21.08 65-69 23.285 27.605 28.265 20.845 70-74 23.755000000000003 27.62 27.515 21.11 75-79 23.855 27.21 27.775 21.16 80-84 23.175 28.43 27.83 20.565 85-89 23.65 27.96 27.92 20.47 90-94 23.52 28.455000000000002 27.794999999999998 20.23 95-99 23.56 27.765 28.060000000000002 20.615 100-104 23.9 28.205000000000002 26.840000000000003 21.055 105-109 23.275000000000002 27.750000000000004 27.889999999999997 21.085 110-114 23.53 28.055000000000003 27.73 20.685000000000002 115-119 24.39 28.134999999999998 27.68 19.794999999999998 120-124 23.65 28.305000000000003 27.98 20.064999999999998 125-129 23.875 28.349999999999998 27.284999999999997 20.49 130-134 24.465 27.775 27.6 20.16 135-139 24.22 28.244999999999997 27.58 19.955000000000002 140-144 24.15 28.444999999999997 27.315 20.09 145-149 24.9 28.134999999999998 27.060000000000002 19.905 150-151 24.1625 28.299999999999997 28.175 19.3625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 1.0 16 1.0 17 0.5 18 1.0 19 0.5 20 0.5 21 1.5 22 2.5 23 2.0 24 0.5 25 2.5 26 5.0 27 6.5 28 7.0 29 8.5 30 13.0 31 19.5 32 30.0 33 38.0 34 52.0 35 73.5 36 90.5 37 107.5 38 132.5 39 153.5 40 185.5 41 215.0 42 234.5 43 267.0 44 274.0 45 283.0 46 284.0 47 257.5 48 238.5 49 198.5 50 169.5 51 151.0 52 116.5 53 96.5 54 79.0 55 56.0 56 37.0 57 27.5 58 24.5 59 19.0 60 11.5 61 7.0 62 6.0 63 4.0 64 1.5 65 2.5 66 2.0 67 0.5 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.72403411941796 99.375 2 0.2007024586051179 0.4 3 0.07526342197691922 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0125 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.025 0.0 0.0 0.0 0.0 80-81 0.025 0.0 0.0 0.0 0.0 82-83 0.05 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2375 0.0 0.0 0.0 0.0 90-91 0.3125 0.0 0.0 0.0 0.0 92-93 0.4 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.6875 0.0 0.0 0.0 0.0 98-99 0.8625 0.0 0.0 0.0 0.0 100-101 0.9624999999999999 0.0 0.0 0.0 0.0 102-103 1.125 0.0 0.0 0.0 0.0 104-105 1.25 0.0 0.0 0.0 0.0 106-107 1.3875 0.0 0.0 0.0 0.0 108-109 1.5499999999999998 0.0 0.0 0.0 0.0 110-111 1.7875 0.0 0.0 0.0 0.0 112-113 2.0375 0.0 0.0 0.0 0.0 114-115 2.1875 0.0 0.0 0.0 0.0 116-117 2.4125 0.0 0.0 0.0 0.0 118-119 2.625 0.0 0.0 0.0 0.0 120-121 2.8875 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.525 0.0 0.0 0.0 0.0 126-127 3.8875 0.0 0.0 0.0 0.0 128-129 4.175 0.0 0.0 0.0 0.0 130-131 4.3625 0.0 0.0 0.0 0.0 132-133 4.737500000000001 0.0 0.0 0.0 0.0 134-135 5.2125 0.0 0.0 0.0 0.0 136-137 5.5875 0.0 0.0 0.0 0.0 138-139 5.925000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCCCCCC 30 0.0014437955 24.166668 35-39 >>END_MODULE Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra Read 798693 spots for SRR7170478.sra Written 798693 spots for SRR7170478.sra SRR ids: ['SRR7170478.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k8jgqjta SRR7170478.sra spots: 15973860 blocks: [[1, 798693], [798694, 1597386], [1597387, 2396079], [2396080, 3194772], [3194773, 3993465], [3993466, 4792158], [4792159, 5590851], [5590852, 6389544], [6389545, 7188237], [7188238, 7986930], [7986931, 8785623], [8785624, 9584316], [9584317, 10383009], [10383010, 11181702], [11181703, 11980395], [11980396, 12779088], [12779089, 13577781], [13577782, 14376474], [14376475, 15175167], [15175168, 15973860]] SRR7170478 file size 5391316 SRR7170478 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170478 SRR7170478_1.fastq SRR7170478_2.fastq Input file: SRR7170478_1.fastq Paired file: SRR7170478_2.fastq trimmed: SRR7170478-trimmed-pair1.fastq, SRR7170478-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:46:28 2025 >> started Wed Feb 12 22:46:48 2025 >> done (19.455s) 15973860 read pairs processed; of these: 9540 ( 0.06%) short read pairs filtered out after trimming by size control 10556 ( 0.07%) empty read pairs filtered out after trimming by size control 15953764 (99.87%) read pairs available; of these: 9098620 (57.03%) trimmed read pairs available after processing 6855144 (42.97%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 3 0.00% 21 2 0.00% 22 1 0.00% 23 4 0.00% 24 3 0.00% 25 2 0.00% 26 4 0.00% 27 3 0.00% 28 4 0.00% 29 2 0.00% 30 6 0.00% 31 9 0.00% 32 7 0.00% 33 6 0.00% 34 4 0.00% 35 4 0.00% 36 8 0.00% 37 10 0.00% 38 16 0.00% 39 12 0.00% 40 18 0.00% 41 21 0.00% 42 27 0.00% 43 31 0.00% 44 30 0.00% 45 35 0.00% 46 39 0.00% 47 56 0.00% 48 58 0.00% 49 65 0.00% 50 77 0.00% 51 104 0.00% 52 83 0.00% 53 99 0.00% 54 96 0.00% 55 120 0.00% 56 135 0.00% 57 150 0.00% 58 202 0.00% 59 214 0.00% 60 248 0.00% 61 263 0.00% 62 336 0.00% 63 380 0.00% 64 456 0.00% 65 482 0.00% 66 511 0.00% 67 606 0.00% 68 636 0.00% 69 724 0.00% 70 821 0.01% 71 956 0.01% 72 1130 0.01% 73 1324 0.01% 74 1376 0.01% 75 1594 0.01% 76 1899 0.01% 77 1984 0.01% 78 2039 0.01% 79 2357 0.01% 80 2650 0.02% 81 2856 0.02% 82 3298 0.02% 83 3795 0.02% 84 4657 0.03% 85 5080 0.03% 86 5339 0.03% 87 5727 0.04% 88 6158 0.04% 89 6518 0.04% 90 6880 0.04% 91 7491 0.05% 92 8026 0.05% 93 8843 0.06% 94 9553 0.06% 95 10197 0.06% 96 10696 0.07% 97 11010 0.07% 98 11514 0.07% 99 11908 0.07% 100 12856 0.08% 101 12973 0.08% 102 13987 0.09% 103 14663 0.09% 104 15404 0.10% 105 16192 0.10% 106 16843 0.11% 107 17318 0.11% 108 17905 0.11% 109 18378 0.12% 110 18640 0.12% 111 19548 0.12% 112 20269 0.13% 113 20654 0.13% 114 21576 0.14% 115 22560 0.14% 116 23551 0.15% 117 23699 0.15% 118 24298 0.15% 119 25021 0.16% 120 25582 0.16% 121 26139 0.16% 122 26778 0.17% 123 28203 0.18% 124 29013 0.18% 125 29951 0.19% 126 31591 0.20% 127 32614 0.20% 128 33969 0.21% 129 35422 0.22% 130 37336 0.23% 131 38663 0.24% 132 39977 0.25% 133 42860 0.27% 134 45684 0.29% 135 49273 0.31% 136 52720 0.33% 137 57756 0.36% 138 63283 0.40% 139 70472 0.44% 140 79441 0.50% 141 90721 0.57% 142 105570 0.66% 143 126391 0.79% 144 156405 0.98% 145 198767 1.25% 146 266695 1.67% 147 379946 2.38% 148 609847 3.82% 149 1215451 7.62% 150 4531674 28.41% 151 6855144 42.97% 15953764 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=18 prefix-density=0.45 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=98.59 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.6 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.82 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=25 prefix-density=0.83 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=135.98 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=8.7 sequence=AAACAAGAGCGCGGTGGATAGGAGGAGAGCATAACCATTTTAGTTAGTCACATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTT SRR7170478 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:47:33 Started mapping on | Feb 12 22:47:33 Finished on | Feb 12 22:49:20 Mapping speed, Million of reads per hour | 536.76 Number of input reads | 15953764 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 15000910 Uniquely mapped reads % | 94.03% Average mapped length | 294.07 Number of splices: Total | 14500874 Number of splices: Annotated (sjdb) | 14186394 Number of splices: GT/AG | 14233940 Number of splices: GC/AG | 216475 Number of splices: AT/AC | 8913 Number of splices: Non-canonical | 41546 Mismatch rate per base, % | 0.35% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 393887 % of reads mapped to multiple loci | 2.47% Number of reads mapped to too many loci | 42586 % of reads mapped to too many loci | 0.27% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.19% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 567867 567867 567867 N_multimapping 393887 393887 393887 N_noFeature 559292 14737607 644285 N_ambiguous 286305 1290 107217 UnstrandedReadsAssigned:14155313 PositiveStrandReadsAssigned:262013 NegativeStrandReadsAssigned:14249408 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170478 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170478-trimmed-pair1.fastq SRR7170478-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,953,764 reads, 14,186,791 reads pseudoaligned [quant] estimated average fragment length: 271.13 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,118 rounds 52401 SRR7170478.ke.tsv 34699 SRR7170478.se.tsv 87100 total ==> SRR7170478.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1747.87 875 31.1504 Potri.005G024800.1.v4.1 1035 764.87 413 33.599 Potri.004G059700.1.v4.1 961 690.88 18 1.62119 Potri.007G009000.2.v4.1 1416 1145.87 0 0 Potri.003G141000.2.v4.1 2943 2672.87 750 17.4601 Potri.016G087400.1.v4.1 270 76.2403 1102 899.417 Potri.015G069301.1.v4.1 564 299.241 0 0 Potri.010G195200.1.v4.1 1773 1502.87 197 8.1566 Potri.012G127500.1.v4.1 977 706.88 90 7.92248 ==> SRR7170478.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 690 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 349 Potri.001G212900.v4.1 4 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 7 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170478 completed mapping pipeline successfully