Starting /dee2/code/volunteer_pipeline.sh SRR7170479 current disk space = 3050458976256 free memory = 1578917676 SRR7170479 SRAfilesize 0a6d31e61a5f3ab230f42db432a4f134 SRR7170479.sra SRR7170479.sra file validated SRR7170479 is paired end SRR7170479 is conventional basespace SRR7170479 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170479_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.5875 18.0 18.0 18.0 18.0 32.0 2 23.97675 25.0 18.0 27.0 18.0 29.0 3 23.6185 25.0 18.0 29.0 18.0 31.0 4 26.45 27.0 25.0 30.0 15.0 31.0 5 29.369 32.0 27.0 32.0 25.0 33.0 6 35.3 37.0 35.0 38.0 31.0 38.0 7 36.82525 38.0 37.0 38.0 34.0 38.0 8 36.86 38.0 37.0 38.0 35.0 38.0 9 37.15575 38.0 38.0 38.0 36.0 38.0 10-14 37.3935 38.0 38.0 38.0 36.4 38.0 15-19 37.5182 38.0 38.0 38.0 37.2 38.0 20-24 37.70675 38.0 38.0 38.0 38.0 38.0 25-29 37.6774 38.0 38.0 38.0 38.0 38.0 30-34 37.672399999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.601000000000006 38.0 38.0 38.0 38.0 38.0 40-44 37.559250000000006 38.0 38.0 38.0 37.8 38.0 45-49 37.5099 38.0 38.0 38.0 37.6 38.0 50-54 37.43125 38.0 38.0 38.0 37.0 38.0 55-59 37.2577 38.0 38.0 38.0 36.0 38.0 60-64 37.22135 38.0 38.0 38.0 36.2 38.0 65-69 37.10135 38.0 38.0 38.0 36.0 38.0 70-74 37.03294999999999 38.0 38.0 38.0 35.8 38.0 75-79 36.955949999999994 38.0 38.0 38.0 35.6 38.0 80-84 36.75150000000001 38.0 38.0 38.0 34.4 38.0 85-89 36.65575 38.0 38.0 38.0 34.2 38.0 90-94 36.52065 38.0 37.6 38.0 34.0 38.0 95-99 36.4564 38.0 37.4 38.0 34.0 38.0 100-104 35.95125 38.0 36.8 38.0 32.0 38.0 105-109 36.018350000000005 38.0 37.0 38.0 32.6 38.0 110-114 35.792449999999995 38.0 36.6 38.0 31.4 38.0 115-119 35.462250000000004 38.0 36.0 38.0 29.4 38.0 120-124 35.09215 38.0 35.2 38.0 28.2 38.0 125-129 34.74105 38.0 35.0 38.0 27.2 38.0 130-134 34.7376 38.0 35.0 38.0 27.2 38.0 135-139 33.88535 38.0 33.4 38.0 23.0 38.0 140-144 33.178250000000006 37.6 32.6 38.0 19.4 38.0 145-149 31.56755 36.0 30.8 38.0 10.8 38.0 150-151 27.099625 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 2.0 11 1.0 12 0.0 13 1.0 14 0.0 15 0.0 16 1.0 17 2.0 18 3.0 19 3.0 20 1.0 21 3.0 22 1.0 23 4.0 24 6.0 25 7.0 26 7.0 27 15.0 28 16.0 29 29.0 30 49.0 31 69.0 32 94.0 33 153.0 34 290.0 35 653.0 36 1567.0 37 1023.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 29.550706033376123 24.67265725288832 8.549422336328627 37.22721437740693 2 25.0 15.65 34.325 25.025 3 25.825 18.224999999999998 24.474999999999998 31.474999999999998 4 23.175 28.075 22.25 26.5 5 23.25 31.275 24.65 20.825 6 18.975 37.4 25.25 18.375 7 14.774999999999999 26.075 42.625 16.525000000000002 8 19.1 25.474999999999998 30.725 24.7 9 18.325 24.85 33.375 23.45 10-14 19.11 30.5 27.589999999999996 22.8 15-19 19.689999999999998 28.92 28.005000000000003 23.385 20-24 19.495 29.375 27.875 23.255 25-29 20.075000000000003 29.599999999999998 27.575 22.75 30-34 19.63 29.17 27.860000000000003 23.34 35-39 19.8 29.330000000000002 27.905 22.965 40-44 19.73 29.294999999999998 27.595 23.380000000000003 45-49 19.885 29.225 28.03 22.86 50-54 19.939999999999998 29.75 27.365000000000002 22.945 55-59 19.634999999999998 28.825 28.23 23.31 60-64 20.16 29.145 27.439999999999998 23.255 65-69 19.205 29.035 28.62 23.14 70-74 19.765 28.84 28.155 23.24 75-79 19.54 29.25 27.650000000000002 23.56 80-84 19.715 28.73 28.07 23.485 85-89 19.794999999999998 28.67 27.79 23.745 90-94 19.744999999999997 29.37 27.735 23.150000000000002 95-99 19.64 29.23 27.515 23.615 100-104 20.29 28.470000000000002 28.305000000000003 22.935 105-109 20.215 29.445 27.43 22.91 110-114 20.13 28.28 28.04 23.549999999999997 115-119 20.34 29.134999999999998 27.47 23.055 120-124 20.49 28.57 27.6 23.34 125-129 21.065 28.134999999999998 27.715 23.085 130-134 20.355 28.395 27.395000000000003 23.855 135-139 20.525 27.694999999999997 28.139999999999997 23.64 140-144 20.515 28.155 27.750000000000004 23.580000000000002 145-149 20.0 27.85 28.1 24.05 150-151 19.9125 29.125 27.075 23.8875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 0.5 20 0.0 21 0.0 22 1.5 23 3.5 24 4.0 25 3.5 26 6.0 27 10.0 28 10.5 29 12.5 30 25.0 31 41.5 32 54.5 33 58.5 34 71.0 35 97.0 36 105.0 37 123.0 38 160.0 39 178.5 40 209.0 41 234.5 42 222.5 43 244.5 44 260.5 45 254.0 46 252.0 47 239.0 48 230.0 49 188.0 50 155.0 51 135.0 52 97.0 53 80.0 54 63.0 55 42.0 56 32.0 57 27.5 58 23.0 59 13.0 60 9.5 61 8.0 62 4.0 63 2.5 64 2.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.625 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.625 #Duplication Level Percentage of deduplicated Percentage of total 1 99.64868255959848 99.275 2 0.32622333751568383 0.65 3 0.02509410288582183 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.25 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3125 0.0 0.0 0.0 0.0 90-91 0.35 0.0 0.0 0.0 0.0 92-93 0.3875 0.0 0.0 0.0 0.0 94-95 0.4625 0.0 0.0 0.0 0.0 96-97 0.5375000000000001 0.0 0.0 0.0 0.0 98-99 0.6625 0.0 0.0 0.0 0.0 100-101 0.775 0.0 0.0 0.0 0.0 102-103 0.8875 0.0 0.0 0.0 0.0 104-105 1.0375 0.0 0.0 0.0 0.0 106-107 1.1625 0.0 0.0 0.0 0.0 108-109 1.4125 0.0 0.0 0.0 0.0 110-111 1.6625 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 1.925 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.35 0.0 0.0 0.0 0.0 120-121 2.5375 0.0 0.0 0.0 0.0 122-123 2.9000000000000004 0.0 0.0 0.0 0.0 124-125 3.3125 0.0 0.0 0.0 0.0 126-127 3.5999999999999996 0.0 0.0 0.0 0.0 128-129 3.8125 0.0 0.0 0.0 0.0 130-131 3.9749999999999996 0.0 0.0 0.0 0.0 132-133 4.2125 0.0 0.0 0.0 0.0 134-135 4.512499999999999 0.0 0.0 0.0 0.0 136-137 4.875 0.0 0.0 0.0 0.0 138-139 5.1375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CTTTATT 10 0.006577216 146.82278 1 >>END_MODULE SRR7170479 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170479_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9795 33.0 33.0 34.0 32.0 34.0 2 33.09875 34.0 33.0 34.0 33.0 34.0 3 33.1405 34.0 33.0 34.0 33.0 34.0 4 33.10075 34.0 33.0 34.0 33.0 34.0 5 33.127 34.0 33.0 34.0 33.0 34.0 6 37.31475 38.0 38.0 38.0 37.0 38.0 7 37.29275 38.0 38.0 38.0 37.0 38.0 8 37.31125 38.0 38.0 38.0 37.0 38.0 9 37.295 38.0 38.0 38.0 37.0 38.0 10-14 37.301100000000005 38.0 38.0 38.0 37.0 38.0 15-19 37.21039999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.2472 38.0 38.0 38.0 37.0 38.0 25-29 37.1853 38.0 38.0 38.0 37.0 38.0 30-34 37.13775 38.0 38.0 38.0 37.0 38.0 35-39 37.157799999999995 38.0 38.0 38.0 37.0 38.0 40-44 37.15655 38.0 38.0 38.0 37.0 38.0 45-49 37.114200000000004 38.0 38.0 38.0 36.6 38.0 50-54 37.073750000000004 38.0 38.0 38.0 36.8 38.0 55-59 37.066 38.0 38.0 38.0 36.8 38.0 60-64 37.0439 38.0 38.0 38.0 36.2 38.0 65-69 36.932100000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.95725 38.0 38.0 38.0 36.0 38.0 75-79 36.9224 38.0 38.0 38.0 36.0 38.0 80-84 36.8286 38.0 38.0 38.0 35.8 38.0 85-89 36.54155 38.0 38.0 38.0 34.4 38.0 90-94 36.519999999999996 38.0 38.0 38.0 34.6 38.0 95-99 36.269999999999996 38.0 37.8 38.0 33.4 38.0 100-104 36.18149999999999 38.0 37.4 38.0 33.8 38.0 105-109 36.1543 38.0 37.2 38.0 33.2 38.0 110-114 36.03535000000001 38.0 37.0 38.0 33.0 38.0 115-119 35.77374999999999 38.0 37.0 38.0 31.8 38.0 120-124 35.518249999999995 38.0 36.4 38.0 31.0 38.0 125-129 35.1792 38.0 36.0 38.0 29.8 38.0 130-134 34.72865 38.0 35.0 38.0 28.4 38.0 135-139 34.06905 38.0 33.2 38.0 24.6 38.0 140-144 33.34205000000001 38.0 33.0 38.0 21.0 38.0 145-149 32.2324 38.0 33.0 38.0 12.2 38.0 150-151 26.289250000000003 33.0 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 3.0 4 1.0 5 1.0 6 1.0 7 0.0 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 3.0 15 4.0 16 4.0 17 2.0 18 4.0 19 4.0 20 4.0 21 5.0 22 12.0 23 12.0 24 7.0 25 16.0 26 17.0 27 23.0 28 29.0 29 28.0 30 43.0 31 47.0 32 77.0 33 97.0 34 162.0 35 293.0 36 868.0 37 2224.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.33358339584896 20.68017004251063 15.803950987746937 29.182295573893473 2 26.056514128532132 24.731182795698924 32.808202050512634 16.404101025256317 3 19.30482620655164 29.207301825456366 32.00800200050013 19.479869967491872 4 23.13078269567392 34.358589647411854 23.80595148787197 18.704676169042262 5 24.8062015503876 35.0587646911728 23.355838959739934 16.779194798699677 6 19.579894973743436 37.78444611152788 25.03125781445361 17.60440110027507 7 19.5 21.625 39.125 19.75 8 20.549999999999997 25.174999999999997 28.975 25.3 9 21.555388847211805 26.156539134783696 30.807701925481368 21.48037009252313 10-14 23.389677935587116 28.995799159831964 26.5503100620124 21.064212842568512 15-19 22.495623905976494 28.402100525131285 28.157039259814955 20.94523630907727 20-24 22.78569642410603 28.3520880220055 28.177044261065266 20.685171292823206 25-29 22.34058514628657 28.672168042010505 28.497124281070267 20.49012253063266 30-34 23.07576894223556 28.312078019504877 28.107026756689173 20.505126281570394 35-39 22.735683920980247 27.93198299574894 28.782195548887223 20.550137534383595 40-44 22.82570642660665 28.312078019504877 28.3520880220055 20.510127531882972 45-49 22.655663915978995 28.00700175043761 28.79219804951238 20.545136284071017 50-54 23.220805201300326 28.602150537634408 27.866966741685424 20.310077519379846 55-59 22.99074768692173 27.58689672418104 28.347086771692926 21.0752688172043 60-64 22.34558639659915 28.18704676169042 28.557139284821204 20.91022755688922 65-69 22.8607151787947 27.721930482620653 28.84721180295074 20.57014253563391 70-74 22.960740185046262 28.072018004501125 28.16704176044011 20.800200050012503 75-79 22.850712678169543 28.30207551887972 27.54688672168042 21.30032508127032 80-84 22.8607151787947 27.901975493873472 28.02700675168792 21.21030257564391 85-89 22.72068017004251 28.122030507626906 28.69717429357339 20.46011502875719 90-94 23.705926481620406 27.526881720430108 27.85696424106027 20.91022755688922 95-99 23.225806451612904 28.48712178044511 27.781945486371594 20.505126281570394 100-104 23.3408352088022 27.76694173543386 28.597149287321834 20.29507376844211 105-109 23.495873968492123 28.81220305076269 27.326831707926978 20.365091272818205 110-114 23.845961490372595 28.13703425856464 27.76194048512128 20.255063765941486 115-119 23.975993998499625 28.197049262315577 27.771942985746435 20.05501375343836 120-124 23.410852713178297 28.077019254813703 28.597149287321834 19.91497874468617 125-129 23.6609152288072 28.377094273568392 27.366841710427607 20.5951487871968 130-134 24.191047761940485 28.017004251062765 27.7569392348087 20.035008752188048 135-139 24.321080270067515 27.541885471367845 28.172043010752688 19.964991247811952 140-144 24.056014003500874 27.451862965741437 28.472118029507378 20.02000500125031 145-149 24.411102775693923 28.02700675168792 27.35683920980245 20.205051262815704 150-151 23.493373343335833 27.85696424106027 28.769692423105774 19.879969992498125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.5 17 1.0 18 0.5 19 0.5 20 1.5 21 1.0 22 0.5 23 1.0 24 1.5 25 1.5 26 6.5 27 9.5 28 8.0 29 12.0 30 16.5 31 20.5 32 30.0 33 39.5 34 55.5 35 83.5 36 104.0 37 124.0 38 142.0 39 163.0 40 202.5 41 230.5 42 276.0 43 305.5 44 282.0 45 275.0 46 266.0 47 232.0 48 214.0 49 195.0 50 152.0 51 118.0 52 100.5 53 78.5 54 63.0 55 52.5 56 31.5 57 24.0 58 20.5 59 12.5 60 11.0 61 11.0 62 9.0 63 4.0 64 1.5 65 1.0 66 0.0 67 1.5 68 1.5 69 0.5 70 0.5 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.025 7 0.0 8 0.0 9 0.025 10-14 0.02 15-19 0.025 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.025 80-84 0.025 85-89 0.025 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.025 125-129 0.025 130-134 0.025 135-139 0.025 140-144 0.025 145-149 0.025 150-151 0.025 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34442763489663 98.5 2 0.529500756429652 1.05 3 0.07564296520423601 0.22499999999999998 4 0.02521432173474534 0.1 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0125 0.0 0.0 0.0 0.0 38-39 0.025 0.0 0.0 0.0 0.0 40-41 0.025 0.0 0.0 0.0 0.0 42-43 0.025 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.15 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.275 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.3375 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4125 0.0 0.0 0.0 0.0 94-95 0.48750000000000004 0.0 0.0 0.0 0.0 96-97 0.5625 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.8 0.0 0.0 0.0 0.0 102-103 0.9125000000000001 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.1875 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.7125 0.0 0.0 0.0 0.0 112-113 1.8625 0.0 0.0 0.0 0.0 114-115 1.975 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.4 0.0 0.0 0.0 0.0 120-121 2.5875 0.0 0.0 0.0 0.0 122-123 2.95 0.0 0.0 0.0 0.0 124-125 3.3625 0.0 0.0 0.0 0.0 126-127 3.6625 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.05 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.5875 0.0 0.0 0.0 0.0 136-137 4.925 0.0 0.0 0.0 0.0 138-139 5.1875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATGTTT 10 0.006830828 145.0 9 ACAGGAG 10 0.006830828 145.0 6 >>END_MODULE Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657043 spots for SRR7170479.sra Written 657043 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra Read 657036 spots for SRR7170479.sra Written 657036 spots for SRR7170479.sra SRR ids: ['SRR7170479.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd___75a34c SRR7170479.sra spots: 13140727 blocks: [[1, 657036], [657037, 1314072], [1314073, 1971108], [1971109, 2628144], [2628145, 3285180], [3285181, 3942216], [3942217, 4599252], [4599253, 5256288], [5256289, 5913324], [5913325, 6570360], [6570361, 7227396], [7227397, 7884432], [7884433, 8541468], [8541469, 9198504], [9198505, 9855540], [9855541, 10512576], [10512577, 11169612], [11169613, 11826648], [11826649, 12483684], [12483685, 13140727]] SRR7170479 file size 4431260 SRR7170479 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170479 SRR7170479_1.fastq SRR7170479_2.fastq Input file: SRR7170479_1.fastq Paired file: SRR7170479_2.fastq trimmed: SRR7170479-trimmed-pair1.fastq, SRR7170479-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:58:29 2025 >> started Wed Feb 12 22:58:43 2025 >> done (13.559s) 13140727 read pairs processed; of these: 14269 ( 0.11%) short read pairs filtered out after trimming by size control 18707 ( 0.14%) empty read pairs filtered out after trimming by size control 13107751 (99.75%) read pairs available; of these: 8217879 (62.69%) trimmed read pairs available after processing 4889872 (37.31%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 2 0.00% 21 1 0.00% 22 0 0.00% 23 4 0.00% 24 1 0.00% 25 2 0.00% 26 7 0.00% 27 4 0.00% 28 4 0.00% 29 1 0.00% 30 6 0.00% 31 5 0.00% 32 5 0.00% 33 9 0.00% 34 6 0.00% 35 14 0.00% 36 13 0.00% 37 12 0.00% 38 16 0.00% 39 10 0.00% 40 16 0.00% 41 26 0.00% 42 24 0.00% 43 25 0.00% 44 34 0.00% 45 29 0.00% 46 51 0.00% 47 38 0.00% 48 57 0.00% 49 45 0.00% 50 82 0.00% 51 101 0.00% 52 100 0.00% 53 98 0.00% 54 107 0.00% 55 87 0.00% 56 134 0.00% 57 169 0.00% 58 161 0.00% 59 204 0.00% 60 264 0.00% 61 278 0.00% 62 350 0.00% 63 380 0.00% 64 428 0.00% 65 438 0.00% 66 457 0.00% 67 517 0.00% 68 597 0.00% 69 661 0.01% 70 774 0.01% 71 866 0.01% 72 982 0.01% 73 1106 0.01% 74 1298 0.01% 75 1487 0.01% 76 1500 0.01% 77 1676 0.01% 78 1777 0.01% 79 2049 0.02% 80 2325 0.02% 81 2567 0.02% 82 2881 0.02% 83 3498 0.03% 84 4146 0.03% 85 4602 0.04% 86 4871 0.04% 87 5073 0.04% 88 5088 0.04% 89 5317 0.04% 90 5589 0.04% 91 6061 0.05% 92 6757 0.05% 93 7163 0.05% 94 7744 0.06% 95 8182 0.06% 96 8818 0.07% 97 8805 0.07% 98 9188 0.07% 99 9851 0.08% 100 10245 0.08% 101 10650 0.08% 102 11371 0.09% 103 11984 0.09% 104 12554 0.10% 105 13357 0.10% 106 14079 0.11% 107 14568 0.11% 108 14628 0.11% 109 15116 0.12% 110 15534 0.12% 111 15545 0.12% 112 16302 0.12% 113 16954 0.13% 114 17710 0.14% 115 18672 0.14% 116 18849 0.14% 117 19829 0.15% 118 20137 0.15% 119 20492 0.16% 120 21401 0.16% 121 22212 0.17% 122 23115 0.18% 123 24115 0.18% 124 25334 0.19% 125 26537 0.20% 126 28022 0.21% 127 29474 0.22% 128 30563 0.23% 129 32308 0.25% 130 34501 0.26% 131 36457 0.28% 132 39109 0.30% 133 42911 0.33% 134 46004 0.35% 135 49766 0.38% 136 55482 0.42% 137 60897 0.46% 138 67951 0.52% 139 75929 0.58% 140 86595 0.66% 141 99407 0.76% 142 115618 0.88% 143 136275 1.04% 144 165497 1.26% 145 209836 1.60% 146 277117 2.11% 147 392829 3.00% 148 617153 4.71% 149 1191410 9.09% 150 3707351 28.28% 151 4889872 37.31% 13107751 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.22 fanout-score-rank=18 prefix-density=0.41 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=292.58 fanout-score-rank=1 prefix-density=0.20 prefix-fanout=13.9 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=2.49 fanout-score-rank=22 prefix-density=0.49 prefix-fanout=2.4 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=27.52 fanout-score-rank=1 prefix-density=0.06 prefix-fanout=3.3 sequence=CAATATTTTTCAGTATGAAAGCTTTAGTGATAGCTATTCTTATAGCTA SRR7170479 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:59:25 Started mapping on | Feb 12 22:59:25 Finished on | Feb 13 00:04:30 Mapping speed, Million of reads per hour | 12.08 Number of input reads | 13107751 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12198055 Uniquely mapped reads % | 93.06% Average mapped length | 293.07 Number of splices: Total | 11643545 Number of splices: Annotated (sjdb) | 11347564 Number of splices: GT/AG | 11429790 Number of splices: GC/AG | 167583 Number of splices: AT/AC | 7005 Number of splices: Non-canonical | 39167 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 380736 % of reads mapped to multiple loci | 2.90% Number of reads mapped to too many loci | 52794 % of reads mapped to too many loci | 0.40% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.55% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 538321 538321 538321 N_multimapping 380736 380736 380736 N_noFeature 474094 12002196 535609 N_ambiguous 245974 930 111140 UnstrandedReadsAssigned:11477987 PositiveStrandReadsAssigned:194929 NegativeStrandReadsAssigned:11551306 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170479 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170479-trimmed-pair1.fastq SRR7170479-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,107,751 reads, 11,521,030 reads pseudoaligned [quant] estimated average fragment length: 274.413 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7170479.ke.tsv 34699 SRR7170479.se.tsv 87100 total ==> SRR7170479.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1744.59 846 38.2114 Potri.005G024800.1.v4.1 1035 761.587 251 25.9698 Potri.004G059700.1.v4.1 961 687.614 18 2.06273 Potri.007G009000.2.v4.1 1416 1142.59 0 0 Potri.003G141000.2.v4.1 2943 2669.59 520.28 15.3571 Potri.016G087400.1.v4.1 270 75.6894 717 746.448 Potri.015G069301.1.v4.1 564 295.584 0 0 Potri.010G195200.1.v4.1 1773 1499.59 23 1.20857 Potri.012G127500.1.v4.1 977 703.598 225 25.1984 ==> SRR7170479.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1521 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 257 Potri.001G212900.v4.1 71 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 3 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 50 SRR7170479 completed mapping pipeline successfully