Starting /dee2/code/volunteer_pipeline.sh SRR7170480 current disk space = 3050437644288 free memory = 1577234828 SRR7170480 SRAfilesize 8b50acd563d66dbce9fcfb754e2b99f4 SRR7170480.sra SRR7170480.sra file validated SRR7170480 is paired end SRR7170480 is conventional basespace SRR7170480 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170480_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.252 18.0 18.0 18.0 18.0 32.0 2 25.8615 27.0 25.0 27.0 18.0 30.0 3 26.745 27.0 25.0 29.0 18.0 31.0 4 29.686 31.0 29.0 31.0 27.0 33.0 5 30.83025 32.0 31.0 33.0 27.0 33.0 6 35.6705 37.0 35.0 38.0 31.0 38.0 7 36.9545 38.0 37.0 38.0 35.0 38.0 8 36.9555 38.0 37.0 38.0 35.0 38.0 9 37.24425 38.0 38.0 38.0 36.0 38.0 10-14 37.404700000000005 38.0 38.0 38.0 36.8 38.0 15-19 37.49495 38.0 38.0 38.0 37.0 38.0 20-24 37.52705 38.0 38.0 38.0 37.2 38.0 25-29 37.61 38.0 38.0 38.0 38.0 38.0 30-34 37.5839 38.0 38.0 38.0 37.8 38.0 35-39 37.5172 38.0 38.0 38.0 37.6 38.0 40-44 37.5024 38.0 38.0 38.0 37.2 38.0 45-49 37.4144 38.0 38.0 38.0 37.0 38.0 50-54 37.40965 38.0 38.0 38.0 37.0 38.0 55-59 37.26335 38.0 38.0 38.0 36.4 38.0 60-64 37.22835 38.0 38.0 38.0 36.2 38.0 65-69 37.236599999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.09075 38.0 38.0 38.0 36.0 38.0 75-79 36.995400000000004 38.0 38.0 38.0 35.6 38.0 80-84 37.04165 38.0 38.0 38.0 36.0 38.0 85-89 36.69355 38.0 38.0 38.0 34.6 38.0 90-94 36.58515 38.0 38.0 38.0 34.0 38.0 95-99 36.4719 38.0 37.6 38.0 33.8 38.0 100-104 36.555150000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.38035 38.0 37.0 38.0 34.0 38.0 110-114 36.144949999999994 38.0 37.0 38.0 33.0 38.0 115-119 35.65565 38.0 36.0 38.0 30.6 38.0 120-124 35.7857 38.0 36.2 38.0 31.8 38.0 125-129 35.47345 38.0 35.6 38.0 30.0 38.0 130-134 31.953100000000006 35.4 28.0 38.0 22.0 38.0 135-139 34.189499999999995 38.0 33.4 38.0 25.6 38.0 140-144 30.248700000000003 34.0 25.8 37.6 15.6 38.0 145-149 32.619 37.4 32.6 38.0 17.0 38.0 150-151 28.667125 35.0 24.0 38.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 1.0 20 3.0 21 5.0 22 2.0 23 3.0 24 9.0 25 11.0 26 5.0 27 18.0 28 29.0 29 31.0 30 37.0 31 54.0 32 96.0 33 148.0 34 280.0 35 583.0 36 1573.0 37 1108.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 23.111345090813373 33.429849960515924 6.896551724137931 36.56225322453277 2 22.755688922230558 15.403850962740684 33.25831457864466 28.582145536384097 3 21.7 20.424999999999997 25.474999999999998 32.4 4 24.25 28.325 22.0 25.424999999999997 5 24.0 31.075000000000003 23.5 21.425 6 17.849999999999998 37.425000000000004 24.175 20.549999999999997 7 14.899999999999999 25.775 41.225 18.099999999999998 8 18.375 24.95 31.775 24.9 9 17.25 24.825 33.4 24.525 10-14 19.77 30.14 27.015 23.075000000000003 15-19 19.925 29.165000000000003 27.544999999999998 23.365 20-24 19.99 29.18 27.29 23.54 25-29 20.035 28.875 27.529999999999998 23.56 30-34 20.135 29.225 27.12 23.52 35-39 19.765 28.655 27.66 23.919999999999998 40-44 20.419999999999998 29.04 27.185 23.355 45-49 19.88 29.134999999999998 27.189999999999998 23.794999999999998 50-54 20.28 28.360000000000003 27.565 23.794999999999998 55-59 20.13 29.099999999999998 26.884999999999998 23.885 60-64 20.635 28.110000000000003 27.36 23.895 65-69 19.875 28.87 27.32 23.935000000000002 70-74 20.560000000000002 28.28 27.77 23.39 75-79 19.955000000000002 28.444999999999997 27.51 24.09 80-84 20.11 28.475 27.544999999999998 23.87 85-89 20.22 28.715000000000003 27.224999999999998 23.84 90-94 20.215 28.044999999999998 27.6 24.14 95-99 20.105 28.16 27.634999999999998 24.099999999999998 100-104 20.47 28.565 26.99 23.974999999999998 105-109 20.655 28.23 27.38 23.735 110-114 20.28 27.825 27.650000000000002 24.245 115-119 20.369999999999997 28.04 27.565 24.025 120-124 20.64 27.91 27.295 24.154999999999998 125-129 20.69 27.839999999999996 27.63 23.84 130-134 20.979999999999997 27.52 27.46 24.04 135-139 21.205 27.66 27.13 24.005000000000003 140-144 20.86 27.439999999999998 27.650000000000002 24.05 145-149 20.48 27.584999999999997 27.200000000000003 24.735 150-151 21.0625 27.800000000000004 27.437499999999996 23.7 >>END_MODULE >>Per sequence GC content fail #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.5 22 2.5 23 2.5 24 2.5 25 2.0 26 2.5 27 5.0 28 7.0 29 13.5 30 20.0 31 22.5 32 29.5 33 44.5 34 62.0 35 81.0 36 97.5 37 117.0 38 140.0 39 161.0 40 183.5 41 202.5 42 242.0 43 268.5 44 252.5 45 242.5 46 253.5 47 275.0 48 259.0 49 209.5 50 164.5 51 135.5 52 120.0 53 94.0 54 69.0 55 52.0 56 43.5 57 36.0 58 26.5 59 19.5 60 13.5 61 7.0 62 5.5 63 4.5 64 0.5 65 1.0 66 1.0 67 1.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.025 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.675 #Duplication Level Percentage of deduplicated Percentage of total 1 99.67394030599448 99.35000000000001 2 0.32605969400551793 0.65 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.25 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4625 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.625 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.35 0.0 0.0 0.0 0.0 104-105 1.5375 0.0 0.0 0.0 0.0 106-107 1.7625 0.0 0.0 0.0 0.0 108-109 1.9375 0.0 0.0 0.0 0.0 110-111 2.1625 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.5625 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.3875 0.0 0.0 0.0 0.0 122-123 3.575 0.0 0.0 0.0 0.0 124-125 3.7750000000000004 0.0 0.0 0.0 0.0 126-127 3.9375 0.025 0.0 0.0 0.0 128-129 4.1875 0.025 0.0 0.0 0.0 130-131 4.3875 0.025 0.0 0.0 0.0 132-133 4.525 0.025 0.0 0.0 0.0 134-135 4.75 0.025 0.0 0.0 0.0 136-137 5.0 0.025 0.0 0.0 0.0 138-139 5.25 0.025 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170480 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170480_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8745 33.0 33.0 34.0 32.0 34.0 2 32.96675 34.0 33.0 34.0 32.0 34.0 3 33.096 34.0 33.0 34.0 32.0 34.0 4 33.04225 34.0 33.0 34.0 32.0 34.0 5 32.9875 34.0 33.0 34.0 32.0 34.0 6 37.21225 38.0 38.0 38.0 37.0 38.0 7 37.21275 38.0 38.0 38.0 37.0 38.0 8 37.206 38.0 38.0 38.0 37.0 38.0 9 37.2205 38.0 38.0 38.0 37.0 38.0 10-14 37.1767 38.0 38.0 38.0 37.0 38.0 15-19 35.85025 38.0 36.0 38.0 30.4 38.0 20-24 36.87735 38.0 38.0 38.0 35.8 38.0 25-29 36.78225 38.0 38.0 38.0 35.4 38.0 30-34 36.92885 38.0 38.0 38.0 36.0 38.0 35-39 36.954699999999995 38.0 38.0 38.0 36.0 38.0 40-44 36.9004 38.0 38.0 38.0 36.0 38.0 45-49 36.87835 38.0 38.0 38.0 35.8 38.0 50-54 36.88745 38.0 38.0 38.0 36.0 38.0 55-59 36.90560000000001 38.0 38.0 38.0 36.0 38.0 60-64 36.78765 38.0 38.0 38.0 35.8 38.0 65-69 36.833 38.0 38.0 38.0 35.8 38.0 70-74 36.688100000000006 38.0 38.0 38.0 35.2 38.0 75-79 36.6754 38.0 38.0 38.0 35.2 38.0 80-84 36.64715000000001 38.0 38.0 38.0 35.0 38.0 85-89 36.2219 38.0 37.8 38.0 33.0 38.0 90-94 33.9608 37.4 33.4 38.0 23.4 38.0 95-99 36.18415 38.0 37.4 38.0 33.6 38.0 100-104 36.117149999999995 38.0 37.2 38.0 33.6 38.0 105-109 35.913 38.0 37.0 38.0 33.0 38.0 110-114 35.807399999999994 38.0 37.0 38.0 31.6 38.0 115-119 35.63245 38.0 36.6 38.0 31.0 38.0 120-124 34.87335 38.0 35.2 38.0 27.8 38.0 125-129 34.80105 38.0 35.6 38.0 27.8 38.0 130-134 34.477050000000006 38.0 34.4 38.0 26.2 38.0 135-139 33.7007 38.0 33.0 38.0 22.0 38.0 140-144 32.85315 38.0 33.0 38.0 18.0 38.0 145-149 31.432299999999998 37.8 31.8 38.0 8.6 38.0 150-151 25.594625 32.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 6.0 5 0.0 6 1.0 7 1.0 8 2.0 9 1.0 10 1.0 11 1.0 12 1.0 13 0.0 14 1.0 15 3.0 16 7.0 17 2.0 18 2.0 19 7.0 20 5.0 21 11.0 22 8.0 23 10.0 24 20.0 25 9.0 26 20.0 27 35.0 28 29.0 29 29.0 30 53.0 31 74.0 32 125.0 33 113.0 34 238.0 35 394.0 36 937.0 37 1848.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.6 21.275 12.725 26.400000000000002 2 27.325 24.9 29.849999999999998 17.925 3 20.200000000000003 27.575 31.95 20.275000000000002 4 23.799999999999997 33.800000000000004 24.125 18.275 5 25.224999999999998 34.9 22.375 17.5 6 20.5 37.9 23.25 18.35 7 19.075 22.55 38.925 19.45 8 22.475 25.124999999999996 27.575 24.825 9 22.925 25.4 28.849999999999998 22.825 10-14 23.474999999999998 28.685 26.22 21.62 15-19 23.21 27.994999999999997 27.389999999999997 21.404999999999998 20-24 23.435 28.199999999999996 27.29 21.075 25-29 23.335 28.754999999999995 27.08 20.830000000000002 30-34 23.54 28.175 27.35 20.935000000000002 35-39 23.32 28.32 27.265 21.095 40-44 23.645 27.76 27.74 20.855 45-49 23.265 27.889999999999997 27.755000000000003 21.09 50-54 23.445 27.515 27.72 21.32 55-59 23.53 27.025 27.889999999999997 21.555 60-64 23.815 27.715 27.43 21.04 65-69 23.72 27.36 27.63 21.29 70-74 23.325000000000003 27.450000000000003 27.589999999999996 21.634999999999998 75-79 23.31 27.88 27.665 21.145 80-84 23.95 27.794999999999998 26.82 21.435000000000002 85-89 23.94 27.765 27.13 21.165 90-94 23.73 28.005000000000003 27.500000000000004 20.765 95-99 23.849999999999998 27.555000000000003 27.334999999999997 21.26 100-104 24.224999999999998 27.595 27.275 20.905 105-109 24.605 27.83 27.32 20.244999999999997 110-114 24.169999999999998 27.755000000000003 27.55 20.525 115-119 24.66 27.955000000000002 27.12 20.265 120-124 24.165 28.23 27.08 20.525 125-129 24.615000000000002 28.050000000000004 27.27 20.064999999999998 130-134 24.705 27.275 27.165 20.855 135-139 24.47 27.62 27.589999999999996 20.32 140-144 24.255 27.82 27.48 20.445 145-149 24.755 27.515 27.63 20.1 150-151 24.5625 26.8 28.1875 20.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 0.5 20 0.5 21 0.5 22 0.5 23 2.5 24 3.0 25 1.5 26 3.0 27 6.0 28 6.5 29 6.0 30 9.0 31 16.0 32 25.0 33 31.5 34 29.5 35 46.5 36 70.0 37 100.0 38 124.0 39 138.5 40 182.5 41 221.0 42 240.0 43 269.5 44 282.5 45 274.5 46 283.0 47 263.5 48 232.0 49 217.0 50 192.5 51 155.0 52 117.5 53 96.0 54 89.0 55 69.5 56 50.0 57 38.5 58 26.0 59 23.0 60 16.5 61 12.0 62 10.5 63 7.0 64 4.0 65 1.5 66 0.5 67 1.0 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.47500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.5727569741141 99.05000000000001 2 0.4021110831867303 0.8 3 0.0 0.0 4 0.0 0.0 5 0.0 0.0 6 0.025131942699170642 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.0875 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.1125 0.0 0.0 0.0 0.0 78-79 0.21250000000000002 0.0 0.0 0.0 0.0 80-81 0.225 0.0 0.0 0.0 0.0 82-83 0.225 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.375 0.0 0.0 0.0 0.0 88-89 0.42500000000000004 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.5874999999999999 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.8625 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.175 0.0 0.0 0.0 0.0 102-103 1.4 0.0 0.0 0.0 0.0 104-105 1.625 0.0 0.0 0.0 0.0 106-107 1.875 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.2875 0.0 0.0 0.0 0.0 112-113 2.4875 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.9875 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.575 0.0 0.0 0.0 0.0 122-123 3.8375 0.0 0.0 0.0 0.0 124-125 4.0625 0.0 0.0 0.0 0.0 126-127 4.300000000000001 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.262499999999999 0.0 0.0 0.0 0.0 134-135 5.6 0.0 0.0 0.0 0.0 136-137 5.925 0.0 0.0 0.0 0.0 138-139 6.2375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AACCCTC 10 0.006830828 145.0 7 >>END_MODULE Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811898 spots for SRR7170480.sra Written 811898 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra Read 811886 spots for SRR7170480.sra Written 811886 spots for SRR7170480.sra SRR ids: ['SRR7170480.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_2mduqmmh SRR7170480.sra spots: 16237732 blocks: [[1, 811886], [811887, 1623772], [1623773, 2435658], [2435659, 3247544], [3247545, 4059430], [4059431, 4871316], [4871317, 5683202], [5683203, 6495088], [6495089, 7306974], [7306975, 8118860], [8118861, 8930746], [8930747, 9742632], [9742633, 10554518], [10554519, 11366404], [11366405, 12178290], [12178291, 12990176], [12990177, 13802062], [13802063, 14613948], [14613949, 15425834], [15425835, 16237732]] SRR7170480 file size 5480734 SRR7170480 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170480 SRR7170480_1.fastq SRR7170480_2.fastq Input file: SRR7170480_1.fastq Paired file: SRR7170480_2.fastq trimmed: SRR7170480-trimmed-pair1.fastq, SRR7170480-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 23:19:03 2025 >> started Wed Feb 12 23:22:38 2025 >> done (215.125s) 16237732 read pairs processed; of these: 11991 ( 0.07%) short read pairs filtered out after trimming by size control 14631 ( 0.09%) empty read pairs filtered out after trimming by size control 16211110 (99.84%) read pairs available; of these: 9530320 (58.79%) trimmed read pairs available after processing 6680790 (41.21%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 5 0.00% 21 8 0.00% 22 5 0.00% 23 3 0.00% 24 2 0.00% 25 6 0.00% 26 3 0.00% 27 4 0.00% 28 7 0.00% 29 4 0.00% 30 11 0.00% 31 10 0.00% 32 9 0.00% 33 6 0.00% 34 9 0.00% 35 8 0.00% 36 17 0.00% 37 17 0.00% 38 21 0.00% 39 32 0.00% 40 35 0.00% 41 47 0.00% 42 42 0.00% 43 46 0.00% 44 53 0.00% 45 51 0.00% 46 84 0.00% 47 81 0.00% 48 105 0.00% 49 117 0.00% 50 142 0.00% 51 158 0.00% 52 179 0.00% 53 181 0.00% 54 206 0.00% 55 220 0.00% 56 240 0.00% 57 269 0.00% 58 314 0.00% 59 436 0.00% 60 444 0.00% 61 572 0.00% 62 602 0.00% 63 728 0.00% 64 767 0.00% 65 846 0.01% 66 914 0.01% 67 989 0.01% 68 1113 0.01% 69 1341 0.01% 70 1517 0.01% 71 1699 0.01% 72 2033 0.01% 73 2287 0.01% 74 2521 0.02% 75 2786 0.02% 76 3014 0.02% 77 3380 0.02% 78 3382 0.02% 79 3885 0.02% 80 4274 0.03% 81 4823 0.03% 82 5307 0.03% 83 6074 0.04% 84 7042 0.04% 85 7880 0.05% 86 8201 0.05% 87 8599 0.05% 88 9234 0.06% 89 9308 0.06% 90 10023 0.06% 91 10883 0.07% 92 11472 0.07% 93 12488 0.08% 94 13259 0.08% 95 14114 0.09% 96 14580 0.09% 97 14907 0.09% 98 15315 0.09% 99 15530 0.10% 100 16318 0.10% 101 16935 0.10% 102 17676 0.11% 103 18676 0.12% 104 19600 0.12% 105 20433 0.13% 106 21031 0.13% 107 21314 0.13% 108 21800 0.13% 109 22145 0.14% 110 22363 0.14% 111 22938 0.14% 112 23885 0.15% 113 24895 0.15% 114 25945 0.16% 115 26951 0.17% 116 27587 0.17% 117 28105 0.17% 118 28705 0.18% 119 29345 0.18% 120 30167 0.19% 121 31240 0.19% 122 32040 0.20% 123 33481 0.21% 124 35211 0.22% 125 36311 0.22% 126 38831 0.24% 127 39994 0.25% 128 41748 0.26% 129 43409 0.27% 130 45599 0.28% 131 47832 0.30% 132 50842 0.31% 133 54703 0.34% 134 58540 0.36% 135 63770 0.39% 136 68962 0.43% 137 75524 0.47% 138 82934 0.51% 139 92110 0.57% 140 103187 0.64% 141 115498 0.71% 142 131009 0.81% 143 153049 0.94% 144 182061 1.12% 145 225352 1.39% 146 287772 1.78% 147 399298 2.46% 148 613813 3.79% 149 1199780 7.40% 150 4418274 27.25% 151 6680790 41.21% 16211110 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=24 prefix-density=0.58 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.20 sequence-density-rank=18 fanout-score=16.85 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=7.7 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=20 prefix-density=0.46 prefix-fanout=2.2 sequence=CCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCAC criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=59.17 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTG SRR7170480 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 23:42:42 Started mapping on | Feb 12 23:42:59 Finished on | Feb 13 00:09:35 Mapping speed, Million of reads per hour | 36.57 Number of input reads | 16211110 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15084692 Uniquely mapped reads % | 93.05% Average mapped length | 292.30 Number of splices: Total | 14677006 Number of splices: Annotated (sjdb) | 14367974 Number of splices: GT/AG | 14399845 Number of splices: GC/AG | 223868 Number of splices: AT/AC | 8729 Number of splices: Non-canonical | 44564 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.63 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 453053 % of reads mapped to multiple loci | 2.79% Number of reads mapped to too many loci | 84967 % of reads mapped to too many loci | 0.52% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.53% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 685383 685383 685383 N_multimapping 453053 453053 453053 N_noFeature 472699 14853824 541039 N_ambiguous 286290 981 123242 UnstrandedReadsAssigned:14325703 PositiveStrandReadsAssigned:229887 NegativeStrandReadsAssigned:14420411 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170480 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170480-trimmed-pair1.fastq SRR7170480-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,211,110 reads, 14,401,438 reads pseudoaligned [quant] estimated average fragment length: 265.457 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,229 rounds 52401 SRR7170480.ke.tsv 34699 SRR7170480.se.tsv 87100 total ==> SRR7170480.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.54 796 29.3635 Potri.005G024800.1.v4.1 1035 770.543 381 31.9845 Potri.004G059700.1.v4.1 961 696.575 17 1.57867 Potri.007G009000.2.v4.1 1416 1151.54 0 0 Potri.003G141000.2.v4.1 2943 2678.54 542.295 13.0963 Potri.016G087400.1.v4.1 270 79.5399 969 788.044 Potri.015G069301.1.v4.1 564 304.935 0 0 Potri.010G195200.1.v4.1 1773 1508.54 182 7.80414 Potri.012G127500.1.v4.1 977 712.559 229 20.7886 ==> SRR7170480.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1241 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 312 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 18 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7170480 completed mapping pipeline successfully