Starting /dee2/code/volunteer_pipeline.sh SRR7170481 current disk space = 3050555260928 free memory = 1458097580 SRR7170481 SRAfilesize 14aa396b86affd05640ad85dcfabae21 SRR7170481.sra SRR7170481.sra file validated SRR7170481 is paired end SRR7170481 is conventional basespace SRR7170481 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170481_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.5495 27.0 18.0 33.0 18.0 33.0 2 23.8195 25.0 18.0 30.0 18.0 33.0 3 29.356 30.0 27.0 31.0 27.0 33.0 4 31.38025 33.0 31.0 33.0 29.0 33.0 5 32.3885 33.0 32.0 33.0 32.0 33.0 6 36.892 38.0 37.0 38.0 35.0 38.0 7 37.29075 38.0 38.0 38.0 36.0 38.0 8 37.589 38.0 38.0 38.0 37.0 38.0 9 37.57675 38.0 38.0 38.0 37.0 38.0 10-14 37.65325 38.0 38.0 38.0 38.0 38.0 15-19 37.65945 38.0 38.0 38.0 38.0 38.0 20-24 37.6501 38.0 38.0 38.0 38.0 38.0 25-29 37.585899999999995 38.0 38.0 38.0 38.0 38.0 30-34 37.570499999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.48945 38.0 38.0 38.0 37.8 38.0 40-44 37.47605 38.0 38.0 38.0 37.8 38.0 45-49 37.27 38.0 38.0 38.0 37.0 38.0 50-54 37.3215 38.0 38.0 38.0 37.0 38.0 55-59 37.1854 38.0 38.0 38.0 36.8 38.0 60-64 37.181400000000004 38.0 38.0 38.0 36.4 38.0 65-69 37.1126 38.0 38.0 38.0 36.0 38.0 70-74 37.06425 38.0 38.0 38.0 36.0 38.0 75-79 36.78935 38.0 38.0 38.0 35.0 38.0 80-84 36.60655 38.0 38.0 38.0 34.6 38.0 85-89 36.548899999999996 38.0 38.0 38.0 34.4 38.0 90-94 36.43825 38.0 38.0 38.0 34.0 38.0 95-99 35.946400000000004 38.0 37.0 38.0 32.4 38.0 100-104 36.2352 38.0 37.2 38.0 33.8 38.0 105-109 35.99415 38.0 37.0 38.0 32.8 38.0 110-114 35.7718 38.0 36.8 38.0 32.0 38.0 115-119 35.4217 38.0 36.0 38.0 30.2 38.0 120-124 35.25575 38.0 36.0 38.0 30.0 38.0 125-129 34.673950000000005 38.0 35.0 38.0 27.2 38.0 130-134 33.7549 38.0 33.4 38.0 21.6 38.0 135-139 33.2205 38.0 33.0 38.0 19.0 38.0 140-144 32.4468 38.0 31.6 38.0 14.0 38.0 145-149 31.552300000000002 37.6 31.8 38.0 10.4 38.0 150-151 26.046 32.0 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 2.0 15 0.0 16 3.0 17 3.0 18 5.0 19 9.0 20 4.0 21 5.0 22 9.0 23 11.0 24 14.0 25 14.0 26 18.0 27 18.0 28 27.0 29 35.0 30 57.0 31 59.0 32 87.0 33 135.0 34 205.0 35 429.0 36 1227.0 37 1621.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 43.248836006207966 12.8039317123642 9.363683393688566 34.58354888773926 2 24.525 13.200000000000001 32.525 29.75 3 19.900000000000002 21.224999999999998 25.424999999999997 33.45 4 23.200000000000003 27.975 23.35 25.474999999999998 5 22.075 32.5 24.15 21.275 6 19.475 35.25 24.675 20.599999999999998 7 14.899999999999999 26.474999999999998 40.875 17.75 8 16.325 26.375 31.175000000000004 26.125 9 17.525 24.45 35.05 22.975 10-14 19.52 30.29 27.134999999999998 23.055 15-19 19.785 29.225 27.74 23.25 20-24 19.37 29.470000000000002 27.495000000000005 23.665 25-29 19.465 29.32 27.955000000000002 23.26 30-34 19.79 29.82 26.72 23.669999999999998 35-39 19.89 29.385 27.12 23.605 40-44 19.59 30.214999999999996 26.150000000000002 24.044999999999998 45-49 19.605 29.599999999999998 27.21 23.585 50-54 19.915 28.68 27.49 23.915 55-59 20.085 28.804999999999996 27.215 23.895 60-64 19.645000000000003 28.485 27.800000000000004 24.07 65-69 19.585 28.815 27.595 24.005000000000003 70-74 19.869999999999997 28.925 27.58 23.625 75-79 20.26 29.160000000000004 27.400000000000002 23.18 80-84 19.794999999999998 29.03 27.57 23.605 85-89 20.45 28.79 26.900000000000002 23.86 90-94 20.175 28.444999999999997 27.435 23.945 95-99 20.07 27.52 27.92 24.490000000000002 100-104 20.25 28.310000000000002 27.18 24.26 105-109 20.380000000000003 28.875 27.105 23.64 110-114 20.845 27.99 27.295 23.87 115-119 20.62 28.725 27.08 23.575 120-124 20.3 28.405 27.43 23.865 125-129 20.32 28.225 27.33 24.125 130-134 21.224999999999998 28.025 26.985 23.765 135-139 20.91 27.98 27.615000000000002 23.494999999999997 140-144 21.305 28.470000000000002 26.555 23.669999999999998 145-149 20.974999999999998 28.235 27.315 23.474999999999998 150-151 20.837500000000002 26.900000000000002 27.775 24.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 1.0 16 1.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.5 22 0.5 23 1.5 24 2.5 25 3.0 26 7.0 27 8.0 28 8.0 29 15.0 30 22.5 31 26.0 32 37.0 33 57.5 34 74.0 35 90.0 36 103.5 37 117.5 38 138.5 39 166.5 40 180.0 41 194.0 42 234.0 43 249.0 44 259.5 45 269.5 46 236.5 47 226.0 48 227.5 49 200.0 50 161.5 51 138.5 52 121.0 53 92.0 54 84.0 55 74.0 56 47.5 57 31.0 58 23.5 59 17.0 60 15.0 61 12.0 62 9.0 63 5.0 64 2.5 65 2.5 66 1.5 67 0.5 68 0.0 69 0.5 70 1.0 71 0.5 72 0.5 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.97500000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2422328870927 98.225 2 0.5304369790351099 1.05 3 0.2020712301086133 0.6 4 0.0 0.0 5 0.025258903763576663 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 5 0.125 TruSeq Adapter, Index 6 (97% over 36bp) >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.675 0.0 0.0 0.0 0.0 94-95 0.775 0.0 0.0 0.0 0.0 96-97 0.875 0.0 0.0 0.0 0.0 98-99 0.925 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.8875 0.0 0.0 0.0 0.0 110-111 2.025 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.625 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.2249999999999996 0.0 0.0 0.0 0.0 122-123 3.45 0.0 0.0 0.0 0.0 124-125 3.725 0.0 0.0 0.0 0.0 126-127 4.012499999999999 0.0 0.0 0.0 0.0 128-129 4.3 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 4.9125 0.0 0.0 0.0 0.0 134-135 5.324999999999999 0.0 0.0 0.0 0.0 136-137 5.6625 0.0 0.0 0.0 0.0 138-139 5.887499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content fail #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GCCTTTT 20 1.5479054E-6 150.61038 1 TCCCTGC 10 0.006836113 144.9625 8 CCTTTTC 20 3.5913987E-4 108.72187 2 >>END_MODULE SRR7170481 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170481_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.8085 33.0 33.0 34.0 32.0 34.0 2 32.90225 33.0 33.0 34.0 32.0 34.0 3 32.92225 34.0 33.0 34.0 32.0 34.0 4 32.85775 34.0 33.0 34.0 32.0 34.0 5 32.8175 34.0 33.0 34.0 32.0 34.0 6 37.013 38.0 38.0 38.0 36.0 38.0 7 37.04475 38.0 38.0 38.0 37.0 38.0 8 37.07275 38.0 38.0 38.0 37.0 38.0 9 37.077 38.0 38.0 38.0 37.0 38.0 10-14 37.03175 38.0 38.0 38.0 37.0 38.0 15-19 36.9995 38.0 38.0 38.0 36.8 38.0 20-24 36.999 38.0 38.0 38.0 36.8 38.0 25-29 36.90689999999999 38.0 38.0 38.0 36.4 38.0 30-34 36.9315 38.0 38.0 38.0 36.2 38.0 35-39 36.89005 38.0 38.0 38.0 36.4 38.0 40-44 36.9171 38.0 38.0 38.0 36.4 38.0 45-49 36.84725 38.0 38.0 38.0 36.0 38.0 50-54 36.78995 38.0 38.0 38.0 36.0 38.0 55-59 36.80395 38.0 38.0 38.0 36.0 38.0 60-64 36.77695 38.0 38.0 38.0 36.0 38.0 65-69 36.716 38.0 38.0 38.0 35.6 38.0 70-74 36.5844 38.0 38.0 38.0 34.8 38.0 75-79 36.52114999999999 38.0 38.0 38.0 35.0 38.0 80-84 36.4688 38.0 38.0 38.0 34.6 38.0 85-89 36.3534 38.0 38.0 38.0 34.2 38.0 90-94 36.2394 38.0 38.0 38.0 34.0 38.0 95-99 36.05794999999999 38.0 38.0 38.0 33.6 38.0 100-104 35.9672 38.0 37.6 38.0 33.4 38.0 105-109 35.86515 38.0 37.0 38.0 33.0 38.0 110-114 35.7048 38.0 37.0 38.0 32.2 38.0 115-119 35.34465 38.0 36.6 38.0 30.6 38.0 120-124 34.96875 38.0 36.2 38.0 28.6 38.0 125-129 34.23485 38.0 34.4 38.0 24.0 38.0 130-134 33.98225 38.0 33.8 38.0 23.8 38.0 135-139 33.3851 38.0 33.0 38.0 20.0 38.0 140-144 32.661899999999996 38.0 33.0 38.0 14.4 38.0 145-149 31.61975 38.0 33.0 38.0 8.2 38.0 150-151 25.996625 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 3.0 4 4.0 5 2.0 6 1.0 7 0.0 8 2.0 9 4.0 10 1.0 11 1.0 12 3.0 13 0.0 14 3.0 15 4.0 16 5.0 17 7.0 18 4.0 19 11.0 20 8.0 21 4.0 22 13.0 23 15.0 24 20.0 25 18.0 26 22.0 27 31.0 28 32.0 29 25.0 30 34.0 31 62.0 32 88.0 33 120.0 34 195.0 35 273.0 36 766.0 37 2206.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.859464866216555 21.405351337834457 15.128782195548887 25.6064016004001 2 28.432108027006752 26.25656414103526 28.232058014503625 17.079269817454364 3 19.679919979995 29.107276819204802 31.957989497374346 19.254813703425857 4 22.9057264316079 33.558389597399355 24.63115778944736 18.904726181545385 5 23.936968484242122 36.643321660830416 22.18609304652326 17.2336168084042 6 19.950000000000003 37.325 23.95 18.775 7 19.7 20.75 39.300000000000004 20.25 8 23.0 25.624999999999996 25.95 25.424999999999997 9 19.675 26.8 29.725 23.799999999999997 10-14 23.39 29.4 26.045 21.165 15-19 22.997299729972998 28.152815281528156 27.992799279927993 20.857085708570857 20-24 23.190797699424856 28.767191797949486 26.886721680420106 21.155288822205552 25-29 23.51558201190536 28.3577609924466 27.44234905707568 20.684307938572356 30-34 22.936468234117058 28.094047023511752 27.533766883441718 21.435717858929465 35-39 23.761880940470235 27.523761880940473 27.843921960980488 20.870435217608804 40-44 23.742122636791038 27.513253976192857 27.903371011303392 20.841252375712713 45-49 22.870717679419855 27.81695423855964 27.991997999499873 21.32033008252063 50-54 23.120780195048763 27.73693423355839 27.73693423355839 21.405351337834457 55-59 23.215803950987745 28.27706926731683 27.41685421355339 21.090272568142034 60-64 23.70829790426649 27.63967388586005 27.589656379732908 21.06237183014055 65-69 23.441720860430216 27.103551775887947 27.91895947973987 21.53576788394197 70-74 24.00200100050025 27.238619309654826 27.383691845922964 21.375687843921963 75-79 23.262794536995347 28.160488268547702 26.824753614487967 21.751963579968983 80-84 23.8116681677174 27.769438607024917 27.103972780946663 21.314920444311017 85-89 23.626813406703352 27.86893446723362 27.35367683841921 21.15057528764382 90-94 23.796898449224614 27.698849424712357 27.788894447223612 20.715357678839418 95-99 23.84192096048024 27.55877938969485 27.908954477238616 20.690345172586294 100-104 24.17208604302151 27.41870935467734 27.738869434717362 20.670335167583794 105-109 24.117058529264632 28.29414707353677 27.178589294647328 20.410205102551277 110-114 23.856928464232116 28.284142071035518 27.378689344672335 20.48024012006003 115-119 24.007003501750876 28.404202101050522 27.228614307153578 20.36018009004502 120-124 24.39085405513584 28.123280132085853 27.152649221994295 20.33321659078401 125-129 24.34190771694525 28.405565008507654 26.80912821539386 20.44339905915324 130-134 24.741029875394087 27.76860331281589 27.05299504578892 20.4373717660011 135-139 24.4920428385547 27.609848863977582 27.925132619357424 19.9729756781103 140-144 24.98873930233722 27.56618787848456 27.165807517141282 20.279265302036936 145-149 25.15012009607686 27.301841473178545 26.96156925540432 20.586469175340273 150-151 25.01563477173233 27.4296435272045 27.542213883677295 20.012507817385867 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 1.0 24 1.5 25 3.5 26 2.5 27 1.0 28 5.0 29 8.5 30 11.5 31 18.0 32 31.0 33 38.0 34 42.5 35 60.0 36 83.0 37 104.5 38 124.5 39 160.5 40 195.0 41 198.5 42 235.5 43 274.0 44 270.5 45 281.0 46 275.0 47 243.0 48 213.5 49 196.0 50 184.0 51 157.5 52 119.0 53 95.0 54 88.5 55 75.5 56 54.5 57 40.0 58 30.5 59 25.0 60 17.0 61 9.5 62 7.0 63 4.5 64 2.5 65 2.0 66 2.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.05 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.01 20-24 0.025 25-29 0.045 30-34 0.05 35-39 0.05 40-44 0.03 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.034999999999999996 65-69 0.05 70-74 0.05 75-79 0.055 80-84 0.06999999999999999 85-89 0.05 90-94 0.05 95-99 0.05 100-104 0.05 105-109 0.05 110-114 0.05 115-119 0.05 120-124 0.065 125-129 0.09 130-134 0.08499999999999999 135-139 0.09 140-144 0.095 145-149 0.08 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.65 #Duplication Level Percentage of deduplicated Percentage of total 1 99.01165737455652 97.675 2 0.7856056766345666 1.55 3 0.10136847440446022 0.3 4 0.025342118601115054 0.1 5 0.07602635580334516 0.375 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTTCAGAGCCGTGTAGATCT 5 0.125 Illumina Single End PCR Primer 1 (96% over 32bp) ATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit ATTAATTAGGGCTGAAAGCCCTAACTTAATGGACGGGAGGTATCCCAATA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0125 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.125 0.0 0.0 0.0 0.0 80-81 0.1625 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5125 0.0 0.0 0.0 0.0 92-93 0.6499999999999999 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.85 0.0 0.0 0.0 0.0 98-99 0.9 0.0 0.0 0.0 0.0 100-101 1.025 0.0 0.0 0.0 0.0 102-103 1.2625000000000002 0.0 0.0 0.0 0.0 104-105 1.525 0.0 0.0 0.0 0.0 106-107 1.6625 0.0 0.0 0.0 0.0 108-109 1.9125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.9 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.475 0.0 0.0 0.0 0.0 130-131 4.875 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.5875 0.0 0.0 0.0 0.0 136-137 5.9375 0.0 0.0 0.0 0.0 138-139 6.137499999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAATGAG 10 0.006830828 145.0 9 >>END_MODULE Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633657 spots for SRR7170481.sra Written 633657 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra Read 633652 spots for SRR7170481.sra Written 633652 spots for SRR7170481.sra SRR ids: ['SRR7170481.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y4w1a243 SRR7170481.sra spots: 12673045 blocks: [[1, 633652], [633653, 1267304], [1267305, 1900956], [1900957, 2534608], [2534609, 3168260], [3168261, 3801912], [3801913, 4435564], [4435565, 5069216], [5069217, 5702868], [5702869, 6336520], [6336521, 6970172], [6970173, 7603824], [7603825, 8237476], [8237477, 8871128], [8871129, 9504780], [9504781, 10138432], [10138433, 10772084], [10772085, 11405736], [11405737, 12039388], [12039389, 12673045]] SRR7170481 file size 4272778 SRR7170481 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170481 SRR7170481_1.fastq SRR7170481_2.fastq Input file: SRR7170481_1.fastq Paired file: SRR7170481_2.fastq trimmed: SRR7170481-trimmed-pair1.fastq, SRR7170481-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:23:47 2025 >> started Wed Feb 12 22:24:02 2025 >> done (15.721s) 12673045 read pairs processed; of these: 21129 ( 0.17%) short read pairs filtered out after trimming by size control 35481 ( 0.28%) empty read pairs filtered out after trimming by size control 12616435 (99.55%) read pairs available; of these: 8186448 (64.89%) trimmed read pairs available after processing 4429987 (35.11%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 2 0.00% 20 1 0.00% 21 1 0.00% 22 2 0.00% 23 2 0.00% 24 1 0.00% 25 4 0.00% 26 3 0.00% 27 3 0.00% 28 8 0.00% 29 12 0.00% 30 6 0.00% 31 7 0.00% 32 7 0.00% 33 11 0.00% 34 7 0.00% 35 12 0.00% 36 10 0.00% 37 14 0.00% 38 15 0.00% 39 21 0.00% 40 19 0.00% 41 26 0.00% 42 36 0.00% 43 29 0.00% 44 39 0.00% 45 49 0.00% 46 60 0.00% 47 58 0.00% 48 64 0.00% 49 99 0.00% 50 97 0.00% 51 103 0.00% 52 129 0.00% 53 150 0.00% 54 162 0.00% 55 160 0.00% 56 176 0.00% 57 228 0.00% 58 266 0.00% 59 284 0.00% 60 349 0.00% 61 347 0.00% 62 387 0.00% 63 473 0.00% 64 508 0.00% 65 539 0.00% 66 601 0.00% 67 650 0.01% 68 744 0.01% 69 878 0.01% 70 1054 0.01% 71 1151 0.01% 72 1298 0.01% 73 1515 0.01% 74 1674 0.01% 75 1858 0.01% 76 2060 0.02% 77 2284 0.02% 78 2448 0.02% 79 2704 0.02% 80 3048 0.02% 81 3566 0.03% 82 3977 0.03% 83 4558 0.04% 84 5921 0.05% 85 6126 0.05% 86 6356 0.05% 87 6423 0.05% 88 6739 0.05% 89 6878 0.05% 90 7338 0.06% 91 7789 0.06% 92 8283 0.07% 93 9022 0.07% 94 9574 0.08% 95 10153 0.08% 96 10454 0.08% 97 11065 0.09% 98 11003 0.09% 99 11560 0.09% 100 12316 0.10% 101 12567 0.10% 102 13414 0.11% 103 13756 0.11% 104 14703 0.12% 105 15318 0.12% 106 16271 0.13% 107 16557 0.13% 108 16902 0.13% 109 17175 0.14% 110 17498 0.14% 111 17790 0.14% 112 18836 0.15% 113 19897 0.16% 114 20717 0.16% 115 21478 0.17% 116 22591 0.18% 117 23099 0.18% 118 24028 0.19% 119 24808 0.20% 120 25489 0.20% 121 26518 0.21% 122 28199 0.22% 123 29761 0.24% 124 30976 0.25% 125 33042 0.26% 126 35057 0.28% 127 36599 0.29% 128 38646 0.31% 129 41293 0.33% 130 43544 0.35% 131 46553 0.37% 132 49876 0.40% 133 53172 0.42% 134 56823 0.45% 135 62013 0.49% 136 66185 0.52% 137 71917 0.57% 138 78218 0.62% 139 85212 0.68% 140 94688 0.75% 141 104778 0.83% 142 118549 0.94% 143 136884 1.08% 144 163404 1.30% 145 200701 1.59% 146 261362 2.07% 147 363724 2.88% 148 560295 4.44% 149 1077244 8.54% 150 3630264 28.77% 151 4429987 35.11% 12616435 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.96 fanout-score-rank=28 prefix-density=0.48 prefix-fanout=1.9 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=104.25 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=10.1 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=1.20 sequence-density-rank=1 fanout-score=2.31 fanout-score-rank=26 prefix-density=1.24 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=28.15 fanout-score-rank=1 prefix-density=0.37 prefix-fanout=1.3 sequence=TTACTTCCATTTCCGCCCAAGCTGCTCACAGTATACGGGCGTCGGCATCCAGACCGTCGGCTGATCGTGGTTTTACTAGGCTAGACTAGCGTACGAGCACTATGGTCAGTAATTCCTGGAGGAATAGGTACCAAGAAAAAAACGAACCTTTGGGTTCCAGAGCTGTACGGTCGCACTGAACTCGGATAGGTCTCAGAAAAACGAAATATAGGCTTACGGTAGGTCCGAATGGCACAAAGCTTGTTCCGTTAGCTGGCATAAGATTCCATGCCTAGATGTGATACACGTTTCTGGAAACTGCCTCGTCATGCGACTGTTCCCCGGGGTCAGGGCCGCTGGTATTTGCTGTAAAGAGGGGCGTTGAGTCCGTCCGACTTCACTGCCCCCTTTCAGCCTTTTGGGTCCTGTATCCCAATTCTCAGAGGTCCCGCCGTACGCTGAGGACCACCTGAAACGGGCATCGTCGCTCTTCGTTGTTCGTCGACTTCTAGTGTGGAGACGAATTGCCAGA SRR7170481 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:24:52 Started mapping on | Feb 12 22:24:52 Finished on | Feb 12 22:27:10 Mapping speed, Million of reads per hour | 329.12 Number of input reads | 12616435 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 11472741 Uniquely mapped reads % | 90.93% Average mapped length | 291.77 Number of splices: Total | 11210169 Number of splices: Annotated (sjdb) | 10940430 Number of splices: GT/AG | 11009951 Number of splices: GC/AG | 157654 Number of splices: AT/AC | 7441 Number of splices: Non-canonical | 35123 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.86 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 324494 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 13551 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.34% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 833421 833421 833421 N_multimapping 324494 324494 324494 N_noFeature 344134 11212801 401332 N_ambiguous 302833 872 99697 UnstrandedReadsAssigned:10825774 PositiveStrandReadsAssigned:259068 NegativeStrandReadsAssigned:10971712 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170481 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170481-trimmed-pair1.fastq SRR7170481-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,616,435 reads, 10,893,202 reads pseudoaligned [quant] estimated average fragment length: 268.184 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,109 rounds 52401 SRR7170481.ke.tsv 34699 SRR7170481.se.tsv 87100 total ==> SRR7170481.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.82 621 23.0053 Potri.005G024800.1.v4.1 1035 767.816 436 36.8303 Potri.004G059700.1.v4.1 961 693.833 6 0.560883 Potri.007G009000.2.v4.1 1416 1148.82 0 0 Potri.003G141000.2.v4.1 2943 2675.82 478 11.5864 Potri.016G087400.1.v4.1 270 76.9529 821.653 692.531 Potri.015G069301.1.v4.1 564 301.513 0 0 Potri.010G195200.1.v4.1 1773 1505.82 113.917 4.90674 Potri.012G127500.1.v4.1 977 709.822 154 14.0717 ==> SRR7170481.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 701 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 381 Potri.001G212900.v4.1 6 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 95 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 3 SRR7170481 completed mapping pipeline successfully