Starting /dee2/code/volunteer_pipeline.sh SRR7170482 current disk space = 3050500964352 free memory = 1579632708 SRR7170482 SRAfilesize 6557d320484000c9445cdc85e040232f SRR7170482.sra SRR7170482.sra file validated SRR7170482 is paired end SRR7170482 is conventional basespace SRR7170482 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170482_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.247 25.0 18.0 33.0 18.0 33.0 2 23.494 18.0 18.0 29.0 18.0 33.0 3 28.853 29.0 27.0 31.0 25.0 33.0 4 31.105 31.0 30.0 33.0 29.0 33.0 5 32.26175 33.0 32.0 33.0 32.0 33.0 6 36.754 38.0 37.0 38.0 34.0 38.0 7 37.22275 38.0 38.0 38.0 36.0 38.0 8 37.502 38.0 38.0 38.0 37.0 38.0 9 37.3745 38.0 38.0 38.0 37.0 38.0 10-14 37.5914 38.0 38.0 38.0 37.8 38.0 15-19 37.61155 38.0 38.0 38.0 38.0 38.0 20-24 37.57935 38.0 38.0 38.0 38.0 38.0 25-29 37.541 38.0 38.0 38.0 38.0 38.0 30-34 37.532399999999996 38.0 38.0 38.0 37.8 38.0 35-39 37.4018 38.0 38.0 38.0 37.4 38.0 40-44 37.40775 38.0 38.0 38.0 37.0 38.0 45-49 37.21135 38.0 38.0 38.0 36.8 38.0 50-54 37.1977 38.0 38.0 38.0 36.6 38.0 55-59 37.065250000000006 38.0 38.0 38.0 35.8 38.0 60-64 37.0943 38.0 38.0 38.0 36.0 38.0 65-69 36.975300000000004 38.0 38.0 38.0 35.6 38.0 70-74 36.82965 38.0 38.0 38.0 35.2 38.0 75-79 36.6354 38.0 38.0 38.0 34.2 38.0 80-84 36.4037 38.0 37.8 38.0 34.0 38.0 85-89 36.360299999999995 38.0 38.0 38.0 34.0 38.0 90-94 36.27184999999999 38.0 37.2 38.0 33.4 38.0 95-99 35.82755 38.0 36.8 38.0 31.8 38.0 100-104 36.02225000000001 38.0 37.0 38.0 33.0 38.0 105-109 35.7448 38.0 36.6 38.0 31.0 38.0 110-114 35.49550000000001 38.0 36.2 38.0 30.2 38.0 115-119 35.11685 38.0 35.6 38.0 28.2 38.0 120-124 34.84930000000001 38.0 35.0 38.0 27.8 38.0 125-129 34.31314999999999 38.0 34.6 38.0 24.0 38.0 130-134 33.2007 38.0 32.4 38.0 19.2 38.0 135-139 32.6255 37.2 32.0 38.0 16.2 38.0 140-144 31.595349999999996 36.4 30.6 38.0 13.0 38.0 145-149 30.45595 36.0 29.2 38.0 8.4 38.0 150-151 24.7635 32.0 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 1.0 10 0.0 11 0.0 12 0.0 13 0.0 14 3.0 15 2.0 16 1.0 17 1.0 18 4.0 19 4.0 20 8.0 21 5.0 22 7.0 23 15.0 24 16.0 25 21.0 26 25.0 27 27.0 28 44.0 29 32.0 30 60.0 31 70.0 32 84.0 33 144.0 34 286.0 35 530.0 36 1402.0 37 1208.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 45.11065362840967 10.010293360782295 10.036026762738034 34.84302624807 2 24.725 13.225000000000001 34.699999999999996 27.35 3 19.075 21.275 25.474999999999998 34.175 4 22.35 28.499999999999996 23.799999999999997 25.35 5 22.05 33.5 24.575 19.875 6 19.175 35.325 25.424999999999997 20.075000000000003 7 13.750000000000002 24.05 44.5 17.7 8 18.0 25.45 30.9 25.650000000000002 9 16.075 23.75 35.5 24.675 10-14 19.17 30.5 27.42 22.91 15-19 19.44597229861493 28.761438071903594 27.861393069653484 23.931196559827992 20-24 19.54 28.68 27.915 23.865 25-29 19.225 29.01 28.035 23.73 30-34 19.37887577515503 28.470694138827767 28.470694138827767 23.679735947189435 35-39 19.446944694469448 29.022902290229023 27.912791279127912 23.617361736173617 40-44 19.316931693169316 29.167916791679165 27.63776377637764 23.877387738773876 45-49 19.6 29.299999999999997 27.37 23.73 50-54 19.89 29.154999999999998 27.700000000000003 23.255 55-59 19.84 28.775000000000002 28.044999999999998 23.34 60-64 19.645000000000003 28.565 28.215 23.575 65-69 19.825 28.725 27.495000000000005 23.955000000000002 70-74 20.165 29.104999999999997 27.61 23.119999999999997 75-79 19.622849139655862 28.156262505002 28.431372549019606 23.789515806322527 80-84 19.92797118847539 28.68147258903561 27.35094037615046 24.039615846338535 85-89 20.216010800540026 28.596429821491075 27.68638431921596 23.50117505875294 90-94 20.3 28.425 27.71 23.565 95-99 20.150000000000002 28.665000000000003 27.075 24.11 100-104 20.205000000000002 28.63 27.47 23.695 105-109 19.78 27.63 28.315 24.275 110-114 20.365 27.725 27.91 24.0 115-119 20.43 28.455000000000002 27.584999999999997 23.53 120-124 20.119999999999997 28.78 27.139999999999997 23.96 125-129 20.505000000000003 28.515 27.639999999999997 23.34 130-134 20.405 28.38 27.485 23.73 135-139 20.165 28.405 27.615000000000002 23.815 140-144 20.369999999999997 28.355000000000004 27.255000000000003 24.02 145-149 20.66 28.035 27.310000000000002 23.995 150-151 20.575 27.1125 28.525 23.7875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 1.0 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.5 21 2.5 22 1.5 23 0.5 24 1.0 25 3.0 26 5.5 27 5.5 28 8.0 29 12.0 30 16.5 31 24.0 32 38.0 33 45.0 34 55.0 35 78.0 36 103.5 37 134.0 38 160.5 39 173.0 40 198.5 41 215.0 42 229.0 43 262.5 44 270.5 45 268.5 46 252.5 47 239.0 48 224.0 49 201.0 50 182.0 51 141.0 52 109.5 53 92.0 54 66.5 55 44.5 56 40.5 57 34.5 58 19.5 59 14.5 60 10.0 61 6.5 62 4.5 63 1.5 64 0.5 65 0.5 66 0.5 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.85 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.01 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.04 80-84 0.04 85-89 0.005 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.25 #Duplication Level Percentage of deduplicated Percentage of total 1 99.34508816120908 98.6 2 0.5793450881612091 1.15 3 0.05037783375314861 0.15 4 0.025188916876574305 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625000000000001 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.125 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4500000000000002 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 1.9625 0.0 0.0 0.0 0.0 110-111 2.2125 0.0 0.0 0.0 0.0 112-113 2.525 0.0 0.0 0.0 0.0 114-115 2.6500000000000004 0.0 0.0 0.0 0.0 116-117 2.8875 0.0 0.0 0.0 0.0 118-119 3.2125 0.0 0.0 0.0 0.0 120-121 3.4749999999999996 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.9375 0.0 0.0 0.0 0.0 126-127 4.137499999999999 0.0 0.0 0.0 0.0 128-129 4.35 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 5.0625 0.0 0.0 0.0 0.0 136-137 5.262499999999999 0.0 0.0 0.0 0.0 138-139 5.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170482 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170482_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9235 33.0 33.0 34.0 32.0 34.0 2 33.062 34.0 33.0 34.0 32.0 34.0 3 33.075 34.0 33.0 34.0 33.0 34.0 4 33.03875 34.0 33.0 34.0 33.0 34.0 5 33.02125 34.0 33.0 34.0 33.0 34.0 6 37.157 38.0 38.0 38.0 37.0 38.0 7 37.1705 38.0 38.0 38.0 37.0 38.0 8 37.25225 38.0 38.0 38.0 37.0 38.0 9 37.26775 38.0 38.0 38.0 37.0 38.0 10-14 37.2242 38.0 38.0 38.0 37.0 38.0 15-19 37.206149999999994 38.0 38.0 38.0 37.0 38.0 20-24 37.1874 38.0 38.0 38.0 37.0 38.0 25-29 37.22085 38.0 38.0 38.0 37.0 38.0 30-34 37.17785 38.0 38.0 38.0 37.0 38.0 35-39 37.101350000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.1139 38.0 38.0 38.0 37.0 38.0 45-49 37.0632 38.0 38.0 38.0 36.6 38.0 50-54 37.032000000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.0309 38.0 38.0 38.0 36.6 38.0 60-64 37.02334999999999 38.0 38.0 38.0 36.0 38.0 65-69 36.940000000000005 38.0 38.0 38.0 36.0 38.0 70-74 36.82895 38.0 38.0 38.0 36.0 38.0 75-79 36.79075 38.0 38.0 38.0 36.0 38.0 80-84 36.6846 38.0 38.0 38.0 35.4 38.0 85-89 36.63825 38.0 38.0 38.0 35.2 38.0 90-94 36.5143 38.0 38.0 38.0 34.6 38.0 95-99 36.367000000000004 38.0 38.0 38.0 34.0 38.0 100-104 36.284499999999994 38.0 38.0 38.0 34.0 38.0 105-109 36.17385 38.0 38.0 38.0 33.8 38.0 110-114 35.98225 38.0 37.4 38.0 33.2 38.0 115-119 35.714150000000004 38.0 37.0 38.0 31.4 38.0 120-124 35.401050000000005 38.0 36.6 38.0 31.0 38.0 125-129 34.649750000000004 38.0 35.2 38.0 26.6 38.0 130-134 34.463750000000005 38.0 34.6 38.0 26.6 38.0 135-139 33.767250000000004 38.0 33.2 38.0 22.2 38.0 140-144 33.1124 38.0 33.0 38.0 18.6 38.0 145-149 32.2917 38.0 33.0 38.0 10.6 38.0 150-151 26.841375 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 1.0 4 2.0 5 3.0 6 3.0 7 2.0 8 0.0 9 0.0 10 2.0 11 1.0 12 1.0 13 3.0 14 3.0 15 4.0 16 0.0 17 2.0 18 11.0 19 6.0 20 10.0 21 7.0 22 15.0 23 10.0 24 15.0 25 9.0 26 22.0 27 21.0 28 29.0 29 27.0 30 40.0 31 34.0 32 59.0 33 105.0 34 171.0 35 283.0 36 759.0 37 2335.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.08708708708709 21.47147147147147 15.04004004004004 26.401401401401404 2 27.352352352352355 24.64964964964965 31.78178178178178 16.216216216216218 3 20.795795795795797 28.57857857857858 31.506506506506504 19.11911911911912 4 22.17217217217217 34.18418418418418 24.374374374374376 19.26926926926927 5 24.34934934934935 35.310310310310314 22.54754754754755 17.792792792792792 6 19.73980485364023 37.22792094070553 24.418313735301474 18.613960470352765 7 19.189392044033024 20.740555416562422 40.405303977983486 19.664748561421067 8 21.641230923192396 25.344008006004504 27.145359019264447 25.869402051538653 9 20.465349011758818 24.943707780835627 31.248436327245432 23.34250688016012 10-14 22.882161621215914 29.061796347260444 26.860145108831624 21.19589692269202 15-19 22.52189141856392 28.281210908181137 28.246184638478862 20.950713034776083 20-24 22.340106095485936 28.435592032829547 28.33550195175658 20.888799919927937 25-29 22.53753753753754 27.902902902902905 28.48848848848849 21.07107107107107 30-34 22.24224224224224 28.153153153153156 28.678678678678676 20.925925925925924 35-39 22.74774774774775 27.387387387387385 28.098098098098095 21.766766766766768 40-44 22.992992992992995 27.882882882882882 28.233233233233236 20.89089089089089 45-49 23.15199439467494 27.661278214303586 28.542115009258794 20.644612381762677 50-54 22.88674240528502 28.066663330163657 28.597167308943494 20.449426955607827 55-59 23.751376238614753 27.32459213291963 28.05524972475228 20.868781903713344 60-64 22.60760760760761 27.887887887887885 28.298298298298295 21.206206206206208 65-69 22.75275275275275 28.173173173173172 27.982982982982985 21.09109109109109 70-74 23.173173173173172 28.16816816816817 27.562562562562565 21.096096096096094 75-79 22.762762762762762 28.098098098098095 28.193193193193196 20.945945945945947 80-84 22.867867867867865 28.753753753753752 27.352352352352355 21.026026026026027 85-89 23.37837837837838 28.06806806806807 27.627627627627625 20.925925925925924 90-94 22.83783783783784 28.178178178178175 27.78778778778779 21.196196196196198 95-99 23.873873873873876 28.133133133133132 27.16216216216216 20.83083083083083 100-104 23.97897897897898 28.093093093093092 27.522522522522525 20.405405405405403 105-109 23.77877877877878 27.7027027027027 28.088088088088085 20.43043043043043 110-114 23.67867867867868 27.85785785785786 28.103103103103106 20.36036036036036 115-119 23.773773773773772 28.353353353353356 26.996996996996998 20.875875875875877 120-124 23.703703703703706 28.098098098098095 27.962962962962962 20.235235235235237 125-129 24.02902902902903 28.023023023023026 27.74774774774775 20.2002002002002 130-134 24.794794794794793 28.31831831831832 26.946946946946948 19.93993993993994 135-139 24.36936936936937 27.47747747747748 27.68268268268268 20.47047047047047 140-144 24.884884884884883 28.143143143143146 27.072072072072075 19.8998998998999 145-149 24.4994994994995 27.387387387387385 27.33233233233233 20.78078078078078 150-151 24.64964964964965 27.72772772772773 27.865365365365363 19.75725725725726 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.0 22 0.0 23 0.5 24 2.0 25 2.0 26 1.0 27 5.5 28 11.5 29 9.0 30 14.0 31 23.0 32 30.5 33 35.5 34 50.5 35 76.5 36 89.0 37 105.5 38 142.5 39 167.5 40 202.5 41 241.0 42 262.5 43 273.5 44 282.5 45 271.0 46 249.0 47 256.0 48 238.0 49 196.0 50 171.5 51 135.5 52 104.5 53 90.5 54 65.0 55 49.5 56 39.5 57 32.5 58 20.5 59 11.0 60 10.5 61 10.5 62 6.5 63 2.5 64 2.0 65 2.0 66 1.0 67 0.5 68 0.5 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.1 5 0.1 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.075 20-24 0.09 25-29 0.1 30-34 0.1 35-39 0.1 40-44 0.1 45-49 0.095 50-54 0.095 55-59 0.09 60-64 0.1 65-69 0.1 70-74 0.1 75-79 0.1 80-84 0.1 85-89 0.1 90-94 0.1 95-99 0.1 100-104 0.1 105-109 0.1 110-114 0.1 115-119 0.1 120-124 0.1 125-129 0.1 130-134 0.1 135-139 0.1 140-144 0.1 145-149 0.1 150-151 0.1 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.44612286002014 98.75 2 0.4531722054380665 0.8999999999999999 3 0.050352467270896276 0.15 4 0.050352467270896276 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0125 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.025 0.0 0.0 0.0 0.0 74-75 0.025 0.0 0.0 0.0 0.0 76-77 0.025 0.0 0.0 0.0 0.0 78-79 0.037500000000000006 0.0 0.0 0.0 0.0 80-81 0.1375 0.0 0.0 0.0 0.0 82-83 0.2 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2875 0.0 0.0 0.0 0.0 88-89 0.4 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7124999999999999 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 1.15 0.0 0.0 0.0 0.0 100-101 1.35 0.0 0.0 0.0 0.0 102-103 1.475 0.0 0.0 0.0 0.0 104-105 1.6 0.0 0.0 0.0 0.0 106-107 1.8625 0.0 0.0 0.0 0.0 108-109 2.0125 0.0 0.0 0.0 0.0 110-111 2.2625 0.0 0.0 0.0 0.0 112-113 2.575 0.0 0.0 0.0 0.0 114-115 2.7 0.0 0.0 0.0 0.0 116-117 2.9125 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.7375 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.125 0.0 0.0 0.0 0.0 128-129 4.3625 0.0 0.0 0.0 0.0 130-131 4.6 0.0 0.0 0.0 0.0 132-133 4.7875 0.0 0.0 0.0 0.0 134-135 5.0875 0.0 0.0 0.0 0.0 136-137 5.3125 0.0 0.0 0.0 0.0 138-139 5.612500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718797 spots for SRR7170482.sra Written 718797 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra Read 718783 spots for SRR7170482.sra Written 718783 spots for SRR7170482.sra SRR ids: ['SRR7170482.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ixcuhbr5 SRR7170482.sra spots: 14375674 blocks: [[1, 718783], [718784, 1437566], [1437567, 2156349], [2156350, 2875132], [2875133, 3593915], [3593916, 4312698], [4312699, 5031481], [5031482, 5750264], [5750265, 6469047], [6469048, 7187830], [7187831, 7906613], [7906614, 8625396], [8625397, 9344179], [9344180, 10062962], [10062963, 10781745], [10781746, 11500528], [11500529, 12219311], [12219312, 12938094], [12938095, 13656877], [13656878, 14375674]] SRR7170482 file size 4849743 SRR7170482 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170482 SRR7170482_1.fastq SRR7170482_2.fastq Input file: SRR7170482_1.fastq Paired file: SRR7170482_2.fastq trimmed: SRR7170482-trimmed-pair1.fastq, SRR7170482-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:25:18 2025 >> started Thu Feb 13 00:30:52 2025 >> done (333.620s) 14375674 read pairs processed; of these: 14997 ( 0.10%) short read pairs filtered out after trimming by size control 20733 ( 0.14%) empty read pairs filtered out after trimming by size control 14339944 (99.75%) read pairs available; of these: 9453252 (65.92%) trimmed read pairs available after processing 4886692 (34.08%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 1 0.00% 20 2 0.00% 21 2 0.00% 22 3 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 3 0.00% 27 6 0.00% 28 2 0.00% 29 2 0.00% 30 4 0.00% 31 8 0.00% 32 6 0.00% 33 7 0.00% 34 10 0.00% 35 13 0.00% 36 8 0.00% 37 17 0.00% 38 14 0.00% 39 21 0.00% 40 20 0.00% 41 25 0.00% 42 25 0.00% 43 32 0.00% 44 36 0.00% 45 35 0.00% 46 39 0.00% 47 49 0.00% 48 64 0.00% 49 79 0.00% 50 82 0.00% 51 128 0.00% 52 121 0.00% 53 108 0.00% 54 129 0.00% 55 150 0.00% 56 158 0.00% 57 177 0.00% 58 190 0.00% 59 228 0.00% 60 274 0.00% 61 305 0.00% 62 337 0.00% 63 446 0.00% 64 453 0.00% 65 482 0.00% 66 542 0.00% 67 628 0.00% 68 687 0.00% 69 773 0.01% 70 958 0.01% 71 1004 0.01% 72 1194 0.01% 73 1347 0.01% 74 1430 0.01% 75 1632 0.01% 76 1878 0.01% 77 1961 0.01% 78 2160 0.02% 79 2504 0.02% 80 2720 0.02% 81 3199 0.02% 82 3577 0.02% 83 4223 0.03% 84 5270 0.04% 85 5305 0.04% 86 5666 0.04% 87 5775 0.04% 88 6132 0.04% 89 6304 0.04% 90 6685 0.05% 91 7366 0.05% 92 7891 0.06% 93 8505 0.06% 94 9344 0.07% 95 9634 0.07% 96 10311 0.07% 97 10621 0.07% 98 10926 0.08% 99 11630 0.08% 100 12320 0.09% 101 12642 0.09% 102 13488 0.09% 103 14439 0.10% 104 15215 0.11% 105 15778 0.11% 106 16559 0.12% 107 17085 0.12% 108 17491 0.12% 109 17824 0.12% 110 18312 0.13% 111 18718 0.13% 112 20124 0.14% 113 20804 0.15% 114 21749 0.15% 115 22976 0.16% 116 23624 0.16% 117 24500 0.17% 118 25150 0.18% 119 26052 0.18% 120 27578 0.19% 121 28616 0.20% 122 29720 0.21% 123 31894 0.22% 124 33515 0.23% 125 34959 0.24% 126 37399 0.26% 127 39868 0.28% 128 42010 0.29% 129 43950 0.31% 130 46844 0.33% 131 50499 0.35% 132 53649 0.37% 133 57747 0.40% 134 62059 0.43% 135 67852 0.47% 136 74133 0.52% 137 79782 0.56% 138 88428 0.62% 139 97189 0.68% 140 109628 0.76% 141 123030 0.86% 142 140937 0.98% 143 164157 1.14% 144 198560 1.38% 145 247829 1.73% 146 323380 2.26% 147 452025 3.15% 148 694421 4.84% 149 1308272 9.12% 150 4124380 28.76% 151 4886692 34.08% 14339944 reads passed initial QC criterion=sequence-density sequence-density=0.39 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=26 prefix-density=0.40 prefix-fanout=2.0 sequence=ATACGGATAAAGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=26 fanout-score=22.76 fanout-score-rank=1 prefix-density=0.25 prefix-fanout=8.9 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.43 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=21 prefix-density=0.45 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=37.76 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.8 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170482 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:03:10 Started mapping on | Feb 13 01:03:26 Finished on | Feb 13 01:12:47 Mapping speed, Million of reads per hour | 92.02 Number of input reads | 14339944 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13308225 Uniquely mapped reads % | 92.81% Average mapped length | 292.16 Number of splices: Total | 13046895 Number of splices: Annotated (sjdb) | 12731984 Number of splices: GT/AG | 12806846 Number of splices: GC/AG | 190366 Number of splices: AT/AC | 8065 Number of splices: Non-canonical | 41618 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.24 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404794 % of reads mapped to multiple loci | 2.82% Number of reads mapped to too many loci | 15212 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.23% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 637264 637264 637264 N_multimapping 404794 404794 404794 N_noFeature 467084 13077990 530522 N_ambiguous 277572 861 110429 UnstrandedReadsAssigned:12563569 PositiveStrandReadsAssigned:229374 NegativeStrandReadsAssigned:12667274 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170482 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170482-trimmed-pair1.fastq SRR7170482-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,339,944 reads, 12,555,282 reads pseudoaligned [quant] estimated average fragment length: 273.709 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,256 rounds 52401 SRR7170482.ke.tsv 34699 SRR7170482.se.tsv 87100 total ==> SRR7170482.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.29 1081 43.5192 Potri.005G024800.1.v4.1 1035 762.291 294 27.0987 Potri.004G059700.1.v4.1 961 688.302 2 0.204161 Potri.007G009000.2.v4.1 1416 1143.29 0 0 Potri.003G141000.2.v4.1 2943 2670.29 465.641 12.2522 Potri.016G087400.1.v4.1 270 76.8625 909 830.944 Potri.015G069301.1.v4.1 564 296.317 0 0 Potri.010G195200.1.v4.1 1773 1500.29 380 17.7963 Potri.012G127500.1.v4.1 977 704.297 71 7.08313 ==> SRR7170482.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 503 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 56 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 113 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170482 completed mapping pipeline successfully