Starting /dee2/code/volunteer_pipeline.sh SRR7170483 current disk space = 3050484486144 free memory = 1462071488 SRR7170483 SRAfilesize 5e0351508444f4ebb0d318a954310085 SRR7170483.sra SRR7170483.sra file validated SRR7170483 is paired end SRR7170483 is conventional basespace SRR7170483 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170483_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.95175 30.0 18.0 33.0 18.0 33.0 2 30.50225 31.0 29.0 33.0 27.0 34.0 3 31.203 33.0 31.0 33.0 27.0 33.0 4 30.62275 31.0 29.0 33.0 28.0 33.0 5 32.30775 33.0 32.0 33.0 32.0 33.0 6 36.5815 38.0 37.0 38.0 34.0 38.0 7 37.2385 38.0 38.0 38.0 36.0 38.0 8 37.547 38.0 38.0 38.0 37.0 38.0 9 37.4075 38.0 38.0 38.0 37.0 38.0 10-14 37.4927 38.0 38.0 38.0 37.0 38.0 15-19 37.572950000000006 38.0 38.0 38.0 37.6 38.0 20-24 37.58675000000001 38.0 38.0 38.0 37.8 38.0 25-29 37.5333 38.0 38.0 38.0 37.8 38.0 30-34 37.5272 38.0 38.0 38.0 37.8 38.0 35-39 37.37740000000001 38.0 38.0 38.0 37.2 38.0 40-44 37.425650000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.2393 38.0 38.0 38.0 37.0 38.0 50-54 37.1766 38.0 38.0 38.0 36.0 38.0 55-59 37.06925 38.0 38.0 38.0 35.8 38.0 60-64 37.1114 38.0 38.0 38.0 36.0 38.0 65-69 36.91515 38.0 38.0 38.0 35.4 38.0 70-74 36.87015 38.0 38.0 38.0 35.2 38.0 75-79 36.60960000000001 38.0 38.0 38.0 34.2 38.0 80-84 36.36035 38.0 38.0 38.0 34.0 38.0 85-89 36.3994 38.0 37.8 38.0 34.0 38.0 90-94 36.12624999999999 38.0 37.0 38.0 33.6 38.0 95-99 35.7188 38.0 36.6 38.0 31.0 38.0 100-104 35.9016 38.0 37.0 38.0 31.8 38.0 105-109 35.60745 38.0 36.4 38.0 30.2 38.0 110-114 35.5284 38.0 36.0 38.0 30.6 38.0 115-119 35.12425 38.0 35.4 38.0 28.6 38.0 120-124 34.7649 38.0 35.0 38.0 27.0 38.0 125-129 34.2834 38.0 34.6 38.0 24.4 38.0 130-134 33.117399999999996 38.0 32.0 38.0 17.8 38.0 135-139 32.521 37.2 31.2 38.0 15.0 38.0 140-144 31.50335 36.2 30.0 38.0 13.0 38.0 145-149 30.517899999999997 36.0 29.4 38.0 8.4 38.0 150-151 24.6265 32.0 15.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 0.0 15 2.0 16 2.0 17 4.0 18 3.0 19 7.0 20 4.0 21 3.0 22 4.0 23 14.0 24 19.0 25 11.0 26 24.0 27 36.0 28 40.0 29 42.0 30 53.0 31 89.0 32 109.0 33 169.0 34 258.0 35 505.0 36 1221.0 37 1379.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 34.32325886990802 10.459921156373193 11.37976346911958 43.83705650459921 2 19.925 16.325 33.775 29.975 3 19.375 21.25 26.25 33.125 4 24.20605151287822 28.182045511377847 21.580395098774694 26.03150787696924 5 23.825 32.625 22.8 20.75 6 19.55 35.3 24.875 20.275000000000002 7 14.124999999999998 26.55 42.15 17.175 8 18.625 24.85 30.45 26.075 9 16.35 25.900000000000002 33.550000000000004 24.2 10-14 19.285 30.4 27.595 22.720000000000002 15-19 19.585 28.59 27.805000000000003 24.02 20-24 19.93 28.610000000000003 27.82 23.64 25-29 19.02 29.935000000000002 27.529999999999998 23.515 30-34 19.865993299664982 28.666433321666084 27.586379318965946 23.881194059702985 35-39 19.525000000000002 27.87 28.549999999999997 24.055 40-44 20.01 28.799999999999997 27.715 23.474999999999998 45-49 19.375 29.165000000000003 27.474999999999998 23.985 50-54 19.814999999999998 28.275 27.92 23.990000000000002 55-59 19.84 28.775000000000002 27.755000000000003 23.630000000000003 60-64 20.135 28.985 27.565 23.315 65-69 20.095 28.615000000000002 27.279999999999998 24.01 70-74 19.79 28.410000000000004 28.225 23.575 75-79 19.68098404920246 28.346417320866042 28.026401320066004 23.946197309865493 80-84 19.90398079615923 28.630726145229048 27.245449089817964 24.219843968793757 85-89 19.805 28.915000000000003 27.474999999999998 23.805 90-94 20.32 28.215 27.415 24.05 95-99 20.025000000000002 29.04 27.245 23.69 100-104 19.994999999999997 28.42 27.950000000000003 23.635 105-109 20.135 28.53 27.33 24.005000000000003 110-114 19.55 27.915 28.38 24.154999999999998 115-119 20.465 27.98 27.58 23.974999999999998 120-124 19.975 27.77 27.425 24.83 125-129 20.424999999999997 27.93 28.015 23.630000000000003 130-134 21.175 27.46 27.05 24.315 135-139 20.255000000000003 28.29 27.74 23.715 140-144 20.560000000000002 28.4 27.325 23.715 145-149 20.515 27.925 27.505000000000003 24.055 150-151 20.05 27.625 27.8625 24.462500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.0 22 0.0 23 0.5 24 2.0 25 3.5 26 5.0 27 4.5 28 4.5 29 8.0 30 15.0 31 24.0 32 35.0 33 45.0 34 60.0 35 82.0 36 103.0 37 129.5 38 153.5 39 180.5 40 198.0 41 202.5 42 233.5 43 252.5 44 267.0 45 277.5 46 259.0 47 244.5 48 224.5 49 195.0 50 172.5 51 140.0 52 108.0 53 95.0 54 72.0 55 53.5 56 45.5 57 29.0 58 18.5 59 19.0 60 14.5 61 7.0 62 4.5 63 3.5 64 1.5 65 1.0 66 1.0 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.875 2 0.0 3 0.0 4 0.025 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5285678328718851 1.05 3 0.07550969041026932 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.9125 0.0 0.0 0.0 0.0 110-111 1.0625 0.0 0.0 0.0 0.0 112-113 1.275 0.0 0.0 0.0 0.0 114-115 1.5 0.0 0.0 0.0 0.0 116-117 1.6875 0.0 0.0 0.0 0.0 118-119 1.9 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.875 0.0 0.0 0.0 0.0 130-131 3.125 0.0 0.0 0.0 0.0 132-133 3.4125 0.0 0.0 0.0 0.0 134-135 3.7 0.0 0.0 0.0 0.0 136-137 4.0 0.0 0.0 0.0 0.0 138-139 4.3125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AGGAAAC 10 0.0068378756 144.95 6 GTAAAGA 10 0.0068378756 144.95 9 >>END_MODULE SRR7170483 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170483_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.90925 33.0 33.0 34.0 32.0 34.0 2 33.005 34.0 33.0 34.0 32.0 34.0 3 33.05525 34.0 33.0 34.0 32.0 34.0 4 32.995 34.0 33.0 34.0 32.0 34.0 5 33.02825 34.0 33.0 34.0 32.0 34.0 6 37.23925 38.0 38.0 38.0 37.0 38.0 7 37.2205 38.0 38.0 38.0 37.0 38.0 8 37.20525 38.0 38.0 38.0 37.0 38.0 9 37.29975 38.0 38.0 38.0 37.0 38.0 10-14 37.23245000000001 38.0 38.0 38.0 37.0 38.0 15-19 37.21294999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.21585 38.0 38.0 38.0 37.0 38.0 25-29 37.2112 38.0 38.0 38.0 37.0 38.0 30-34 37.15155 38.0 38.0 38.0 37.0 38.0 35-39 37.1498 38.0 38.0 38.0 37.0 38.0 40-44 37.119699999999995 38.0 38.0 38.0 37.0 38.0 45-49 37.126900000000006 38.0 38.0 38.0 37.0 38.0 50-54 37.06675 38.0 38.0 38.0 37.0 38.0 55-59 37.0457 38.0 38.0 38.0 36.6 38.0 60-64 36.9942 38.0 38.0 38.0 36.2 38.0 65-69 36.9481 38.0 38.0 38.0 36.0 38.0 70-74 36.8117 38.0 38.0 38.0 36.0 38.0 75-79 36.8159 38.0 38.0 38.0 35.8 38.0 80-84 36.6669 38.0 38.0 38.0 35.2 38.0 85-89 36.68695 38.0 38.0 38.0 35.6 38.0 90-94 36.48965 38.0 38.0 38.0 34.6 38.0 95-99 36.398300000000006 38.0 38.0 38.0 34.2 38.0 100-104 36.30605 38.0 38.0 38.0 34.0 38.0 105-109 36.1613 38.0 38.0 38.0 33.8 38.0 110-114 36.0437 38.0 37.4 38.0 33.6 38.0 115-119 35.7992 38.0 37.0 38.0 32.6 38.0 120-124 35.4901 38.0 36.6 38.0 30.6 38.0 125-129 34.77735 38.0 35.6 38.0 26.8 38.0 130-134 34.59015 38.0 34.8 38.0 27.4 38.0 135-139 34.11275 38.0 33.8 38.0 25.0 38.0 140-144 33.453250000000004 38.0 33.2 38.0 20.8 38.0 145-149 32.79655 38.0 33.0 38.0 16.8 38.0 150-151 27.402625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 2.0 4 0.0 5 0.0 6 2.0 7 1.0 8 1.0 9 1.0 10 0.0 11 1.0 12 4.0 13 2.0 14 3.0 15 2.0 16 3.0 17 3.0 18 3.0 19 3.0 20 9.0 21 7.0 22 3.0 23 8.0 24 12.0 25 10.0 26 16.0 27 24.0 28 24.0 29 32.0 30 34.0 31 53.0 32 69.0 33 98.0 34 187.0 35 273.0 36 701.0 37 2396.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 33.77533149862397 19.5896922692019 17.212909682261696 29.422066549912433 2 24.768576432324245 27.270452839629723 30.97322992244183 16.987740805604204 3 19.88991743807856 28.096072054040533 31.64873655241431 20.365273955466602 4 23.34250688016012 33.75031273455092 24.91868901676257 17.988491368526393 5 25.293970477858394 34.92619464598449 22.892169126845133 16.887665749311985 6 20.115086314736054 38.10357768326244 23.91793845384038 17.86339754816112 7 19.664748561421067 19.989992494370778 40.58043532649487 19.764823617713283 8 21.240930698023515 26.09457092819615 28.396297222917187 24.26820115086315 9 21.215911933950462 25.193895421566175 31.07330497873405 22.516887665749312 10-14 23.742807105328996 28.886664998749062 26.024518388791595 21.346009507130347 15-19 22.677007755816863 27.800850637978485 28.651488616462345 20.870652989742304 20-24 22.687015261446085 28.676507380535405 27.690768076057044 20.945709281961474 25-29 22.98223667750813 28.576432324243186 27.890918188641482 20.550412809607206 30-34 22.39179384538404 28.74655991993996 28.241180885664246 20.62046534901176 35-39 23.252439329497125 28.506379784838632 27.47560670502877 20.765574180635475 40-44 23.197398048536403 28.431323492619466 27.51563672754566 20.855641731298473 45-49 23.167375531648737 28.36627470602952 27.72079059294471 20.745559169377035 50-54 22.787090317738304 28.19614711033275 27.820865649236925 21.19589692269202 55-59 23.6977733299975 27.87090317738304 27.865899424568426 20.565424068051037 60-64 23.112334250688015 27.850888166124594 27.905929447085313 21.130848136102077 65-69 23.572679509632223 27.775831873905428 27.905929447085313 20.745559169377035 70-74 23.512634475856892 27.775831873905428 27.93094821115837 20.78058543907931 75-79 23.597698273705277 28.426319739804857 27.545659244433324 20.430322742056543 80-84 24.259407526020816 27.507005604483588 27.542033626901517 20.691553242594075 85-89 23.772829622216662 28.61145859394546 26.815111333500123 20.800600450337754 90-94 23.672754565924443 28.226169627220415 27.425569176882664 20.675506629972478 95-99 23.35251438578934 28.066049537152864 27.730798098573928 20.850637978483864 100-104 23.90793094821116 27.990993244933698 27.110332749562172 20.99074305729297 105-109 23.937953465098825 27.88091068301226 27.63572679509632 20.545409056792593 110-114 24.093069802351764 27.435576682511886 27.875906930197647 20.595446584938703 115-119 24.568426319739807 27.790843132349263 26.860145108831624 20.78058543907931 120-124 24.234387510008006 28.037429943955168 27.4919935948759 20.23618895116093 125-129 24.42320204193984 28.166758420499477 27.13577899004054 20.274260547520147 130-134 24.593363695510735 27.756368550122616 27.77138281367299 19.87888494069366 135-139 24.454454454454456 28.703703703703702 26.686686686686688 20.155155155155153 140-144 24.78978978978979 28.27827827827828 27.17217217217217 19.75975975975976 145-149 24.68721849664698 27.810029026123512 27.399659693724352 20.103092783505154 150-151 24.1556167125344 28.32124093069802 28.13360020015011 19.389542156617463 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 3.0 1 1.5 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 1.5 22 1.0 23 0.0 24 1.5 25 2.5 26 3.0 27 6.0 28 7.5 29 7.0 30 13.5 31 20.0 32 24.0 33 29.5 34 49.0 35 67.5 36 86.0 37 106.0 38 120.5 39 157.5 40 209.0 41 244.0 42 263.5 43 281.0 44 280.5 45 278.5 46 280.5 47 262.5 48 236.5 49 212.5 50 166.5 51 128.0 52 103.0 53 77.5 54 62.0 55 53.0 56 46.0 57 31.5 58 24.5 59 17.0 60 8.5 61 7.5 62 5.0 63 4.5 64 3.5 65 1.5 66 1.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.075 7 0.075 8 0.075 9 0.075 10-14 0.075 15-19 0.075 20-24 0.075 25-29 0.075 30-34 0.075 35-39 0.075 40-44 0.075 45-49 0.075 50-54 0.075 55-59 0.075 60-64 0.075 65-69 0.075 70-74 0.075 75-79 0.075 80-84 0.08 85-89 0.075 90-94 0.075 95-99 0.075 100-104 0.075 105-109 0.075 110-114 0.075 115-119 0.075 120-124 0.08 125-129 0.095 130-134 0.095 135-139 0.1 140-144 0.1 145-149 0.09 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31852599697123 98.375 2 0.5300353356890459 1.05 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.025239777889954566 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.037500000000000006 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.0625 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.225 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.25 0.0 0.0 0.0 0.0 96-97 0.375 0.0 0.0 0.0 0.0 98-99 0.4875 0.0 0.0 0.0 0.0 100-101 0.5875 0.0 0.0 0.0 0.0 102-103 0.6625000000000001 0.0 0.0 0.0 0.0 104-105 0.7124999999999999 0.0 0.0 0.0 0.0 106-107 0.8 0.0 0.0 0.0 0.0 108-109 0.8875 0.0 0.0 0.0 0.0 110-111 1.0125 0.0 0.0 0.0 0.0 112-113 1.225 0.0 0.0 0.0 0.0 114-115 1.475 0.0 0.0 0.0 0.0 116-117 1.6625 0.0 0.0 0.0 0.0 118-119 1.875 0.0 0.0 0.0 0.0 120-121 2.0999999999999996 0.0 0.0 0.0 0.0 122-123 2.2 0.0 0.0 0.0 0.0 124-125 2.3499999999999996 0.0 0.0 0.0 0.0 126-127 2.55 0.0 0.0 0.0 0.0 128-129 2.9124999999999996 0.0 0.0 0.0 0.0 130-131 3.1875 0.0 0.0 0.0 0.0 132-133 3.4875 0.0 0.0 0.0 0.0 134-135 3.75 0.0 0.0 0.0 0.0 136-137 4.0625 0.0 0.0 0.0 0.0 138-139 4.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AAAAAAA 30 0.0014437955 24.166668 10-14 >>END_MODULE Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700863 spots for SRR7170483.sra Written 700863 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra Read 700855 spots for SRR7170483.sra Written 700855 spots for SRR7170483.sra SRR ids: ['SRR7170483.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_op8l_e1s SRR7170483.sra spots: 14017108 blocks: [[1, 700855], [700856, 1401710], [1401711, 2102565], [2102566, 2803420], [2803421, 3504275], [3504276, 4205130], [4205131, 4905985], [4905986, 5606840], [5606841, 6307695], [6307696, 7008550], [7008551, 7709405], [7709406, 8410260], [8410261, 9111115], [9111116, 9811970], [9811971, 10512825], [10512826, 11213680], [11213681, 11914535], [11914536, 12615390], [12615391, 13316245], [13316246, 14017108]] SRR7170483 file size 4728237 SRR7170483 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170483 SRR7170483_1.fastq SRR7170483_2.fastq Input file: SRR7170483_1.fastq Paired file: SRR7170483_2.fastq trimmed: SRR7170483-trimmed-pair1.fastq, SRR7170483-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Wed Feb 12 22:50:25 2025 >> started Wed Feb 12 22:50:42 2025 >> done (17.147s) 14017108 read pairs processed; of these: 13813 ( 0.10%) short read pairs filtered out after trimming by size control 20461 ( 0.15%) empty read pairs filtered out after trimming by size control 13982834 (99.76%) read pairs available; of these: 9046742 (64.70%) trimmed read pairs available after processing 4936092 (35.30%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 3 0.00% 20 1 0.00% 21 3 0.00% 22 1 0.00% 23 4 0.00% 24 1 0.00% 25 1 0.00% 26 4 0.00% 27 1 0.00% 28 5 0.00% 29 6 0.00% 30 7 0.00% 31 3 0.00% 32 1 0.00% 33 3 0.00% 34 5 0.00% 35 6 0.00% 36 9 0.00% 37 7 0.00% 38 12 0.00% 39 5 0.00% 40 14 0.00% 41 10 0.00% 42 17 0.00% 43 12 0.00% 44 19 0.00% 45 17 0.00% 46 30 0.00% 47 37 0.00% 48 35 0.00% 49 45 0.00% 50 59 0.00% 51 52 0.00% 52 75 0.00% 53 81 0.00% 54 78 0.00% 55 98 0.00% 56 119 0.00% 57 119 0.00% 58 143 0.00% 59 166 0.00% 60 188 0.00% 61 216 0.00% 62 224 0.00% 63 243 0.00% 64 292 0.00% 65 338 0.00% 66 367 0.00% 67 427 0.00% 68 422 0.00% 69 532 0.00% 70 559 0.00% 71 687 0.00% 72 804 0.01% 73 922 0.01% 74 1006 0.01% 75 1147 0.01% 76 1287 0.01% 77 1410 0.01% 78 1481 0.01% 79 1709 0.01% 80 1877 0.01% 81 2251 0.02% 82 2571 0.02% 83 2942 0.02% 84 3910 0.03% 85 4023 0.03% 86 4203 0.03% 87 4160 0.03% 88 4537 0.03% 89 4601 0.03% 90 5009 0.04% 91 5542 0.04% 92 5891 0.04% 93 6465 0.05% 94 6921 0.05% 95 7415 0.05% 96 7800 0.06% 97 8196 0.06% 98 8430 0.06% 99 8813 0.06% 100 9323 0.07% 101 9988 0.07% 102 10574 0.08% 103 11214 0.08% 104 11684 0.08% 105 12592 0.09% 106 13531 0.10% 107 13576 0.10% 108 14207 0.10% 109 14607 0.10% 110 14933 0.11% 111 15659 0.11% 112 16225 0.12% 113 17182 0.12% 114 18029 0.13% 115 18884 0.14% 116 19791 0.14% 117 20851 0.15% 118 21607 0.15% 119 22344 0.16% 120 23114 0.17% 121 24509 0.18% 122 25616 0.18% 123 27270 0.20% 124 28656 0.20% 125 30745 0.22% 126 32406 0.23% 127 34603 0.25% 128 36480 0.26% 129 39018 0.28% 130 41866 0.30% 131 44694 0.32% 132 47681 0.34% 133 52137 0.37% 134 55731 0.40% 135 61077 0.44% 136 66187 0.47% 137 73069 0.52% 138 80764 0.58% 139 89748 0.64% 140 100382 0.72% 141 113767 0.81% 142 130879 0.94% 143 153521 1.10% 144 186439 1.33% 145 233439 1.67% 146 305641 2.19% 147 431597 3.09% 148 667175 4.77% 149 1275892 9.12% 150 4104703 29.36% 151 4936092 35.30% 13982834 reads passed initial QC criterion=sequence-density sequence-density=0.41 sequence-density-rank=1 fanout-score=2.10 fanout-score-rank=20 prefix-density=0.43 prefix-fanout=2.0 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=74.26 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.38 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.3 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.09 sequence-density-rank=25 fanout-score=32.18 fanout-score-rank=1 prefix-density=0.28 prefix-fanout=10.4 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170483 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 12 22:51:25 Started mapping on | Feb 12 22:51:26 Finished on | Feb 12 22:53:02 Mapping speed, Million of reads per hour | 524.36 Number of input reads | 13982834 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13128391 Uniquely mapped reads % | 93.89% Average mapped length | 293.32 Number of splices: Total | 12878817 Number of splices: Annotated (sjdb) | 12595852 Number of splices: GT/AG | 12649472 Number of splices: GC/AG | 185032 Number of splices: AT/AC | 7981 Number of splices: Non-canonical | 36332 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.80 Insertion rate per base | 0.02% Insertion average length | 2.04 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 399589 % of reads mapped to multiple loci | 2.86% Number of reads mapped to too many loci | 21664 % of reads mapped to too many loci | 0.15% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.06% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463903 463903 463903 N_multimapping 399589 399589 399589 N_noFeature 386688 12915402 440271 N_ambiguous 262448 1001 102563 UnstrandedReadsAssigned:12479255 PositiveStrandReadsAssigned:211988 NegativeStrandReadsAssigned:12585557 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170483 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170483-trimmed-pair1.fastq SRR7170483-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,982,834 reads, 12,508,012 reads pseudoaligned [quant] estimated average fragment length: 276.326 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,249 rounds 52401 SRR7170483.ke.tsv 34699 SRR7170483.se.tsv 87100 total ==> SRR7170483.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.67 798 31.5728 Potri.005G024800.1.v4.1 1035 759.674 323 29.3158 Potri.004G059700.1.v4.1 961 685.674 5 0.502782 Potri.007G009000.2.v4.1 1416 1140.67 0 0 Potri.003G141000.2.v4.1 2943 2667.67 690.824 17.8551 Potri.016G087400.1.v4.1 270 72.9352 1511 1428.41 Potri.015G069301.1.v4.1 564 293.756 0 0 Potri.010G195200.1.v4.1 1773 1497.67 467.979 21.5445 Potri.012G127500.1.v4.1 977 701.674 54 5.30622 ==> SRR7170483.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 478 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 272 Potri.001G212900.v4.1 9 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 26 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 4 SRR7170483 completed mapping pipeline successfully