Starting /dee2/code/volunteer_pipeline.sh SRR7170484 current disk space = 3050495750144 free memory = 1575470984 SRR7170484 SRAfilesize d2bd44b91e622401eeeceeace376f2d4 SRR7170484.sra SRR7170484.sra file validated SRR7170484 is paired end SRR7170484 is conventional basespace SRR7170484 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170484_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.164 30.0 18.0 33.0 18.0 33.0 2 30.24075 31.0 29.0 33.0 27.0 33.0 3 29.6035 31.0 29.0 33.0 25.0 33.0 4 29.35525 31.0 29.0 33.0 25.0 33.0 5 32.1855 33.0 32.0 33.0 32.0 33.0 6 36.515 38.0 37.0 38.0 34.0 38.0 7 37.19525 38.0 38.0 38.0 36.0 38.0 8 37.48375 38.0 38.0 38.0 37.0 38.0 9 37.5945 38.0 38.0 38.0 37.0 38.0 10-14 37.5358 38.0 38.0 38.0 37.0 38.0 15-19 37.653200000000005 38.0 38.0 38.0 38.0 38.0 20-24 37.67139999999999 38.0 38.0 38.0 38.0 38.0 25-29 37.6617 38.0 38.0 38.0 38.0 38.0 30-34 37.5894 38.0 38.0 38.0 38.0 38.0 35-39 37.5373 38.0 38.0 38.0 38.0 38.0 40-44 37.50905 38.0 38.0 38.0 37.8 38.0 45-49 37.4277 38.0 38.0 38.0 37.0 38.0 50-54 37.364999999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.15995 38.0 38.0 38.0 36.0 38.0 60-64 37.14789999999999 38.0 38.0 38.0 36.0 38.0 65-69 37.005849999999995 38.0 38.0 38.0 35.8 38.0 70-74 36.93575 38.0 38.0 38.0 35.6 38.0 75-79 36.81255 38.0 38.0 38.0 34.8 38.0 80-84 36.671800000000005 38.0 38.0 38.0 34.4 38.0 85-89 36.609950000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.4654 38.0 37.4 38.0 34.0 38.0 95-99 36.286500000000004 38.0 37.0 38.0 33.6 38.0 100-104 35.645399999999995 38.0 36.4 38.0 30.4 38.0 105-109 35.85724999999999 38.0 37.0 38.0 32.4 38.0 110-114 35.66295 38.0 36.0 38.0 30.6 38.0 115-119 35.264050000000005 38.0 35.8 38.0 28.8 38.0 120-124 34.95315 38.0 35.2 38.0 27.8 38.0 125-129 34.7118 38.0 35.0 38.0 27.4 38.0 130-134 34.50315 38.0 34.6 38.0 26.4 38.0 135-139 33.6252 38.0 33.4 38.0 21.4 38.0 140-144 32.906 37.6 32.6 38.0 18.6 38.0 145-149 31.156599999999997 36.2 30.4 38.0 10.8 38.0 150-151 27.2175 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 9 2.0 10 0.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 1.0 17 1.0 18 2.0 19 4.0 20 4.0 21 6.0 22 3.0 23 3.0 24 8.0 25 11.0 26 21.0 27 23.0 28 20.0 29 35.0 30 46.0 31 61.0 32 83.0 33 136.0 34 254.0 35 509.0 36 1327.0 37 1437.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.87759336099585 10.088174273858922 10.425311203319502 42.60892116182573 2 20.95 15.75 32.675 30.625000000000004 3 20.1 19.825 26.35 33.725 4 23.3 27.450000000000003 23.05 26.200000000000003 5 22.75 31.574999999999996 24.725 20.95 6 19.725 35.725 24.925 19.625 7 15.049999999999999 24.925 41.6 18.425 8 17.45 25.45 30.925000000000004 26.174999999999997 9 17.349999999999998 24.474999999999998 34.599999999999994 23.575 10-14 19.095000000000002 30.220000000000002 26.735 23.95 15-19 19.75 28.7 28.449999999999996 23.1 20-24 19.57 28.49 27.634999999999998 24.305 25-29 19.405 29.189999999999998 27.48 23.925 30-34 19.814999999999998 29.270000000000003 27.389999999999997 23.525 35-39 19.85 28.349999999999998 28.095 23.705000000000002 40-44 19.445 28.860000000000003 27.82 23.875 45-49 19.405 29.375 27.495000000000005 23.724999999999998 50-54 19.35 28.945 27.634999999999998 24.07 55-59 19.705000000000002 28.595 27.894999999999996 23.805 60-64 19.865 28.705000000000002 27.775 23.655 65-69 19.855 28.33 27.689999999999998 24.125 70-74 19.900000000000002 28.22 28.215 23.665 75-79 19.73098654932747 28.131406570328515 28.10140507025351 24.036201810090503 80-84 19.912986948042207 28.594289143371505 27.044056608491275 24.448667300095014 85-89 20.31 28.694999999999997 27.22 23.775 90-94 20.22 28.449999999999996 27.375 23.955000000000002 95-99 20.275000000000002 28.749999999999996 27.455000000000002 23.52 100-104 20.525 27.97 27.52 23.985 105-109 20.31 28.26 27.215 24.215 110-114 20.54 28.544999999999998 27.229999999999997 23.685000000000002 115-119 20.525 28.305000000000003 27.445000000000004 23.724999999999998 120-124 20.86 27.894999999999996 27.045 24.2 125-129 19.985 28.84 27.295 23.880000000000003 130-134 20.73 27.67 27.13 24.47 135-139 20.94 28.115000000000002 26.965 23.98 140-144 21.005 27.089999999999996 27.735 24.169999999999998 145-149 20.27 27.800000000000004 27.05 24.88 150-151 20.25 28.275 27.1375 24.337500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.5 15 1.5 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 2.5 23 3.5 24 2.5 25 2.0 26 4.5 27 8.0 28 7.0 29 8.0 30 17.0 31 25.5 32 39.5 33 50.0 34 63.5 35 74.5 36 92.0 37 122.5 38 148.5 39 176.0 40 198.5 41 225.5 42 242.0 43 243.5 44 244.5 45 252.0 46 237.0 47 219.5 48 212.5 49 196.5 50 182.0 51 150.5 52 124.0 53 106.5 54 77.5 55 56.5 56 51.0 57 39.0 58 24.5 59 22.0 60 18.0 61 11.5 62 6.5 63 2.5 64 2.0 65 0.5 66 1.5 67 1.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.5999999999999996 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.14032869785082 98.02499999999999 2 0.6826801517067004 1.35 3 0.07585335018963338 0.22499999999999998 4 0.1011378002528445 0.4 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.1125 0.0 0.0 0.0 0.0 102-103 1.2 0.0 0.0 0.0 0.0 104-105 1.3125 0.0 0.0 0.0 0.0 106-107 1.4625 0.0 0.0 0.0 0.0 108-109 1.575 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.675 0.0 0.0 0.0 0.0 118-119 2.95 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.1125 0.0 0.0 0.0 0.0 130-131 4.4875 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.237500000000001 0.0 0.0 0.0 0.0 138-139 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170484 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170484_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.95325 33.0 33.0 34.0 32.0 34.0 2 33.06275 34.0 33.0 34.0 33.0 34.0 3 33.1135 34.0 33.0 34.0 33.0 34.0 4 33.05275 34.0 33.0 34.0 33.0 34.0 5 33.03975 34.0 33.0 34.0 33.0 34.0 6 37.244 38.0 38.0 38.0 37.0 38.0 7 37.32475 38.0 38.0 38.0 37.0 38.0 8 37.2695 38.0 38.0 38.0 37.0 38.0 9 37.27825 38.0 38.0 38.0 38.0 38.0 10-14 37.24905 38.0 38.0 38.0 37.4 38.0 15-19 37.16955 38.0 38.0 38.0 37.0 38.0 20-24 37.14245 38.0 38.0 38.0 37.0 38.0 25-29 37.165949999999995 38.0 38.0 38.0 37.2 38.0 30-34 37.097300000000004 38.0 38.0 38.0 37.0 38.0 35-39 37.110150000000004 38.0 38.0 38.0 37.0 38.0 40-44 37.09635 38.0 38.0 38.0 37.0 38.0 45-49 37.06045 38.0 38.0 38.0 37.0 38.0 50-54 37.020500000000006 38.0 38.0 38.0 36.8 38.0 55-59 36.98515 38.0 38.0 38.0 36.6 38.0 60-64 36.92655 38.0 38.0 38.0 36.0 38.0 65-69 36.874399999999994 38.0 38.0 38.0 36.0 38.0 70-74 36.86575 38.0 38.0 38.0 36.0 38.0 75-79 36.7916 38.0 38.0 38.0 36.0 38.0 80-84 36.653200000000005 38.0 38.0 38.0 35.6 38.0 85-89 36.478750000000005 38.0 38.0 38.0 34.6 38.0 90-94 36.3005 38.0 38.0 38.0 34.4 38.0 95-99 36.2025 38.0 37.8 38.0 34.0 38.0 100-104 36.1593 38.0 37.8 38.0 34.0 38.0 105-109 36.11415000000001 38.0 37.8 38.0 33.8 38.0 110-114 35.9123 38.0 37.0 38.0 33.2 38.0 115-119 35.659749999999995 38.0 37.0 38.0 31.6 38.0 120-124 35.394600000000004 38.0 36.4 38.0 31.0 38.0 125-129 34.91865 38.0 35.8 38.0 28.6 38.0 130-134 34.5534 38.0 35.0 38.0 26.8 38.0 135-139 33.95795 38.0 33.2 38.0 23.8 38.0 140-144 33.4464 38.0 33.0 38.0 21.2 38.0 145-149 32.1845 38.0 33.0 38.0 11.6 38.0 150-151 26.310125 33.0 17.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 6.0 4 1.0 5 1.0 6 1.0 7 1.0 8 2.0 9 2.0 10 1.0 11 1.0 12 2.0 13 2.0 14 5.0 15 3.0 16 5.0 17 3.0 18 3.0 19 6.0 20 9.0 21 8.0 22 10.0 23 13.0 24 8.0 25 12.0 26 15.0 27 18.0 28 20.0 29 22.0 30 40.0 31 58.0 32 54.0 33 101.0 34 138.0 35 303.0 36 813.0 37 2302.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.14392991239049 20.40050062578223 16.946182728410513 27.50938673341677 2 26.708385481852314 26.83354192740926 30.58823529411765 15.869837296620776 3 20.826032540675847 28.360450563204004 30.738423028785984 20.075093867334168 4 22.102628285356694 35.294117647058826 23.754693366708384 18.848560700876096 5 24.30538172715895 36.34543178973717 23.2540675844806 16.09511889862328 6 20.490367775831874 37.52814610958219 23.01726294721041 18.964223167375533 7 19.475 20.4 39.7 20.424999999999997 8 22.71135567783892 25.287643821910955 27.213606803401703 24.787393696848426 9 22.742056542406804 24.993745308981737 29.597197898423815 22.66700025018764 10-14 23.1850702956922 29.58422974933707 25.93685895832291 21.29384099664782 15-19 22.94179470496972 28.276863019868877 27.8214303588409 20.959911916320504 20-24 23.289453926622954 28.845287551929527 27.083437609489962 20.781820911957556 25-29 23.8648310387985 28.270337922403005 27.10387984981227 20.760951188986233 30-34 23.04225916282796 28.299619467254157 27.924093731223714 20.734027638694172 35-39 23.57918982524661 28.29602924240148 27.324620700015025 20.80016023233689 40-44 23.90510035537314 27.84423644827068 27.45883177336203 20.791831422994143 45-49 23.882464834559745 27.912098913750818 27.646793812884816 20.558642438804625 50-54 23.93872647176612 28.71946335602723 26.707048458149778 20.634761714056868 55-59 23.3056361998198 27.960756832515766 27.755531084192615 20.97807588347182 60-64 22.970267294023426 28.05586144759235 27.935729302232453 21.03814195615177 65-69 23.659574468085108 27.44430538172716 27.944931163954944 20.95118898623279 70-74 23.750375638585595 27.636982870880495 27.386557147150153 21.226084343383754 75-79 23.220992538434572 27.95833541990085 27.868195703340177 20.952476338324402 80-84 23.731275988176943 28.10480436851861 27.27318270627724 20.890736937027203 85-89 23.832665330661325 28.266533066132265 27.009018036072145 20.89178356713427 90-94 23.855325117723673 28.55425308085362 26.760845606652637 20.829576194770063 95-99 23.674327775274147 28.76170447148365 26.81888738671073 20.74508036653147 100-104 24.11894273127753 28.479175010012014 26.69203043652383 20.70985182218662 105-109 24.02262601992291 27.721880162186512 27.4115232517395 20.843970566151075 110-114 24.21026282853567 28.41551939924906 27.078848560700873 20.295369211514394 115-119 24.491839391208572 27.721037348553118 27.590868128567138 20.196255131671172 120-124 24.49787127473078 28.089156023040317 27.277736038066617 20.135236664162285 125-129 24.76452905811623 28.181362725450903 26.64328657314629 20.41082164328657 130-134 24.780844562440514 27.771377047537943 27.18529279166458 20.26248559835696 135-139 24.61422845691383 27.61022044088176 27.46492985971944 20.31062124248497 140-144 24.708180952858072 28.099794599468964 26.982616101397728 20.209408346275236 145-149 24.83719066225829 27.60244464482517 27.1816451257389 20.37871956717764 150-151 25.98898347521282 26.664997496244368 27.44116174261392 19.90485728592889 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 3.0 25 2.5 26 3.5 27 7.0 28 10.0 29 10.0 30 10.0 31 15.0 32 27.5 33 44.0 34 56.5 35 64.5 36 74.0 37 95.5 38 134.5 39 157.5 40 178.0 41 214.5 42 254.0 43 267.0 44 264.0 45 276.5 46 273.0 47 253.0 48 223.0 49 190.0 50 169.5 51 149.0 52 123.0 53 104.0 54 94.0 55 70.5 56 43.5 57 37.0 58 29.5 59 24.5 60 18.5 61 9.5 62 6.0 63 3.5 64 1.0 65 0.0 66 0.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.125 2 0.125 3 0.125 4 0.125 5 0.125 6 0.075 7 0.0 8 0.05 9 0.075 10-14 0.065 15-19 0.095 20-24 0.105 25-29 0.125 30-34 0.13999999999999999 35-39 0.145 40-44 0.105 45-49 0.11499999999999999 50-54 0.12 55-59 0.11 60-64 0.11 65-69 0.125 70-74 0.16999999999999998 75-79 0.155 80-84 0.19499999999999998 85-89 0.2 90-94 0.19 95-99 0.145 100-104 0.12 105-109 0.11499999999999999 110-114 0.125 115-119 0.13 120-124 0.17500000000000002 125-129 0.2 130-134 0.185 135-139 0.2 140-144 0.19499999999999998 145-149 0.19 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.7 #Duplication Level Percentage of deduplicated Percentage of total 1 99.13880445795338 97.85000000000001 2 0.6838905775075987 1.35 3 0.050658561296859174 0.15 4 0.050658561296859174 0.2 5 0.050658561296859174 0.25 6 0.0 0.0 7 0.0 0.0 8 0.025329280648429587 0.2 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 8 0.2 No Hit CACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC 5 0.125 No Hit CATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.125 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.2125 0.0 0.0 0.0 0.0 80-81 0.2875 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.425 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.0375 0.0 0.0 0.0 0.0 100-101 1.1375 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.4874999999999998 0.0 0.0 0.0 0.0 108-109 1.6 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.175 0.0 0.0 0.0 0.0 114-115 2.425 0.0 0.0 0.0 0.0 116-117 2.7249999999999996 0.0 0.0 0.0 0.0 118-119 2.9875 0.0 0.0 0.0 0.0 120-121 3.125 0.0 0.0 0.0 0.0 122-123 3.2625 0.0 0.0 0.0 0.0 124-125 3.55 0.0 0.0 0.0 0.0 126-127 3.825 0.0 0.0 0.0 0.0 128-129 4.0875 0.0 0.0 0.0 0.0 130-131 4.475 0.0 0.0 0.0 0.0 132-133 4.762499999999999 0.0 0.0 0.0 0.0 134-135 4.9375 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCACAG 10 0.006830828 145.0 5 CTATGTT 10 0.006830828 145.0 7 >>END_MODULE Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649883 spots for SRR7170484.sra Written 649883 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra Read 649878 spots for SRR7170484.sra Written 649878 spots for SRR7170484.sra SRR ids: ['SRR7170484.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_y5xfwb7o SRR7170484.sra spots: 12997565 blocks: [[1, 649878], [649879, 1299756], [1299757, 1949634], [1949635, 2599512], [2599513, 3249390], [3249391, 3899268], [3899269, 4549146], [4549147, 5199024], [5199025, 5848902], [5848903, 6498780], [6498781, 7148658], [7148659, 7798536], [7798537, 8448414], [8448415, 9098292], [9098293, 9748170], [9748171, 10398048], [10398049, 11047926], [11047927, 11697804], [11697805, 12347682], [12347683, 12997565]] SRR7170484 file size 4382747 SRR7170484 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170484 SRR7170484_1.fastq SRR7170484_2.fastq Input file: SRR7170484_1.fastq Paired file: SRR7170484_2.fastq trimmed: SRR7170484-trimmed-pair1.fastq, SRR7170484-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:29:55 2025 >> started Thu Feb 13 00:35:12 2025 >> done (316.726s) 12997565 read pairs processed; of these: 18580 ( 0.14%) short read pairs filtered out after trimming by size control 25628 ( 0.20%) empty read pairs filtered out after trimming by size control 12953357 (99.66%) read pairs available; of these: 8058743 (62.21%) trimmed read pairs available after processing 4894614 (37.79%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 6 0.00% 19 1 0.00% 20 3 0.00% 21 5 0.00% 22 2 0.00% 23 1 0.00% 24 3 0.00% 25 2 0.00% 26 5 0.00% 27 11 0.00% 28 4 0.00% 29 5 0.00% 30 3 0.00% 31 6 0.00% 32 11 0.00% 33 5 0.00% 34 9 0.00% 35 14 0.00% 36 15 0.00% 37 10 0.00% 38 19 0.00% 39 16 0.00% 40 23 0.00% 41 37 0.00% 42 30 0.00% 43 28 0.00% 44 32 0.00% 45 40 0.00% 46 45 0.00% 47 64 0.00% 48 54 0.00% 49 89 0.00% 50 111 0.00% 51 88 0.00% 52 145 0.00% 53 142 0.00% 54 146 0.00% 55 142 0.00% 56 130 0.00% 57 190 0.00% 58 204 0.00% 59 245 0.00% 60 318 0.00% 61 335 0.00% 62 427 0.00% 63 507 0.00% 64 503 0.00% 65 513 0.00% 66 568 0.00% 67 587 0.00% 68 671 0.01% 69 772 0.01% 70 954 0.01% 71 960 0.01% 72 1216 0.01% 73 1354 0.01% 74 1518 0.01% 75 1672 0.01% 76 1807 0.01% 77 1886 0.01% 78 1978 0.02% 79 2287 0.02% 80 2611 0.02% 81 2919 0.02% 82 3387 0.03% 83 3969 0.03% 84 5021 0.04% 85 5320 0.04% 86 5484 0.04% 87 5555 0.04% 88 5555 0.04% 89 6079 0.05% 90 6388 0.05% 91 7033 0.05% 92 7447 0.06% 93 8216 0.06% 94 8738 0.07% 95 9253 0.07% 96 9522 0.07% 97 9885 0.08% 98 10092 0.08% 99 10496 0.08% 100 10990 0.08% 101 11614 0.09% 102 12551 0.10% 103 13024 0.10% 104 13797 0.11% 105 14325 0.11% 106 15235 0.12% 107 15594 0.12% 108 15454 0.12% 109 15954 0.12% 110 15987 0.12% 111 16714 0.13% 112 17339 0.13% 113 18251 0.14% 114 18827 0.15% 115 20095 0.16% 116 20392 0.16% 117 20852 0.16% 118 21539 0.17% 119 21727 0.17% 120 22503 0.17% 121 23127 0.18% 122 24382 0.19% 123 25537 0.20% 124 26322 0.20% 125 27923 0.22% 126 29317 0.23% 127 30601 0.24% 128 31601 0.24% 129 32670 0.25% 130 34899 0.27% 131 37253 0.29% 132 39098 0.30% 133 42494 0.33% 134 45830 0.35% 135 49095 0.38% 136 54011 0.42% 137 59366 0.46% 138 65148 0.50% 139 73058 0.56% 140 82327 0.64% 141 93377 0.72% 142 107880 0.83% 143 127050 0.98% 144 155050 1.20% 145 195770 1.51% 146 259169 2.00% 147 370272 2.86% 148 587296 4.53% 149 1149108 8.87% 150 3671004 28.34% 151 4894614 37.79% 12953357 reads passed initial QC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.75 fanout-score-rank=11 prefix-density=0.62 prefix-fanout=2.4 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.01 sequence-density-rank=24 fanout-score=78.11 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.0 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCT criterion=sequence-density sequence-density=0.45 sequence-density-rank=1 fanout-score=2.17 fanout-score-rank=24 prefix-density=0.46 prefix-fanout=2.1 sequence=TACCTTCTTCGC criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=34.61 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.0 sequence=AAACAAGAGAGGTGGAGATATAGGAGAGCATAACCATGTTAGTCCCATATATTTCCAAGATGAAGGCCTTTCTTATCGCATGCATTCTCTTAGCTACCATCGTCTTCTCTCCCCT SRR7170484 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:12:46 Started mapping on | Feb 13 01:13:47 Finished on | Feb 13 01:17:54 Mapping speed, Million of reads per hour | 188.79 Number of input reads | 12953357 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11773413 Uniquely mapped reads % | 90.89% Average mapped length | 292.93 Number of splices: Total | 11932000 Number of splices: Annotated (sjdb) | 11658219 Number of splices: GT/AG | 11719529 Number of splices: GC/AG | 168346 Number of splices: AT/AC | 7956 Number of splices: Non-canonical | 36169 Mismatch rate per base, % | 0.39% Deletion rate per base | 0.03% Deletion average length | 2.45 Insertion rate per base | 0.02% Insertion average length | 2.13 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 295032 % of reads mapped to multiple loci | 2.28% Number of reads mapped to too many loci | 45672 % of reads mapped to too many loci | 0.35% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.40% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 896139 896139 896139 N_multimapping 295032 295032 295032 N_noFeature 378993 11529251 431603 N_ambiguous 279768 803 87962 UnstrandedReadsAssigned:11114652 PositiveStrandReadsAssigned:243359 NegativeStrandReadsAssigned:11253848 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170484 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170484-trimmed-pair1.fastq SRR7170484-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,953,357 reads, 11,152,756 reads pseudoaligned [quant] estimated average fragment length: 266.629 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,205 rounds 52401 SRR7170484.ke.tsv 34699 SRR7170484.se.tsv 87100 total ==> SRR7170484.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1752.37 581 21.5695 Potri.005G024800.1.v4.1 1035 769.371 242 20.463 Potri.004G059700.1.v4.1 961 695.392 14 1.30975 Potri.007G009000.2.v4.1 1416 1150.37 0 0 Potri.003G141000.2.v4.1 2943 2677.37 715.474 17.385 Potri.016G087400.1.v4.1 270 76.4349 1217 1035.83 Potri.015G069301.1.v4.1 564 302.361 0 0 Potri.010G195200.1.v4.1 1773 1507.37 109 4.70431 Potri.012G127500.1.v4.1 977 711.392 107 9.78507 ==> SRR7170484.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 641 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 386 Potri.001G212900.v4.1 5 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 20 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 8 SRR7170484 completed mapping pipeline successfully