Starting /dee2/code/volunteer_pipeline.sh SRR7170485 current disk space = 3050487083008 free memory = 1577012516 SRR7170485 SRAfilesize 1282a754534e3f537336034b381a7ace SRR7170485.sra SRR7170485.sra file validated SRR7170485 is paired end SRR7170485 is conventional basespace SRR7170485 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170485_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 22.2745 18.0 18.0 30.0 18.0 32.0 2 30.52275 31.0 29.0 33.0 27.0 33.0 3 31.4485 33.0 31.0 33.0 28.0 33.0 4 32.3845 33.0 33.0 33.0 31.0 34.0 5 33.1465 33.0 33.0 34.0 33.0 34.0 6 37.30175 38.0 38.0 38.0 36.0 38.0 7 37.53625 38.0 38.0 38.0 37.0 38.0 8 37.5055 38.0 38.0 38.0 37.0 38.0 9 37.61025 38.0 38.0 38.0 38.0 38.0 10-14 37.655899999999995 38.0 38.0 38.0 38.0 38.0 15-19 37.65475 38.0 38.0 38.0 38.0 38.0 20-24 37.637600000000006 38.0 38.0 38.0 38.0 38.0 25-29 37.58825 38.0 38.0 38.0 38.0 38.0 30-34 37.56765 38.0 38.0 38.0 38.0 38.0 35-39 37.52595 38.0 38.0 38.0 37.8 38.0 40-44 37.50685 38.0 38.0 38.0 37.2 38.0 45-49 37.44485 38.0 38.0 38.0 37.2 38.0 50-54 37.277300000000004 38.0 38.0 38.0 36.4 38.0 55-59 37.128949999999996 38.0 38.0 38.0 36.0 38.0 60-64 37.04725 38.0 38.0 38.0 35.8 38.0 65-69 36.86495 38.0 38.0 38.0 34.8 38.0 70-74 36.857099999999996 38.0 38.0 38.0 35.0 38.0 75-79 36.71945 38.0 38.0 38.0 34.4 38.0 80-84 36.562599999999996 38.0 37.6 38.0 34.2 38.0 85-89 36.45455 38.0 37.6 38.0 34.0 38.0 90-94 36.340250000000005 38.0 37.4 38.0 33.8 38.0 95-99 36.20495000000001 38.0 37.0 38.0 33.4 38.0 100-104 35.53355 38.0 36.2 38.0 30.2 38.0 105-109 35.728249999999996 38.0 36.4 38.0 31.0 38.0 110-114 35.5106 38.0 36.0 38.0 30.2 38.0 115-119 35.1847 38.0 35.4 38.0 28.8 38.0 120-124 34.65525 38.0 34.8 38.0 26.8 38.0 125-129 34.39795 38.0 34.4 38.0 25.0 38.0 130-134 34.213699999999996 38.0 34.0 38.0 23.8 38.0 135-139 33.4723 38.0 33.2 38.0 19.8 38.0 140-144 32.677949999999996 37.4 32.2 38.0 15.8 38.0 145-149 30.898500000000002 36.0 30.4 38.0 10.8 38.0 150-151 26.421 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 0.0 12 1.0 13 0.0 14 1.0 15 2.0 16 1.0 17 1.0 18 2.0 19 6.0 20 0.0 21 4.0 22 6.0 23 10.0 24 11.0 25 18.0 26 13.0 27 11.0 28 29.0 29 38.0 30 40.0 31 77.0 32 100.0 33 149.0 34 246.0 35 557.0 36 1315.0 37 1361.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 44.87715629900679 11.238891792995295 9.435441714584423 34.44851019341348 2 21.975 15.024999999999999 33.35 29.65 3 18.65 22.05 28.4 30.9 4 21.7 29.7 23.575 25.025 5 23.425 32.275 25.05 19.25 6 18.425 35.625 24.625 21.325 7 14.424999999999999 25.724999999999998 43.45 16.400000000000002 8 17.424999999999997 24.575 32.175 25.825 9 16.2 25.025 34.475 24.3 10-14 20.24 30.435000000000002 26.784999999999997 22.54 15-19 20.02 28.875 28.165000000000003 22.939999999999998 20-24 20.07 28.845 27.800000000000004 23.285 25-29 20.145 29.134999999999998 27.495000000000005 23.225 30-34 19.5 28.79 28.225 23.485 35-39 19.68 28.585 28.199999999999996 23.535 40-44 20.05 28.98 27.505000000000003 23.465 45-49 20.674999999999997 28.925 27.779999999999998 22.62 50-54 19.505 28.33 27.894999999999996 24.27 55-59 20.200000000000003 28.51 28.225 23.064999999999998 60-64 20.150000000000002 28.310000000000002 28.27 23.27 65-69 19.955000000000002 28.24 28.705000000000002 23.1 70-74 20.04 28.68 28.035 23.244999999999997 75-79 20.502050205020502 28.467846784678468 28.027802780278027 23.002300230023 80-84 20.254050810162035 28.120624124824968 27.900580116023203 23.724744948989798 85-89 20.275000000000002 29.235 27.584999999999997 22.905 90-94 20.165 28.384999999999998 27.605 23.845 95-99 20.34 28.78 27.32 23.56 100-104 20.655 28.904999999999998 27.229999999999997 23.21 105-109 20.455000000000002 28.15 28.01 23.385 110-114 20.845 28.595 26.790000000000003 23.77 115-119 20.0 28.715000000000003 27.715 23.57 120-124 20.05 28.749999999999996 27.685 23.515 125-129 20.615 28.475 27.49 23.419999999999998 130-134 20.495 28.02 27.775 23.71 135-139 21.055 28.235 27.36 23.35 140-144 21.05 27.944999999999997 27.58 23.425 145-149 20.580000000000002 28.04 27.415 23.965 150-151 19.6 29.2875 27.0 24.1125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 1.0 16 0.5 17 1.0 18 1.0 19 0.0 20 1.0 21 1.0 22 1.0 23 2.5 24 2.5 25 5.5 26 7.5 27 6.0 28 8.5 29 15.5 30 24.0 31 30.5 32 33.0 33 43.5 34 66.5 35 83.0 36 101.0 37 115.5 38 139.0 39 166.5 40 196.5 41 240.0 42 246.0 43 244.5 44 265.0 45 268.5 46 250.5 47 234.0 48 226.5 49 206.5 50 172.5 51 137.0 52 112.0 53 91.5 54 63.0 55 44.5 56 41.0 57 31.0 58 19.5 59 18.0 60 14.0 61 7.0 62 1.5 63 1.5 64 2.5 65 2.0 66 2.5 67 1.5 68 1.0 69 1.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.35 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.01 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62311557788944 99.125 2 0.32663316582914576 0.65 3 0.02512562814070352 0.075 4 0.0 0.0 5 0.0 0.0 6 0.02512562814070352 0.15 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source GTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACC 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.925 0.0 0.0 0.0 0.0 90-91 1.0499999999999998 0.0 0.0 0.0 0.0 92-93 1.0875 0.0 0.0 0.0 0.0 94-95 1.225 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.7 0.0 0.0 0.0 0.0 100-101 1.7875 0.0 0.0 0.0 0.0 102-103 1.9375 0.0 0.0 0.0 0.0 104-105 2.2249999999999996 0.0 0.0 0.0 0.0 106-107 2.4124999999999996 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.875 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.3 0.0 0.0 0.0 0.0 118-119 3.55 0.0 0.0 0.0 0.0 120-121 3.8 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.387499999999999 0.0 0.0 0.0 0.0 126-127 4.575 0.0 0.0 0.0 0.0 128-129 4.775 0.0 0.0 0.0 0.0 130-131 4.9 0.0 0.0 0.0 0.0 132-133 5.125 0.0 0.0 0.0 0.0 134-135 5.574999999999999 0.0 0.0 0.0 0.0 136-137 6.0375 0.0 0.0 0.0 0.0 138-139 6.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCTCTT 10 0.0068396386 144.9375 7 >>END_MODULE SRR7170485 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170485_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0115 33.0 33.0 34.0 32.0 34.0 2 33.13075 34.0 33.0 34.0 33.0 34.0 3 33.1775 34.0 33.0 34.0 33.0 34.0 4 33.1235 34.0 33.0 34.0 33.0 34.0 5 33.0495 34.0 33.0 34.0 33.0 34.0 6 37.26225 38.0 38.0 38.0 37.0 38.0 7 37.32875 38.0 38.0 38.0 37.0 38.0 8 37.229 38.0 38.0 38.0 37.0 38.0 9 37.384 38.0 38.0 38.0 38.0 38.0 10-14 37.32575 38.0 38.0 38.0 37.6 38.0 15-19 37.24645 38.0 38.0 38.0 37.2 38.0 20-24 37.27685 38.0 38.0 38.0 37.4 38.0 25-29 37.24855 38.0 38.0 38.0 37.4 38.0 30-34 37.2081 38.0 38.0 38.0 37.0 38.0 35-39 37.2005 38.0 38.0 38.0 37.0 38.0 40-44 37.1943 38.0 38.0 38.0 37.0 38.0 45-49 37.163799999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.0561 38.0 38.0 38.0 37.0 38.0 55-59 37.03995 38.0 38.0 38.0 36.8 38.0 60-64 37.018550000000005 38.0 38.0 38.0 36.4 38.0 65-69 36.93615 38.0 38.0 38.0 36.2 38.0 70-74 36.89 38.0 38.0 38.0 36.0 38.0 75-79 36.81355 38.0 38.0 38.0 36.0 38.0 80-84 36.72935 38.0 38.0 38.0 35.6 38.0 85-89 36.50635 38.0 38.0 38.0 34.8 38.0 90-94 36.4159 38.0 38.0 38.0 34.2 38.0 95-99 36.31595 38.0 38.0 38.0 34.0 38.0 100-104 36.21155 38.0 38.0 38.0 34.0 38.0 105-109 36.05555 38.0 37.8 38.0 33.4 38.0 110-114 35.87285000000001 38.0 37.0 38.0 33.0 38.0 115-119 35.71405 38.0 37.0 38.0 32.2 38.0 120-124 35.357150000000004 38.0 36.4 38.0 31.0 38.0 125-129 34.98315 38.0 36.0 38.0 28.8 38.0 130-134 34.6712 38.0 35.4 38.0 27.4 38.0 135-139 34.00815 38.0 33.4 38.0 24.0 38.0 140-144 33.321749999999994 38.0 33.0 38.0 20.4 38.0 145-149 32.233700000000006 38.0 33.0 38.0 11.8 38.0 150-151 26.266875 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 10.0 3 3.0 4 2.0 5 1.0 6 0.0 7 1.0 8 2.0 9 1.0 10 3.0 11 3.0 12 2.0 13 3.0 14 0.0 15 2.0 16 2.0 17 7.0 18 6.0 19 6.0 20 10.0 21 2.0 22 6.0 23 13.0 24 10.0 25 14.0 26 14.0 27 17.0 28 24.0 29 26.0 30 34.0 31 50.0 32 52.0 33 99.0 34 170.0 35 282.0 36 857.0 37 2266.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 41.381035776832626 21.491118338754063 12.934701025769327 24.193144858643983 2 26.144608456342254 26.344758568926697 31.423567675756818 16.08706529897423 3 19.36452339254441 27.920940705529144 32.99974981235927 19.714786089567177 4 23.367525644233176 34.701025769326996 23.667750813109834 18.263697773329998 5 23.417563172379285 36.602451838879155 22.692019014260694 17.28796597448086 6 19.28464232116058 37.543771885942974 24.662331165582792 18.509254627313656 7 18.384192096048025 19.909954977488745 41.09554777388694 20.610305152576288 8 19.759879939969984 25.662831415707853 29.089544772386194 25.48774387193597 9 21.48574287143572 24.68734367183592 29.33966983491746 24.487243621810904 10-14 22.621310655327665 29.364682341170585 27.123561780890444 20.890445222611305 15-19 22.42121060530265 28.59929964982491 27.85392696348174 21.125562781390695 20-24 22.487368052428835 28.60073040172095 28.13547451098104 20.776427034869176 25-29 22.76365819491695 28.612167300380225 28.01180708425055 20.612367420452273 30-34 21.475032522765936 28.339837886520563 28.78014610227159 21.404983488441907 35-39 22.250575402781948 28.164715300710498 28.204743320324226 21.37996597618333 40-44 22.821410705352676 28.319159579789893 28.07403701850926 20.785392696348172 45-49 22.40120060030015 27.883941970985493 28.609304652326163 21.105552776388194 50-54 22.34617308654327 28.704352176088044 28.08904452226113 20.860430215107552 55-59 22.61630815407704 27.733866933466732 29.014507253626814 20.635317658829415 60-64 22.276138069034516 28.30915457728864 28.7943971985993 20.62031015507754 65-69 22.90259642803542 28.215518535194356 27.835309420181098 21.046575616589124 70-74 22.530771540078053 28.059641749224458 28.164715300710498 21.24487140998699 75-79 22.827120340255192 28.081060795596695 27.820865649236925 21.270953214911184 80-84 23.067300475356518 28.426319739804857 27.535651738804102 20.970728046034527 85-89 23.642732049036777 28.00100075056292 27.450587940955717 20.905679259444586 90-94 23.34250688016012 27.37553164873655 28.906680010007506 20.37528146109582 95-99 22.969930454795616 28.248361434932708 27.873117526392154 20.908590583879523 100-104 24.061843290303212 28.27979585709997 27.454217952566793 20.20414290003002 105-109 23.62417450470282 27.911747048228936 27.91675005003002 20.54732839703822 110-114 23.53529794366338 28.083254115174867 28.078250863060987 20.303197078100766 115-119 23.989393636181706 28.372023213928355 27.436461877126277 20.20212127276366 120-124 23.65774330748061 28.256192144108084 27.8558919189392 20.230172629472104 125-129 24.058043532649485 28.29121841381036 27.31548661496122 20.335251438578933 130-134 24.238178633975483 27.610708031023268 27.950963222416814 20.20015011258444 135-139 24.513385038779084 27.98598949211909 27.450587940955717 20.05003752814611 140-144 24.27820865649237 28.446334751063297 27.435576682511886 19.83987990993245 145-149 24.718538904178132 28.276207155366524 27.25544158118589 19.749812359269452 150-151 24.690431519699814 28.13008130081301 28.055034396497813 19.12445278298937 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 1.0 14 1.0 15 1.0 16 1.0 17 0.5 18 1.5 19 2.0 20 1.0 21 0.0 22 1.0 23 3.5 24 4.5 25 4.5 26 8.5 27 10.5 28 9.5 29 12.5 30 18.0 31 22.0 32 27.5 33 40.5 34 60.5 35 72.5 36 87.0 37 121.5 38 161.5 39 181.0 40 196.5 41 224.0 42 259.5 43 284.5 44 286.5 45 287.0 46 259.5 47 225.5 48 210.5 49 190.0 50 150.0 51 122.0 52 104.5 53 77.0 54 64.0 55 50.0 56 40.5 57 32.0 58 21.5 59 18.5 60 11.5 61 7.5 62 5.5 63 2.5 64 3.5 65 3.5 66 1.5 67 1.0 68 0.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.5 74 0.5 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.075 2 0.075 3 0.075 4 0.075 5 0.075 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.05 15-19 0.05 20-24 0.055 25-29 0.06 30-34 0.06999999999999999 35-39 0.06999999999999999 40-44 0.05 45-49 0.05 50-54 0.05 55-59 0.05 60-64 0.05 65-69 0.055 70-74 0.06999999999999999 75-79 0.075 80-84 0.075 85-89 0.075 90-94 0.075 95-99 0.065 100-104 0.06999999999999999 105-109 0.06 110-114 0.065 115-119 0.06 120-124 0.075 125-129 0.075 130-134 0.075 135-139 0.075 140-144 0.075 145-149 0.075 150-151 0.0625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2671215567349 98.2 2 0.6065200909780136 1.2 3 0.025271670457417232 0.075 4 0.050543340914834464 0.2 5 0.0 0.0 6 0.025271670457417232 0.15 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit AACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAA 6 0.15 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0125 0.0 0.0 0.0 0.0 44-45 0.025 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.037500000000000006 0.0 0.0 0.0 0.0 56-57 0.05 0.0 0.0 0.0 0.0 58-59 0.05 0.0 0.0 0.0 0.0 60-61 0.05 0.0 0.0 0.0 0.0 62-63 0.07500000000000001 0.0 0.0 0.0 0.0 64-65 0.1 0.0 0.0 0.0 0.0 66-67 0.1125 0.0 0.0 0.0 0.0 68-69 0.16249999999999998 0.0 0.0 0.0 0.0 70-71 0.2 0.0 0.0 0.0 0.0 72-73 0.2 0.0 0.0 0.0 0.0 74-75 0.2 0.0 0.0 0.0 0.0 76-77 0.2625 0.0 0.0 0.0 0.0 78-79 0.3625 0.0 0.0 0.0 0.0 80-81 0.475 0.0 0.0 0.0 0.0 82-83 0.5875 0.0 0.0 0.0 0.0 84-85 0.7 0.0 0.0 0.0 0.0 86-87 0.8374999999999999 0.0 0.0 0.0 0.0 88-89 0.95 0.0 0.0 0.0 0.0 90-91 1.0750000000000002 0.0 0.0 0.0 0.0 92-93 1.1125 0.0 0.0 0.0 0.0 94-95 1.25 0.0 0.0 0.0 0.0 96-97 1.5375 0.0 0.0 0.0 0.0 98-99 1.7 0.0 0.0 0.0 0.0 100-101 1.7999999999999998 0.0 0.0 0.0 0.0 102-103 1.9625 0.0 0.0 0.0 0.0 104-105 2.2375 0.0 0.0 0.0 0.0 106-107 2.4124999999999996 0.0 0.0 0.0 0.0 108-109 2.5 0.0 0.0 0.0 0.0 110-111 2.6875 0.0 0.0 0.0 0.0 112-113 2.9375 0.0 0.0 0.0 0.0 114-115 3.1625 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.675 0.0 0.0 0.0 0.0 120-121 3.925 0.0 0.0 0.0 0.0 122-123 4.225 0.0 0.0 0.0 0.0 124-125 4.5625 0.0 0.0 0.0 0.0 126-127 4.762499999999999 0.0 0.0 0.0 0.0 128-129 4.9375 0.0 0.0 0.0 0.0 130-131 5.0625 0.0 0.0 0.0 0.0 132-133 5.300000000000001 0.0 0.0 0.0 0.0 134-135 5.75 0.0 0.0 0.0 0.0 136-137 6.199999999999999 0.0 0.0 0.0 0.0 138-139 6.575 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665514 spots for SRR7170485.sra Written 665514 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra Read 665495 spots for SRR7170485.sra Written 665495 spots for SRR7170485.sra SRR ids: ['SRR7170485.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_bf67fxz5 SRR7170485.sra spots: 13309919 blocks: [[1, 665495], [665496, 1330990], [1330991, 1996485], [1996486, 2661980], [2661981, 3327475], [3327476, 3992970], [3992971, 4658465], [4658466, 5323960], [5323961, 5989455], [5989456, 6654950], [6654951, 7320445], [7320446, 7985940], [7985941, 8651435], [8651436, 9316930], [9316931, 9982425], [9982426, 10647920], [10647921, 11313415], [11313416, 11978910], [11978911, 12644405], [12644406, 13309919]] SRR7170485 file size 4488594 SRR7170485 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170485 SRR7170485_1.fastq SRR7170485_2.fastq Input file: SRR7170485_1.fastq Paired file: SRR7170485_2.fastq trimmed: SRR7170485-trimmed-pair1.fastq, SRR7170485-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:38:40 2025 >> started Thu Feb 13 00:44:11 2025 >> done (331.305s) 13309919 read pairs processed; of these: 17922 ( 0.13%) short read pairs filtered out after trimming by size control 23543 ( 0.18%) empty read pairs filtered out after trimming by size control 13268454 (99.69%) read pairs available; of these: 8542096 (64.38%) trimmed read pairs available after processing 4726358 (35.62%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 6 0.00% 20 4 0.00% 21 3 0.00% 22 3 0.00% 23 4 0.00% 24 7 0.00% 25 4 0.00% 26 10 0.00% 27 9 0.00% 28 4 0.00% 29 10 0.00% 30 4 0.00% 31 7 0.00% 32 12 0.00% 33 14 0.00% 34 24 0.00% 35 14 0.00% 36 18 0.00% 37 25 0.00% 38 27 0.00% 39 43 0.00% 40 42 0.00% 41 48 0.00% 42 61 0.00% 43 75 0.00% 44 63 0.00% 45 90 0.00% 46 107 0.00% 47 110 0.00% 48 128 0.00% 49 167 0.00% 50 215 0.00% 51 256 0.00% 52 246 0.00% 53 280 0.00% 54 279 0.00% 55 339 0.00% 56 368 0.00% 57 380 0.00% 58 535 0.00% 59 572 0.00% 60 682 0.01% 61 722 0.01% 62 845 0.01% 63 891 0.01% 64 1036 0.01% 65 1007 0.01% 66 1143 0.01% 67 1389 0.01% 68 1427 0.01% 69 1710 0.01% 70 1947 0.01% 71 2157 0.02% 72 2384 0.02% 73 2777 0.02% 74 2946 0.02% 75 3198 0.02% 76 3475 0.03% 77 3745 0.03% 78 4131 0.03% 79 4512 0.03% 80 4866 0.04% 81 5509 0.04% 82 6310 0.05% 83 7023 0.05% 84 7917 0.06% 85 8538 0.06% 86 8703 0.07% 87 8988 0.07% 88 9213 0.07% 89 9623 0.07% 90 10286 0.08% 91 10736 0.08% 92 11474 0.09% 93 12145 0.09% 94 12841 0.10% 95 13771 0.10% 96 13704 0.10% 97 14298 0.11% 98 14206 0.11% 99 14421 0.11% 100 15326 0.12% 101 15357 0.12% 102 16505 0.12% 103 16966 0.13% 104 17883 0.13% 105 18084 0.14% 106 18802 0.14% 107 18811 0.14% 108 18868 0.14% 109 19406 0.15% 110 19649 0.15% 111 20204 0.15% 112 20747 0.16% 113 21275 0.16% 114 21834 0.16% 115 22669 0.17% 116 23108 0.17% 117 23722 0.18% 118 24349 0.18% 119 24436 0.18% 120 25412 0.19% 121 26312 0.20% 122 26948 0.20% 123 27933 0.21% 124 29219 0.22% 125 30256 0.23% 126 31930 0.24% 127 32863 0.25% 128 34417 0.26% 129 35833 0.27% 130 37903 0.29% 131 39879 0.30% 132 42469 0.32% 133 46012 0.35% 134 49136 0.37% 135 52660 0.40% 136 58687 0.44% 137 63378 0.48% 138 70536 0.53% 139 78779 0.59% 140 88771 0.67% 141 102307 0.77% 142 118961 0.90% 143 140964 1.06% 144 171096 1.29% 145 217236 1.64% 146 286087 2.16% 147 405935 3.06% 148 631139 4.76% 149 1207196 9.10% 150 3682528 27.75% 151 4726358 35.62% 13268454 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=23 prefix-density=0.43 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=27 fanout-score=28.33 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=6.8 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTGT criterion=sequence-density sequence-density=0.61 sequence-density-rank=1 fanout-score=2.21 fanout-score-rank=19 prefix-density=0.62 prefix-fanout=2.1 sequence=GCTCGAGAATTGG criterion=fanout-score sequence-density=0.11 sequence-density-rank=24 fanout-score=27.64 fanout-score-rank=1 prefix-density=0.39 prefix-fanout=7.5 sequence=GCAATGGCAGCCTCAGTTATGGCTTCATTGAACCTGAAACCATCTCCATTCACGGTTGAGAAGTCTTCAGTGAGAGGCCTCCCAACTCTTTCAAGGAGATCTTTCAAGATTGAAGCCAGTGGTGTCAAGAAGATCAAGACCGATACGCCTTATGGAACTGGTGGTGGCATGAACCTCAGGGATGGGTTAGATGC SRR7170485 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:01:49 Started mapping on | Feb 13 01:02:07 Finished on | Feb 13 01:12:47 Mapping speed, Million of reads per hour | 74.64 Number of input reads | 13268454 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 12272450 Uniquely mapped reads % | 92.49% Average mapped length | 290.91 Number of splices: Total | 11910392 Number of splices: Annotated (sjdb) | 11601426 Number of splices: GT/AG | 11685780 Number of splices: GC/AG | 174426 Number of splices: AT/AC | 7251 Number of splices: Non-canonical | 42935 Mismatch rate per base, % | 0.41% Deletion rate per base | 0.03% Deletion average length | 2.72 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 388018 % of reads mapped to multiple loci | 2.92% Number of reads mapped to too many loci | 27210 % of reads mapped to too many loci | 0.21% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.32% % of reads unmapped: other | 0.06% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 620092 620092 620092 N_multimapping 388018 388018 388018 N_noFeature 481277 12028870 567757 N_ambiguous 283826 969 126237 UnstrandedReadsAssigned:11507347 PositiveStrandReadsAssigned:242611 NegativeStrandReadsAssigned:11578456 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170485 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170485-trimmed-pair1.fastq SRR7170485-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,268,454 reads, 11,503,764 reads pseudoaligned [quant] estimated average fragment length: 270.761 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,004 rounds 52401 SRR7170485.ke.tsv 34699 SRR7170485.se.tsv 87100 total ==> SRR7170485.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1748.24 966 43.3186 Potri.005G024800.1.v4.1 1035 765.239 129 13.2157 Potri.004G059700.1.v4.1 961 691.258 5 0.567059 Potri.007G009000.2.v4.1 1416 1146.24 0 0 Potri.003G141000.2.v4.1 2943 2673.24 536 15.719 Potri.016G087400.1.v4.1 270 82.1634 594 566.769 Potri.015G069301.1.v4.1 564 300.436 0 0 Potri.010G195200.1.v4.1 1773 1503.24 110 5.73671 Potri.012G127500.1.v4.1 977 707.245 113 12.5258 ==> SRR7170485.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 526 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 259 Potri.001G212900.v4.1 49 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 42 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 2 SRR7170485 completed mapping pipeline successfully