Starting /dee2/code/volunteer_pipeline.sh SRR7170486 current disk space = 3050691719168 free memory = 1571661136 SRR7170486 SRAfilesize 7eaf05ddd4538568ec2390a053fb5949 SRR7170486.sra SRR7170486.sra file validated SRR7170486 is paired end SRR7170486 is conventional basespace SRR7170486 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170486_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.16875 25.0 18.0 33.0 18.0 33.0 2 24.99425 25.0 18.0 30.0 18.0 33.0 3 28.59725 29.0 27.0 31.0 25.0 33.0 4 31.398 33.0 31.0 33.0 29.0 33.0 5 32.48775 33.0 33.0 33.0 32.0 33.0 6 36.0825 38.0 36.0 38.0 33.0 38.0 7 36.56875 38.0 37.0 38.0 34.0 38.0 8 37.002 38.0 38.0 38.0 35.0 38.0 9 37.3115 38.0 38.0 38.0 36.0 38.0 10-14 37.38155 38.0 38.0 38.0 36.4 38.0 15-19 37.49444999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.1639 38.0 38.0 38.0 36.0 38.0 25-29 36.407650000000004 38.0 37.4 38.0 31.4 38.0 30-34 37.33855 38.0 38.0 38.0 36.6 38.0 35-39 37.43155 38.0 38.0 38.0 37.0 38.0 40-44 36.83990000000001 38.0 37.8 38.0 34.8 38.0 45-49 34.81215 37.8 33.8 38.0 25.0 38.0 50-54 37.0326 38.0 37.8 38.0 35.4 38.0 55-59 37.1605 38.0 38.0 38.0 36.0 38.0 60-64 37.03245 38.0 38.0 38.0 35.8 38.0 65-69 36.9502 38.0 38.0 38.0 35.6 38.0 70-74 36.876400000000004 38.0 38.0 38.0 35.2 38.0 75-79 36.82915 38.0 38.0 38.0 35.0 38.0 80-84 36.73955 38.0 38.0 38.0 34.6 38.0 85-89 36.419650000000004 38.0 37.6 38.0 33.8 38.0 90-94 36.2449 38.0 37.0 38.0 33.6 38.0 95-99 36.349999999999994 38.0 37.0 38.0 34.0 38.0 100-104 36.2958 38.0 37.0 38.0 33.6 38.0 105-109 36.14469999999999 38.0 37.0 38.0 33.4 38.0 110-114 35.622699999999995 38.0 36.2 38.0 30.8 38.0 115-119 35.2533 38.0 35.4 38.0 29.2 38.0 120-124 35.019400000000005 38.0 35.0 38.0 28.0 38.0 125-129 34.94565 38.0 34.8 38.0 28.0 38.0 130-134 34.5383 38.0 34.6 38.0 27.0 38.0 135-139 33.7014 38.0 33.2 38.0 22.6 38.0 140-144 28.81855 33.4 23.2 37.0 11.6 38.0 145-149 25.5675 31.8 13.0 37.6 2.0 38.0 150-151 16.3335 11.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 10 1.0 11 0.0 12 1.0 13 1.0 14 1.0 15 0.0 16 0.0 17 0.0 18 2.0 19 2.0 20 2.0 21 3.0 22 7.0 23 7.0 24 13.0 25 12.0 26 20.0 27 36.0 28 36.0 29 52.0 30 55.0 31 105.0 32 152.0 33 224.0 34 431.0 35 853.0 36 1465.0 37 519.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.777721390510024 11.316924638416644 8.98249175336209 43.92286221771124 2 20.42042042042042 15.79079079079079 31.88188188188188 31.906906906906908 3 19.7 20.925 26.25 33.125 4 23.724999999999998 28.225 22.35 25.7 5 22.525000000000002 32.6 24.025 20.849999999999998 6 18.8 34.949999999999996 24.349999999999998 21.9 7 13.675 25.1 43.25 17.974999999999998 8 17.599999999999998 24.375 31.275 26.75 9 17.75 24.975 32.574999999999996 24.7 10-14 19.36 30.159999999999997 27.315 23.165 15-19 20.28 28.904999999999998 28.15 22.665 20-24 19.735 28.735 27.96 23.57 25-29 19.5 29.415000000000003 27.150000000000002 23.935000000000002 30-34 19.845 28.415000000000003 28.389999999999997 23.35 35-39 19.435 29.285 27.889999999999997 23.39 40-44 20.11 29.205 27.665 23.02 45-49 19.755 28.71 27.67 23.865 50-54 20.52 28.595 27.415 23.47 55-59 19.835 28.285 27.435 24.445 60-64 20.53 29.049999999999997 27.485 22.935 65-69 20.155 28.939999999999998 27.800000000000004 23.105 70-74 20.27702770277028 29.262926292629267 27.38773877387739 23.072307230723073 75-79 20.21 28.37 28.005000000000003 23.415 80-84 19.735 28.575 27.815 23.875 85-89 20.1 27.965 28.544999999999998 23.39 90-94 20.462046204620464 28.317831783178317 27.752775277527753 23.467346734673466 95-99 19.490974548727436 28.891444572228615 28.121406070303518 23.496174808740435 100-104 20.325 28.375 27.815 23.485 105-109 20.200000000000003 28.560000000000002 27.87 23.369999999999997 110-114 20.445 28.42 27.544999999999998 23.59 115-119 20.544999999999998 28.51 27.61 23.335 120-124 20.535 28.28 27.255000000000003 23.93 125-129 20.665 28.595 26.515 24.224999999999998 130-134 20.43 28.84 26.900000000000002 23.830000000000002 135-139 20.724999999999998 27.779999999999998 27.315 24.18 140-144 20.105 28.165000000000003 27.395000000000003 24.335 145-149 20.294999999999998 28.749999999999996 27.445000000000004 23.51 150-151 20.4625 27.762500000000003 28.275 23.5 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 1.5 24 1.5 25 2.5 26 3.5 27 5.0 28 5.5 29 13.0 30 20.5 31 25.0 32 37.0 33 47.0 34 70.0 35 88.5 36 108.0 37 121.5 38 124.0 39 159.0 40 189.5 41 219.0 42 241.0 43 243.0 44 267.5 45 280.0 46 267.5 47 252.5 48 230.5 49 203.0 50 168.0 51 125.0 52 103.5 53 90.5 54 73.0 55 56.5 56 41.0 57 35.5 58 24.0 59 14.5 60 11.5 61 9.0 62 5.0 63 3.0 64 2.5 65 1.5 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.5 76 0.5 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.4749999999999999 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.01 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.375 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52201257861634 98.9 2 0.37735849056603776 0.75 3 0.05031446540880503 0.15 4 0.05031446540880503 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.0625 0.0 0.0 0.0 0.0 68-69 0.075 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.16249999999999998 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.1875 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.42500000000000004 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.5625 0.0 0.0 0.0 0.0 92-93 0.6875 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8999999999999999 0.0 0.0 0.0 0.0 98-99 1.025 0.0 0.0 0.0 0.0 100-101 1.1375000000000002 0.0 0.0 0.0 0.0 102-103 1.25 0.0 0.0 0.0 0.0 104-105 1.4625 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 1.9874999999999998 0.0 0.0 0.0 0.0 112-113 2.1375 0.0 0.0 0.0 0.0 114-115 2.35 0.0 0.0 0.0 0.0 116-117 2.5250000000000004 0.0 0.0 0.0 0.0 118-119 2.7125 0.0 0.0 0.0 0.0 120-121 2.875 0.0 0.0 0.0 0.0 122-123 3.05 0.0 0.0 0.0 0.0 124-125 3.2375 0.0 0.0 0.0 0.0 126-127 3.4875 0.0 0.0 0.0 0.0 128-129 3.925 0.0 0.0 0.0 0.0 130-131 4.075 0.0 0.0 0.0 0.0 132-133 4.225 0.0 0.0 0.0 0.0 134-135 4.375 0.0 0.0 0.0 0.0 136-137 4.525 0.0 0.0 0.0 0.0 138-139 4.725 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170486 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170486_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.05525 33.0 33.0 34.0 32.0 34.0 2 33.1045 34.0 33.0 34.0 33.0 34.0 3 33.127 34.0 33.0 34.0 33.0 34.0 4 33.03525 34.0 33.0 34.0 33.0 34.0 5 33.07325 34.0 33.0 34.0 33.0 34.0 6 37.2385 38.0 38.0 38.0 37.0 38.0 7 37.3755 38.0 38.0 38.0 37.0 38.0 8 37.371 38.0 38.0 38.0 37.0 38.0 9 37.369 38.0 38.0 38.0 38.0 38.0 10-14 36.646100000000004 38.0 37.2 38.0 33.0 38.0 15-19 36.92675 38.0 37.8 38.0 35.4 38.0 20-24 36.94285000000001 38.0 38.0 38.0 36.2 38.0 25-29 37.04495 38.0 38.0 38.0 36.6 38.0 30-34 37.18435 38.0 38.0 38.0 37.0 38.0 35-39 37.1903 38.0 38.0 38.0 37.0 38.0 40-44 37.19405 38.0 38.0 38.0 37.0 38.0 45-49 36.0068 38.0 36.0 38.0 31.2 38.0 50-54 36.2823 38.0 37.4 38.0 32.2 38.0 55-59 37.12835 38.0 38.0 38.0 36.6 38.0 60-64 36.9987 38.0 38.0 38.0 36.0 38.0 65-69 36.926249999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.84955 38.0 38.0 38.0 35.8 38.0 75-79 36.85985000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.761700000000005 38.0 38.0 38.0 35.4 38.0 85-89 36.7357 38.0 38.0 38.0 35.2 38.0 90-94 36.66425 38.0 38.0 38.0 34.8 38.0 95-99 36.4624 38.0 38.0 38.0 34.2 38.0 100-104 36.2496 38.0 37.8 38.0 33.8 38.0 105-109 36.123400000000004 38.0 37.4 38.0 33.6 38.0 110-114 36.15775 38.0 37.8 38.0 33.8 38.0 115-119 35.840199999999996 38.0 37.0 38.0 32.2 38.0 120-124 35.4697 38.0 36.6 38.0 30.2 38.0 125-129 34.89895 38.0 36.0 38.0 28.0 38.0 130-134 34.815149999999996 38.0 35.2 38.0 28.2 38.0 135-139 34.1349 38.0 33.4 38.0 24.4 38.0 140-144 33.54355 38.0 33.0 38.0 21.8 38.0 145-149 32.62779999999999 38.0 33.0 38.0 14.6 38.0 150-151 26.659625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 0.0 4 0.0 5 0.0 6 1.0 7 1.0 8 1.0 9 2.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 6.0 16 4.0 17 1.0 18 4.0 19 8.0 20 5.0 21 6.0 22 4.0 23 8.0 24 14.0 25 12.0 26 13.0 27 18.0 28 32.0 29 33.0 30 49.0 31 56.0 32 84.0 33 123.0 34 167.0 35 345.0 36 833.0 37 2159.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.625 21.575 14.149999999999999 27.650000000000002 2 25.4 25.900000000000002 31.5 17.2 3 20.575 28.425 31.45 19.55 4 23.3 34.9 22.6 19.2 5 23.375 36.55 22.6 17.474999999999998 6 20.325 37.55 23.1 19.025 7 18.85 21.125 39.300000000000004 20.724999999999998 8 21.7 25.650000000000002 27.800000000000004 24.85 9 22.15 25.474999999999998 28.825 23.549999999999997 10-14 22.795 28.99 26.77 21.445 15-19 22.759999999999998 28.035 27.735 21.47 20-24 23.24 28.235 27.415 21.11 25-29 23.165 28.04 27.389999999999997 21.404999999999998 30-34 22.605 28.09 27.944999999999997 21.36 35-39 22.66 28.055000000000003 28.249999999999996 21.035 40-44 22.875 27.975 27.71 21.44 45-49 23.150000000000002 28.845 26.605 21.4 50-54 23.27 27.73 27.439999999999998 21.560000000000002 55-59 22.955000000000002 27.889999999999997 27.845 21.310000000000002 60-64 23.150000000000002 27.334999999999997 28.189999999999998 21.325 65-69 23.25 27.595 28.425 20.73 70-74 23.544999999999998 27.544999999999998 27.32 21.59 75-79 23.69 27.750000000000004 27.76 20.8 80-84 22.720000000000002 28.285 27.474999999999998 21.52 85-89 23.91 27.76 27.315 21.015 90-94 23.32 28.375 26.950000000000003 21.355 95-99 23.669999999999998 27.845 27.474999999999998 21.01 100-104 23.105 28.410000000000004 27.83 20.655 105-109 24.135 28.110000000000003 27.29 20.465 110-114 24.54 28.025 28.055000000000003 19.38 115-119 24.135 28.294999999999998 27.589999999999996 19.98 120-124 24.255 27.894999999999996 27.485 20.365 125-129 24.635 28.01 27.169999999999998 20.185 130-134 24.355 28.144999999999996 27.36 20.14 135-139 24.39 27.529999999999998 27.985 20.095 140-144 23.785 27.96 27.700000000000003 20.555 145-149 24.82 28.134999999999998 27.195000000000004 19.85 150-151 24.337500000000002 28.3375 26.900000000000002 20.424999999999997 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.0 24 2.0 25 4.0 26 5.0 27 4.5 28 6.0 29 8.5 30 9.5 31 12.5 32 20.0 33 38.5 34 54.0 35 67.5 36 86.0 37 106.5 38 128.5 39 158.0 40 188.0 41 211.0 42 237.5 43 259.0 44 277.5 45 277.0 46 264.0 47 252.0 48 241.0 49 208.0 50 178.5 51 156.5 52 126.0 53 106.5 54 80.0 55 61.0 56 47.0 57 37.5 58 26.5 59 18.0 60 13.5 61 7.0 62 6.5 63 4.0 64 1.5 65 1.5 66 1.0 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.42007060010086 98.575 2 0.4034291477559254 0.8 3 0.10085728693898136 0.3 4 0.05042864346949068 0.2 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.1375 0.0 0.0 0.0 0.0 76-77 0.15 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.2375 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.3375 0.0 0.0 0.0 0.0 86-87 0.4 0.0 0.0 0.0 0.0 88-89 0.4375 0.0 0.0 0.0 0.0 90-91 0.5375 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.725 0.0 0.0 0.0 0.0 96-97 0.8375 0.0 0.0 0.0 0.0 98-99 0.95 0.0 0.0 0.0 0.0 100-101 1.0625 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.4 0.0 0.0 0.0 0.0 106-107 1.6 0.0 0.0 0.0 0.0 108-109 1.8624999999999998 0.0 0.0 0.0 0.0 110-111 2.0 0.0 0.0 0.0 0.0 112-113 2.1625 0.0 0.0 0.0 0.0 114-115 2.375 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 2.7625 0.0 0.0 0.0 0.0 120-121 2.925 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.2874999999999996 0.0 0.0 0.0 0.0 126-127 3.525 0.0 0.0 0.0 0.0 128-129 3.95 0.0 0.0 0.0 0.0 130-131 4.1125 0.0 0.0 0.0 0.0 132-133 4.2875 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.7125 0.0 0.0 0.0 0.0 138-139 5.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675337 spots for SRR7170486.sra Written 675337 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra Read 675329 spots for SRR7170486.sra Written 675329 spots for SRR7170486.sra SRR ids: ['SRR7170486.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_k3hpt8ep SRR7170486.sra spots: 13506588 blocks: [[1, 675329], [675330, 1350658], [1350659, 2025987], [2025988, 2701316], [2701317, 3376645], [3376646, 4051974], [4051975, 4727303], [4727304, 5402632], [5402633, 6077961], [6077962, 6753290], [6753291, 7428619], [7428620, 8103948], [8103949, 8779277], [8779278, 9454606], [9454607, 10129935], [10129936, 10805264], [10805265, 11480593], [11480594, 12155922], [12155923, 12831251], [12831252, 13506588]] SRR7170486 file size 4555239 SRR7170486 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170486 SRR7170486_1.fastq SRR7170486_2.fastq Input file: SRR7170486_1.fastq Paired file: SRR7170486_2.fastq trimmed: SRR7170486-trimmed-pair1.fastq, SRR7170486-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:42:53 2025 >> started Thu Feb 13 00:48:18 2025 >> done (325.062s) 13506588 read pairs processed; of these: 9892 ( 0.07%) short read pairs filtered out after trimming by size control 10063 ( 0.07%) empty read pairs filtered out after trimming by size control 13486633 (99.85%) read pairs available; of these: 7736569 (57.36%) trimmed read pairs available after processing 5750064 (42.64%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 5 0.00% 19 5 0.00% 20 4 0.00% 21 4 0.00% 22 6 0.00% 23 4 0.00% 24 2 0.00% 25 1 0.00% 26 5 0.00% 27 4 0.00% 28 6 0.00% 29 8 0.00% 30 2 0.00% 31 7 0.00% 32 6 0.00% 33 8 0.00% 34 6 0.00% 35 14 0.00% 36 5 0.00% 37 14 0.00% 38 17 0.00% 39 21 0.00% 40 23 0.00% 41 30 0.00% 42 22 0.00% 43 25 0.00% 44 31 0.00% 45 31 0.00% 46 38 0.00% 47 57 0.00% 48 56 0.00% 49 81 0.00% 50 76 0.00% 51 90 0.00% 52 136 0.00% 53 127 0.00% 54 154 0.00% 55 152 0.00% 56 160 0.00% 57 196 0.00% 58 213 0.00% 59 265 0.00% 60 306 0.00% 61 378 0.00% 62 428 0.00% 63 446 0.00% 64 504 0.00% 65 518 0.00% 66 512 0.00% 67 598 0.00% 68 697 0.01% 69 789 0.01% 70 909 0.01% 71 1084 0.01% 72 1208 0.01% 73 1375 0.01% 74 1577 0.01% 75 1687 0.01% 76 1796 0.01% 77 1968 0.01% 78 2140 0.02% 79 2294 0.02% 80 2461 0.02% 81 2913 0.02% 82 3357 0.02% 83 3706 0.03% 84 4551 0.03% 85 5061 0.04% 86 5264 0.04% 87 5408 0.04% 88 5747 0.04% 89 6000 0.04% 90 6398 0.05% 91 6900 0.05% 92 7421 0.06% 93 8202 0.06% 94 8620 0.06% 95 9324 0.07% 96 9585 0.07% 97 10077 0.07% 98 10095 0.07% 99 10469 0.08% 100 10940 0.08% 101 11552 0.09% 102 12162 0.09% 103 12531 0.09% 104 13244 0.10% 105 14073 0.10% 106 14407 0.11% 107 14441 0.11% 108 14848 0.11% 109 15382 0.11% 110 15568 0.12% 111 15957 0.12% 112 16756 0.12% 113 17313 0.13% 114 18043 0.13% 115 18908 0.14% 116 19465 0.14% 117 19769 0.15% 118 20296 0.15% 119 20634 0.15% 120 21333 0.16% 121 21696 0.16% 122 22157 0.16% 123 23473 0.17% 124 24951 0.19% 125 25806 0.19% 126 26811 0.20% 127 27870 0.21% 128 28988 0.21% 129 30205 0.22% 130 31237 0.23% 131 33070 0.25% 132 35332 0.26% 133 37833 0.28% 134 40481 0.30% 135 43702 0.32% 136 47107 0.35% 137 51797 0.38% 138 56249 0.42% 139 63023 0.47% 140 70962 0.53% 141 80666 0.60% 142 93320 0.69% 143 111723 0.83% 144 137356 1.02% 145 172992 1.28% 146 230279 1.71% 147 327655 2.43% 148 520958 3.86% 149 1029228 7.63% 150 3797130 28.15% 151 5750064 42.64% 13486633 reads passed initial QC criterion=sequence-density sequence-density=0.47 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=28 prefix-density=0.47 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=31 fanout-score=112.42 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=8.2 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAA criterion=sequence-density sequence-density=0.44 sequence-density-rank=1 fanout-score=2.86 fanout-score-rank=12 prefix-density=0.63 prefix-fanout=2.0 sequence=AACCGCACCCCGGCACA criterion=fanout-score sequence-density=0.01 sequence-density-rank=28 fanout-score=129.55 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=9.6 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCA SRR7170486 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:20:02 Started mapping on | Feb 13 01:20:02 Finished on | Feb 13 01:21:37 Mapping speed, Million of reads per hour | 511.07 Number of input reads | 13486633 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12704862 Uniquely mapped reads % | 94.20% Average mapped length | 293.77 Number of splices: Total | 12075178 Number of splices: Annotated (sjdb) | 11804724 Number of splices: GT/AG | 11849309 Number of splices: GC/AG | 183658 Number of splices: AT/AC | 7510 Number of splices: Non-canonical | 34701 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.67 Insertion rate per base | 0.02% Insertion average length | 2.09 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 347078 % of reads mapped to multiple loci | 2.57% Number of reads mapped to too many loci | 50390 % of reads mapped to too many loci | 0.37% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.78% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 444086 444086 444086 N_multimapping 347078 347078 347078 N_noFeature 469328 12462309 541385 N_ambiguous 267842 1005 96744 UnstrandedReadsAssigned:11967692 PositiveStrandReadsAssigned:241548 NegativeStrandReadsAssigned:12066733 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170486 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170486-trimmed-pair1.fastq SRR7170486-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,486,633 reads, 11,987,052 reads pseudoaligned [quant] estimated average fragment length: 276.126 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,067 rounds 52401 SRR7170486.ke.tsv 34699 SRR7170486.se.tsv 87100 total ==> SRR7170486.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.87 665 27.1437 Potri.005G024800.1.v4.1 1035 759.874 276 25.8393 Potri.004G059700.1.v4.1 961 685.895 13 1.34834 Potri.007G009000.2.v4.1 1416 1140.87 0 0 Potri.003G141000.2.v4.1 2943 2667.87 468 12.4794 Potri.016G087400.1.v4.1 270 76.0012 747 699.219 Potri.015G069301.1.v4.1 564 295.044 0 0 Potri.010G195200.1.v4.1 1773 1497.87 62 2.94462 Potri.012G127500.1.v4.1 977 701.885 202 20.4738 ==> SRR7170486.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 757 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 301 Potri.001G212900.v4.1 36 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 12 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 12 SRR7170486 completed mapping pipeline successfully