Starting /dee2/code/volunteer_pipeline.sh SRR7170487 current disk space = 3050730889216 free memory = 1576783176 SRR7170487 SRAfilesize 4053e25223274651980c6c6f906ce216 SRR7170487.sra SRR7170487.sra file validated SRR7170487 is paired end SRR7170487 is conventional basespace SRR7170487 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170487_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.21975 18.0 18.0 18.0 18.0 28.0 2 24.36425 25.0 18.0 27.0 18.0 29.0 3 25.318 27.0 25.0 29.0 18.0 31.0 4 28.14225 29.0 27.0 31.0 25.0 33.0 5 28.93 31.0 29.0 31.0 25.0 33.0 6 34.87575 37.0 34.0 37.0 29.0 38.0 7 36.39975 38.0 37.0 38.0 34.0 38.0 8 36.27575 38.0 36.0 38.0 33.0 38.0 9 36.9325 38.0 37.0 38.0 35.0 38.0 10-14 36.61495 38.0 37.2 38.0 33.8 38.0 15-19 37.4798 38.0 38.0 38.0 37.0 38.0 20-24 37.55475 38.0 38.0 38.0 37.0 38.0 25-29 36.66335 38.0 37.4 38.0 32.2 38.0 30-34 37.2416 38.0 38.0 38.0 36.4 38.0 35-39 37.348349999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.4713 38.0 38.0 38.0 37.0 38.0 45-49 37.409349999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.40635 38.0 38.0 38.0 37.0 38.0 55-59 37.2952 38.0 38.0 38.0 36.6 38.0 60-64 37.28775 38.0 38.0 38.0 36.6 38.0 65-69 37.19875 38.0 38.0 38.0 36.4 38.0 70-74 36.6697 38.0 37.8 38.0 34.4 38.0 75-79 37.04775 38.0 38.0 38.0 36.0 38.0 80-84 37.0196 38.0 38.0 38.0 36.0 38.0 85-89 36.82719999999999 38.0 38.0 38.0 35.0 38.0 90-94 36.7549 38.0 38.0 38.0 34.8 38.0 95-99 36.63645 38.0 38.0 38.0 34.4 38.0 100-104 36.64565 38.0 38.0 38.0 34.0 38.0 105-109 36.54045 38.0 38.0 38.0 34.0 38.0 110-114 36.391349999999996 38.0 37.6 38.0 34.0 38.0 115-119 35.99255000000001 38.0 37.0 38.0 32.4 38.0 120-124 35.93285 38.0 37.0 38.0 32.6 38.0 125-129 35.802200000000006 38.0 36.4 38.0 31.8 38.0 130-134 35.49455 38.0 36.0 38.0 31.0 38.0 135-139 34.681050000000006 38.0 35.0 38.0 26.2 38.0 140-144 34.833600000000004 38.0 35.0 38.0 27.8 38.0 145-149 34.27335000000001 38.0 34.2 38.0 26.8 38.0 150-151 30.346874999999997 35.5 28.0 38.0 13.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 1.0 14 0.0 15 1.0 16 0.0 17 3.0 18 2.0 19 3.0 20 1.0 21 4.0 22 1.0 23 3.0 24 5.0 25 8.0 26 7.0 27 11.0 28 23.0 29 26.0 30 30.0 31 65.0 32 71.0 33 119.0 34 205.0 35 450.0 36 1266.0 37 1693.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 22.470741222366712 35.99479843953186 7.906371911573472 33.62808842652796 2 23.005751437859466 15.503875968992247 33.33333333333333 28.157039259814955 3 21.825 20.3 25.674999999999997 32.2 4 22.900000000000002 29.075 21.85 26.174999999999997 5 23.35 32.65 24.55 19.45 6 18.3 36.8 24.825 20.075000000000003 7 12.825000000000001 25.775 44.1 17.299999999999997 8 17.575 25.775 30.025000000000002 26.625 9 16.975 23.95 33.675 25.4 10-14 18.92 30.145 27.525 23.41 15-19 19.23 28.939999999999998 27.855 23.974999999999998 20-24 19.32 28.9 28.349999999999998 23.43 25-29 19.095000000000002 28.99 28.125 23.79 30-34 19.535 28.555000000000003 28.9 23.01 35-39 19.939999999999998 28.58 27.48 24.0 40-44 19.25 28.935 28.03 23.785 45-49 19.77 28.365000000000002 27.63 24.235 50-54 19.305 29.275000000000002 28.015 23.405 55-59 20.075000000000003 28.395 27.93 23.599999999999998 60-64 19.765 28.405 28.025 23.805 65-69 20.044999999999998 27.99 28.255000000000003 23.71 70-74 19.28 28.51 28.134999999999998 24.075 75-79 20.155 29.07 27.49 23.285 80-84 20.03 28.694999999999997 27.515 23.76 85-89 19.695 29.035 27.705000000000002 23.565 90-94 19.759999999999998 27.894999999999996 28.044999999999998 24.3 95-99 19.73 28.055000000000003 28.235 23.98 100-104 19.96 28.925 27.644999999999996 23.47 105-109 19.57 28.33 28.07 24.03 110-114 20.11 28.13 28.02 23.74 115-119 20.1 28.384999999999998 27.71 23.805 120-124 19.985 28.425 27.455000000000002 24.135 125-129 19.855 28.725 27.49 23.93 130-134 20.785 28.77 26.974999999999998 23.47 135-139 20.599999999999998 28.035 27.715 23.65 140-144 20.580000000000002 28.815 27.339999999999996 23.265 145-149 20.21 28.83 27.27 23.69 150-151 20.6375 28.175 26.737499999999997 24.45 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 0.5 22 1.0 23 2.5 24 4.0 25 4.5 26 6.0 27 9.5 28 11.5 29 15.0 30 16.5 31 25.5 32 37.5 33 49.0 34 69.0 35 80.0 36 99.5 37 119.0 38 142.0 39 178.0 40 217.0 41 245.0 42 244.0 43 264.5 44 295.5 45 281.0 46 253.0 47 232.5 48 207.5 49 186.5 50 153.5 51 115.0 52 103.5 53 92.0 54 70.5 55 49.0 56 32.5 57 26.5 58 17.5 59 9.5 60 7.0 61 6.5 62 5.0 63 5.0 64 2.5 65 1.0 66 1.5 67 1.5 68 1.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.875 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.5875 0.0 0.0 0.0 0.0 100-101 0.675 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.9125 0.0 0.0 0.0 0.0 106-107 1.1 0.0 0.0 0.0 0.0 108-109 1.2374999999999998 0.0 0.0 0.0 0.0 110-111 1.3875 0.0 0.0 0.0 0.0 112-113 1.5375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9125 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.275 0.0 0.0 0.0 0.0 122-123 2.4375 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position AATACAC 10 0.006832588 144.9875 5 AAAAAAA 55 4.806514E-6 21.08909 25-29 >>END_MODULE SRR7170487 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170487_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.99275 33.0 33.0 34.0 32.0 34.0 2 33.085 34.0 33.0 34.0 32.0 34.0 3 33.0595 34.0 33.0 34.0 32.0 34.0 4 33.08775 34.0 33.0 34.0 32.0 34.0 5 33.0745 34.0 33.0 34.0 33.0 34.0 6 37.28775 38.0 38.0 38.0 37.0 38.0 7 37.30925 38.0 38.0 38.0 37.0 38.0 8 37.28175 38.0 38.0 38.0 37.0 38.0 9 37.2765 38.0 38.0 38.0 37.0 38.0 10-14 37.19815 38.0 38.0 38.0 36.8 38.0 15-19 37.076750000000004 38.0 38.0 38.0 36.4 38.0 20-24 37.01825 38.0 38.0 38.0 36.2 38.0 25-29 37.0463 38.0 38.0 38.0 36.4 38.0 30-34 37.1113 38.0 38.0 38.0 36.8 38.0 35-39 37.074149999999996 38.0 38.0 38.0 36.8 38.0 40-44 37.02085000000001 38.0 38.0 38.0 36.0 38.0 45-49 36.9469 38.0 38.0 38.0 36.0 38.0 50-54 36.73350000000001 38.0 38.0 38.0 35.2 38.0 55-59 36.858050000000006 38.0 38.0 38.0 35.6 38.0 60-64 36.365050000000004 38.0 37.6 38.0 33.4 38.0 65-69 36.7318 38.0 38.0 38.0 35.4 38.0 70-74 36.21215 38.0 37.6 38.0 32.8 38.0 75-79 36.41685 38.0 37.6 38.0 33.8 38.0 80-84 35.81935 38.0 36.8 38.0 29.4 38.0 85-89 35.2389 38.0 36.2 38.0 27.2 38.0 90-94 36.30685 38.0 37.6 38.0 33.4 38.0 95-99 36.2086 38.0 37.8 38.0 33.8 38.0 100-104 35.978 38.0 37.4 38.0 31.8 38.0 105-109 35.54575 38.0 36.4 38.0 29.8 38.0 110-114 35.3262 38.0 36.0 38.0 27.8 38.0 115-119 35.50515 38.0 36.2 38.0 30.6 38.0 120-124 35.2418 38.0 36.0 38.0 29.0 38.0 125-129 35.02715 38.0 35.8 38.0 28.0 38.0 130-134 34.37485 38.0 34.0 38.0 25.0 38.0 135-139 34.187850000000005 38.0 33.2 38.0 24.6 38.0 140-144 33.17965 38.0 32.6 38.0 19.2 38.0 145-149 32.4105 38.0 33.0 38.0 11.8 38.0 150-151 27.3385 34.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 4.0 4 2.0 5 1.0 6 1.0 7 2.0 8 1.0 9 3.0 10 0.0 11 0.0 12 1.0 13 2.0 14 2.0 15 2.0 16 1.0 17 2.0 18 0.0 19 0.0 20 2.0 21 8.0 22 8.0 23 10.0 24 15.0 25 11.0 26 18.0 27 27.0 28 44.0 29 50.0 30 50.0 31 70.0 32 101.0 33 124.0 34 230.0 35 394.0 36 871.0 37 1938.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.0 20.150000000000002 15.65 27.200000000000003 2 26.075 25.525 31.05 17.349999999999998 3 20.025000000000002 29.175 31.5 19.3 4 23.974999999999998 35.9 22.775000000000002 17.349999999999998 5 23.825 37.375 21.825 16.975 6 20.3 39.125 24.099999999999998 16.475 7 19.15 21.224999999999998 40.0 19.625 8 21.224999999999998 25.15 28.9 24.725 9 22.2 23.45 30.0 24.349999999999998 10-14 22.88 29.65 26.43 21.04 15-19 22.439999999999998 29.03 28.345 20.185 20-24 22.985 27.905 28.849999999999998 20.26 25-29 22.85 28.26 28.255000000000003 20.635 30-34 23.025000000000002 27.785 28.610000000000003 20.580000000000002 35-39 22.67 28.53 27.85 20.95 40-44 23.085 27.889999999999997 28.42 20.605 45-49 22.32 28.794999999999998 28.13 20.755000000000003 50-54 22.755 28.34 28.075 20.830000000000002 55-59 23.035 28.95 27.860000000000003 20.155 60-64 22.875 28.33 28.655 20.14 65-69 23.22 27.785 28.305000000000003 20.69 70-74 23.28 28.075 28.78 19.865 75-79 23.745 27.965 28.015 20.275000000000002 80-84 23.24 28.12 27.889999999999997 20.75 85-89 23.549999999999997 28.075 27.735 20.64 90-94 23.369999999999997 28.665000000000003 28.03 19.935 95-99 23.810000000000002 27.87 27.875 20.445 100-104 23.549999999999997 27.96 28.03 20.46 105-109 23.455000000000002 27.800000000000004 28.17 20.575 110-114 23.565 28.21 27.595 20.630000000000003 115-119 24.025 28.365000000000002 28.115000000000002 19.495 120-124 23.5 27.655 28.43 20.415 125-129 23.810000000000002 27.77 28.199999999999996 20.22 130-134 24.535 27.944999999999997 27.375 20.145 135-139 24.515 27.860000000000003 27.860000000000003 19.765 140-144 24.240000000000002 27.875 28.165000000000003 19.72 145-149 24.310000000000002 28.02 28.08 19.59 150-151 24.462500000000002 27.500000000000004 28.6625 19.375 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.5 17 1.5 18 1.0 19 1.0 20 1.0 21 1.0 22 1.5 23 1.5 24 4.0 25 4.5 26 2.5 27 6.0 28 11.5 29 11.5 30 12.5 31 23.5 32 35.5 33 40.0 34 55.5 35 70.0 36 79.5 37 118.5 38 167.0 39 193.5 40 207.5 41 233.5 42 257.5 43 269.5 44 292.5 45 300.5 46 272.5 47 252.0 48 218.0 49 171.0 50 146.5 51 116.5 52 91.5 53 70.5 54 56.5 55 52.5 56 43.0 57 26.5 58 19.5 59 18.5 60 12.0 61 7.5 62 6.5 63 6.0 64 3.0 65 1.5 66 0.5 67 0.5 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.5 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59798994974875 99.1 2 0.3015075376884422 0.6 3 0.10050251256281408 0.3 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0125 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.075 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.2 0.0 0.0 0.0 0.0 90-91 0.2875 0.0 0.0 0.0 0.0 92-93 0.3375 0.0 0.0 0.0 0.0 94-95 0.4 0.0 0.0 0.0 0.0 96-97 0.48750000000000004 0.0 0.0 0.0 0.0 98-99 0.575 0.0 0.0 0.0 0.0 100-101 0.625 0.0 0.0 0.0 0.0 102-103 0.7 0.0 0.0 0.0 0.0 104-105 0.8875 0.0 0.0 0.0 0.0 106-107 1.0750000000000002 0.0 0.0 0.0 0.0 108-109 1.2125 0.0 0.0 0.0 0.0 110-111 1.3625 0.0 0.0 0.0 0.0 112-113 1.5125000000000002 0.0 0.0 0.0 0.0 114-115 1.725 0.0 0.0 0.0 0.0 116-117 1.8875 0.0 0.0 0.0 0.0 118-119 2.075 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.425 0.0 0.0 0.0 0.0 124-125 2.675 0.0 0.0 0.0 0.0 126-127 2.8875 0.0 0.0 0.0 0.0 128-129 3.125 0.0 0.0 0.0 0.0 130-131 3.425 0.0 0.0 0.0 0.0 132-133 3.65 0.0 0.0 0.0 0.0 134-135 4.0625 0.0 0.0 0.0 0.0 136-137 4.4 0.0 0.0 0.0 0.0 138-139 4.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra Read 671857 spots for SRR7170487.sra Written 671857 spots for SRR7170487.sra Read 671852 spots for SRR7170487.sra Written 671852 spots for SRR7170487.sra SRR ids: ['SRR7170487.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qxx97off SRR7170487.sra spots: 13437045 blocks: [[1, 671852], [671853, 1343704], [1343705, 2015556], [2015557, 2687408], [2687409, 3359260], [3359261, 4031112], [4031113, 4702964], [4702965, 5374816], [5374817, 6046668], [6046669, 6718520], [6718521, 7390372], [7390373, 8062224], [8062225, 8734076], [8734077, 9405928], [9405929, 10077780], [10077781, 10749632], [10749633, 11421484], [11421485, 12093336], [12093337, 12765188], [12765189, 13437045]] SRR7170487 file size 4531673 SRR7170487 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170487 SRR7170487_1.fastq SRR7170487_2.fastq Input file: SRR7170487_1.fastq Paired file: SRR7170487_2.fastq trimmed: SRR7170487-trimmed-pair1.fastq, SRR7170487-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:49:50 2025 >> started Thu Feb 13 00:59:36 2025 >> done (586.260s) 13437045 read pairs processed; of these: 9232 ( 0.07%) short read pairs filtered out after trimming by size control 8492 ( 0.06%) empty read pairs filtered out after trimming by size control 13419321 (99.87%) read pairs available; of these: 7489777 (55.81%) trimmed read pairs available after processing 5929544 (44.19%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 1 0.00% 20 0 0.00% 21 1 0.00% 22 3 0.00% 23 4 0.00% 24 3 0.00% 25 1 0.00% 26 2 0.00% 27 3 0.00% 28 4 0.00% 29 3 0.00% 30 4 0.00% 31 4 0.00% 32 2 0.00% 33 3 0.00% 34 10 0.00% 35 8 0.00% 36 7 0.00% 37 7 0.00% 38 17 0.00% 39 21 0.00% 40 16 0.00% 41 21 0.00% 42 17 0.00% 43 20 0.00% 44 22 0.00% 45 26 0.00% 46 31 0.00% 47 35 0.00% 48 45 0.00% 49 57 0.00% 50 62 0.00% 51 75 0.00% 52 83 0.00% 53 92 0.00% 54 113 0.00% 55 112 0.00% 56 121 0.00% 57 121 0.00% 58 162 0.00% 59 195 0.00% 60 225 0.00% 61 264 0.00% 62 288 0.00% 63 292 0.00% 64 346 0.00% 65 408 0.00% 66 398 0.00% 67 458 0.00% 68 496 0.00% 69 627 0.00% 70 693 0.01% 71 831 0.01% 72 957 0.01% 73 1049 0.01% 74 1171 0.01% 75 1262 0.01% 76 1456 0.01% 77 1545 0.01% 78 1674 0.01% 79 1875 0.01% 80 1932 0.01% 81 2366 0.02% 82 2685 0.02% 83 2955 0.02% 84 3661 0.03% 85 4255 0.03% 86 4435 0.03% 87 4759 0.04% 88 5069 0.04% 89 5255 0.04% 90 5696 0.04% 91 6084 0.05% 92 6642 0.05% 93 7289 0.05% 94 7898 0.06% 95 8295 0.06% 96 8596 0.06% 97 9204 0.07% 98 9447 0.07% 99 10002 0.07% 100 10484 0.08% 101 11003 0.08% 102 11644 0.09% 103 12360 0.09% 104 12932 0.10% 105 13761 0.10% 106 14327 0.11% 107 14640 0.11% 108 14888 0.11% 109 15379 0.11% 110 16186 0.12% 111 16592 0.12% 112 17055 0.13% 113 18005 0.13% 114 18844 0.14% 115 19308 0.14% 116 20079 0.15% 117 20554 0.15% 118 21290 0.16% 119 21570 0.16% 120 22111 0.16% 121 23087 0.17% 122 23839 0.18% 123 25082 0.19% 124 25866 0.19% 125 27573 0.21% 126 29161 0.22% 127 30064 0.22% 128 31541 0.24% 129 33061 0.25% 130 34365 0.26% 131 36293 0.27% 132 38511 0.29% 133 41304 0.31% 134 44487 0.33% 135 48335 0.36% 136 52482 0.39% 137 56589 0.42% 138 62179 0.46% 139 68849 0.51% 140 77483 0.58% 141 86867 0.65% 142 101371 0.76% 143 118193 0.88% 144 143391 1.07% 145 186410 1.39% 146 227079 1.69% 147 322291 2.40% 148 489205 3.65% 149 931466 6.94% 150 3595966 26.80% 151 5929544 44.19% 13419321 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=1.92 fanout-score-rank=32 prefix-density=0.33 prefix-fanout=1.9 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.13 sequence-density-rank=19 fanout-score=14.45 fanout-score-rank=1 prefix-density=0.84 prefix-fanout=2.3 sequence=TGCTTGCTTCTTCTAATCCACTGGAGAACTTT criterion=sequence-density sequence-density=0.34 sequence-density-rank=1 fanout-score=3.09 fanout-score-rank=17 prefix-density=0.36 prefix-fanout=2.9 sequence=TCCACTTGCACTGCTCGAGAATTGGCCGAGCGAGACGTA criterion=fanout-score sequence-density=0.02 sequence-density-rank=28 fanout-score=38.32 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=8.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGT SRR7170487 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:20:05 Started mapping on | Feb 13 01:20:05 Finished on | Feb 13 01:21:37 Mapping speed, Million of reads per hour | 525.10 Number of input reads | 13419321 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 12560618 Uniquely mapped reads % | 93.60% Average mapped length | 293.39 Number of splices: Total | 12308715 Number of splices: Annotated (sjdb) | 11999165 Number of splices: GT/AG | 12083272 Number of splices: GC/AG | 176492 Number of splices: AT/AC | 7449 Number of splices: Non-canonical | 41502 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.64 Insertion rate per base | 0.02% Insertion average length | 2.19 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 404418 % of reads mapped to multiple loci | 3.01% Number of reads mapped to too many loci | 38749 % of reads mapped to too many loci | 0.29% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.01% % of reads unmapped: other | 0.08% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 463689 463689 463689 N_multimapping 404418 404418 404418 N_noFeature 477924 12376802 533524 N_ambiguous 248156 804 119595 UnstrandedReadsAssigned:11834538 PositiveStrandReadsAssigned:183012 NegativeStrandReadsAssigned:11907499 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170487 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170487-trimmed-pair1.fastq SRR7170487-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,419,321 reads, 11,813,927 reads pseudoaligned [quant] estimated average fragment length: 273.58 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,108 rounds 52401 SRR7170487.ke.tsv 34699 SRR7170487.se.tsv 87100 total ==> SRR7170487.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.42 1031 47.7832 Potri.005G024800.1.v4.1 1035 762.42 291 30.8756 Potri.004G059700.1.v4.1 961 688.46 1 0.1175 Potri.007G009000.2.v4.1 1416 1143.42 0 0 Potri.003G141000.2.v4.1 2943 2670.42 618 18.7208 Potri.016G087400.1.v4.1 270 76.6866 964 1016.89 Potri.015G069301.1.v4.1 564 296.934 0 0 Potri.010G195200.1.v4.1 1773 1500.42 487.966 26.3083 Potri.012G127500.1.v4.1 977 704.438 158 18.1439 ==> SRR7170487.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 334 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 186 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 66 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 2 SRR7170487 completed mapping pipeline successfully