Starting /dee2/code/volunteer_pipeline.sh SRR7170488 current disk space = 3050478039040 free memory = 1578288260 SRR7170488 SRAfilesize 01e45fbdcddfd27c2e8130602e906864 SRR7170488.sra SRR7170488.sra file validated SRR7170488 is paired end SRR7170488 is conventional basespace SRR7170488 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170488_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.12075 25.0 18.0 33.0 18.0 33.0 2 25.68425 27.0 18.0 31.0 18.0 33.0 3 29.72225 31.0 28.0 33.0 27.0 33.0 4 31.5365 33.0 31.0 33.0 29.0 33.0 5 32.568 33.0 33.0 33.0 32.0 33.0 6 36.83025 38.0 37.0 38.0 35.0 38.0 7 37.1795 38.0 38.0 38.0 36.0 38.0 8 37.462 38.0 38.0 38.0 37.0 38.0 9 37.39 38.0 38.0 38.0 37.0 38.0 10-14 37.571600000000004 38.0 38.0 38.0 37.6 38.0 15-19 37.58955 38.0 38.0 38.0 38.0 38.0 20-24 37.6184 38.0 38.0 38.0 38.0 38.0 25-29 37.58415 38.0 38.0 38.0 38.0 38.0 30-34 37.54295 38.0 38.0 38.0 38.0 38.0 35-39 37.4499 38.0 38.0 38.0 37.2 38.0 40-44 37.42745 38.0 38.0 38.0 37.0 38.0 45-49 37.20665 38.0 38.0 38.0 36.8 38.0 50-54 37.26445 38.0 38.0 38.0 37.0 38.0 55-59 37.1396 38.0 38.0 38.0 35.8 38.0 60-64 37.17355 38.0 38.0 38.0 36.2 38.0 65-69 37.00450000000001 38.0 38.0 38.0 35.8 38.0 70-74 36.933299999999996 38.0 38.0 38.0 35.4 38.0 75-79 36.634299999999996 38.0 38.0 38.0 34.6 38.0 80-84 36.473200000000006 38.0 38.0 38.0 34.0 38.0 85-89 36.36365000000001 38.0 38.0 38.0 34.0 38.0 90-94 36.26915 38.0 37.2 38.0 33.8 38.0 95-99 35.723699999999994 38.0 36.8 38.0 30.6 38.0 100-104 36.029450000000004 38.0 37.0 38.0 33.0 38.0 105-109 35.7227 38.0 36.6 38.0 31.0 38.0 110-114 35.45309999999999 38.0 36.0 38.0 30.0 38.0 115-119 35.0344 38.0 35.6 38.0 27.8 38.0 120-124 34.76375 38.0 35.0 38.0 27.4 38.0 125-129 34.08245 38.0 34.0 38.0 23.2 38.0 130-134 32.93535 37.6 32.2 38.0 16.2 38.0 135-139 32.194 37.0 31.0 38.0 15.0 38.0 140-144 30.98795 36.0 29.8 38.0 12.8 38.0 145-149 29.743650000000002 36.0 28.2 38.0 5.8 38.0 150-151 23.59825 30.5 11.0 36.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 3.0 13 0.0 14 1.0 15 1.0 16 3.0 17 1.0 18 2.0 19 4.0 20 4.0 21 4.0 22 14.0 23 7.0 24 12.0 25 14.0 26 30.0 27 33.0 28 26.0 29 57.0 30 68.0 31 89.0 32 114.0 33 169.0 34 259.0 35 548.0 36 1353.0 37 1183.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 41.082060574682885 11.467771162309086 7.843644835619984 39.60652342738804 2 19.55 14.6 33.1 32.75 3 18.275 21.05 26.8 33.875 4 22.2 28.549999999999997 23.5 25.75 5 21.475 32.85 24.025 21.65 6 19.175 36.1 23.7 21.025 7 14.000000000000002 24.425 42.825 18.75 8 15.875 25.2 31.225 27.700000000000003 9 16.275000000000002 24.525 34.9 24.3 10-14 19.36 29.2 28.29 23.150000000000002 15-19 19.66 28.035 28.01 24.295 20-24 18.975 28.28 28.925 23.82 25-29 19.509999999999998 29.12 27.74 23.630000000000003 30-34 18.97379475895179 28.775755151030207 28.145629125825167 24.10482096419284 35-39 19.592938940841126 28.289243386507977 28.249237385607838 23.868580287043056 40-44 19.711971197119713 29.50795079507951 27.262726272627262 23.517351735173516 45-49 19.975 28.875 27.235 23.915 50-54 19.814999999999998 28.735 28.01 23.44 55-59 19.48 28.825 27.310000000000002 24.385 60-64 19.53 28.535 27.860000000000003 24.075 65-69 19.869999999999997 28.49 27.88 23.76 70-74 19.875 28.754999999999995 27.455000000000002 23.915 75-79 20.061018305491647 28.623587076122835 27.31819545863759 23.997199159747925 80-84 19.963992798559712 28.900780156031207 27.995599119823964 23.139627925585117 85-89 19.921992199219922 28.64786478647865 27.467746774677465 23.962396239623963 90-94 20.075000000000003 27.96 28.355000000000004 23.61 95-99 20.165 28.38 27.865000000000002 23.59 100-104 19.845 28.58 27.325 24.25 105-109 19.725 28.475 27.750000000000004 24.05 110-114 20.025000000000002 27.905 28.49 23.580000000000002 115-119 19.975 28.57 28.125 23.330000000000002 120-124 20.064999999999998 28.4 27.82 23.715 125-129 19.400000000000002 28.12 28.315 24.165 130-134 20.16 28.025 27.83 23.985 135-139 20.19 28.544999999999998 27.215 24.05 140-144 20.385 28.265 27.560000000000002 23.79 145-149 20.4 27.839999999999996 27.68 24.08 150-151 20.4375 28.4375 27.250000000000004 23.875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 1.0 15 1.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 1.0 22 1.5 23 2.0 24 2.0 25 2.5 26 4.5 27 4.5 28 8.0 29 14.5 30 19.5 31 29.0 32 37.0 33 52.0 34 72.0 35 77.0 36 92.0 37 108.5 38 133.5 39 171.5 40 202.0 41 222.5 42 242.5 43 254.0 44 252.5 45 258.0 46 258.5 47 259.5 48 236.0 49 194.5 50 169.5 51 137.5 52 104.5 53 85.0 54 72.5 55 62.5 56 43.5 57 26.0 58 19.5 59 18.5 60 15.5 61 10.5 62 6.0 63 3.5 64 3.0 65 2.0 66 2.0 67 2.0 68 1.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.02 35-39 0.015 40-44 0.01 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.03 80-84 0.02 85-89 0.01 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.725 #Duplication Level Percentage of deduplicated Percentage of total 1 99.74931060416145 99.47500000000001 2 0.22562045625470042 0.44999999999999996 3 0.0250689395838556 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.175 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.23750000000000002 0.0 0.0 0.0 0.0 82-83 0.3 0.0 0.0 0.0 0.0 84-85 0.3625 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.55 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.6375 0.0 0.0 0.0 0.0 104-105 1.8625 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.15 0.0 0.0 0.0 0.0 110-111 2.25 0.0 0.0 0.0 0.0 112-113 2.4375 0.0 0.0 0.0 0.0 114-115 2.6875 0.0 0.0 0.0 0.0 116-117 2.925 0.0 0.0 0.0 0.0 118-119 3.1375 0.0 0.0 0.0 0.0 120-121 3.4125 0.0 0.0 0.0 0.0 122-123 3.6375 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.325 0.0 0.0 0.0 0.0 130-131 4.575 0.0 0.0 0.0 0.0 132-133 4.95 0.0 0.0 0.0 0.0 134-135 5.3875 0.0 0.0 0.0 0.0 136-137 5.6875 0.0 0.0 0.0 0.0 138-139 5.9875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CAACAGA 10 0.006836113 144.9625 4 >>END_MODULE SRR7170488 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170488_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.03275 33.0 33.0 34.0 32.0 34.0 2 33.099 34.0 33.0 34.0 33.0 34.0 3 33.07025 34.0 33.0 34.0 33.0 34.0 4 33.057 34.0 33.0 34.0 33.0 34.0 5 33.03325 34.0 33.0 34.0 33.0 34.0 6 37.34 38.0 38.0 38.0 37.0 38.0 7 37.344 38.0 38.0 38.0 37.0 38.0 8 37.351 38.0 38.0 38.0 37.0 38.0 9 37.34525 38.0 38.0 38.0 38.0 38.0 10-14 37.3647 38.0 38.0 38.0 37.6 38.0 15-19 37.294500000000006 38.0 38.0 38.0 37.4 38.0 20-24 37.28915 38.0 38.0 38.0 37.0 38.0 25-29 37.231700000000004 38.0 38.0 38.0 37.0 38.0 30-34 37.21655 38.0 38.0 38.0 37.2 38.0 35-39 37.19135 38.0 38.0 38.0 37.0 38.0 40-44 37.15965 38.0 38.0 38.0 37.0 38.0 45-49 37.115050000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.130700000000004 38.0 38.0 38.0 37.0 38.0 55-59 37.11355 38.0 38.0 38.0 37.0 38.0 60-64 37.04515 38.0 38.0 38.0 36.8 38.0 65-69 36.99515 38.0 38.0 38.0 36.4 38.0 70-74 36.84935 38.0 38.0 38.0 36.0 38.0 75-79 36.78860000000001 38.0 38.0 38.0 36.0 38.0 80-84 36.726800000000004 38.0 38.0 38.0 35.8 38.0 85-89 36.67925 38.0 38.0 38.0 35.4 38.0 90-94 36.57135 38.0 38.0 38.0 35.0 38.0 95-99 36.42815 38.0 38.0 38.0 34.2 38.0 100-104 36.292100000000005 38.0 38.0 38.0 34.0 38.0 105-109 36.115449999999996 38.0 38.0 38.0 33.8 38.0 110-114 35.997749999999996 38.0 37.6 38.0 33.6 38.0 115-119 35.77585 38.0 37.0 38.0 32.8 38.0 120-124 35.49915 38.0 36.8 38.0 31.2 38.0 125-129 34.76105 38.0 35.8 38.0 27.4 38.0 130-134 34.473299999999995 38.0 35.0 38.0 26.4 38.0 135-139 34.008 38.0 34.0 38.0 24.2 38.0 140-144 33.222300000000004 38.0 33.0 38.0 19.2 38.0 145-149 32.44425 38.0 33.0 38.0 11.2 38.0 150-151 26.5535 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 6.0 3 2.0 4 0.0 5 2.0 6 3.0 7 1.0 8 1.0 9 3.0 10 2.0 11 4.0 12 2.0 13 4.0 14 1.0 15 6.0 16 3.0 17 7.0 18 4.0 19 4.0 20 6.0 21 3.0 22 10.0 23 8.0 24 10.0 25 18.0 26 18.0 27 18.0 28 34.0 29 31.0 30 32.0 31 48.0 32 63.0 33 89.0 34 134.0 35 275.0 36 710.0 37 2438.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 40.04004004004004 22.67267267267267 13.188188188188189 24.0990990990991 2 25.819364523392547 26.945208906680012 29.82236677508131 17.413059794846134 3 20.67067067067067 29.554554554554553 30.755755755755754 19.01901901901902 4 24.224224224224226 35.06006006006006 22.872872872872875 17.842842842842842 5 24.261392088132197 37.931897846770156 21.807711567351028 15.99899849774662 6 19.039279459594695 39.05429071803853 22.516887665749312 19.389542156617463 7 19.814861145859393 22.34175631723793 38.85414060545409 18.989241931448586 8 19.70985492746373 27.263631815907953 28.61430715357679 24.412206103051524 9 21.060530265132567 25.46273136568284 30.465232616308153 23.011505752876438 10-14 23.36817886260191 29.070174561096383 27.14450057520132 20.417146001100388 15-19 22.44683512634476 28.57142857142857 28.10607955966975 20.875656742556917 20-24 22.45796637309848 28.68294635708567 28.547838270616495 20.31124899919936 25-29 23.168594461969857 28.21090581342947 28.060687997596517 20.559811727004156 30-34 22.185496794871796 28.57071314102564 28.495592948717945 20.748197115384613 35-39 22.947863975559674 28.0012019832724 28.6723093103621 20.378624730805832 40-44 22.46471118230053 28.541395535088597 28.33116428070878 20.662729001902093 45-49 22.469098733923833 28.47420307261172 28.494220087074012 20.56247810639043 50-54 23.29096186567911 28.22039835852267 28.465619057151436 20.023020718646784 55-59 23.11580422380142 28.03022720448404 28.2854569112201 20.568511660494444 60-64 22.941382589978478 28.35260549632077 28.382640036041444 20.32337187765931 65-69 23.518806029949417 27.961135874192415 27.84594581058747 20.674112285270695 70-74 23.596293513648884 28.299524167292763 27.493112947658403 20.61106937139995 75-79 23.2556974705735 28.3496118206862 27.828700225394442 20.565990483345857 80-84 23.496118206862008 27.913849236163284 27.803656398697722 20.786376158276983 85-89 23.451039318807915 28.264462809917358 28.03906836964688 20.24542950162785 90-94 23.43601302278988 28.1893313298272 28.439769596794388 19.93488605058853 95-99 24.00200350613574 28.13924367643376 27.803656398697722 20.05509641873278 100-104 23.716760979518252 28.113576042866445 28.068506184586106 20.101156793029197 105-109 23.74035860963638 28.508464389462084 27.96253631172994 19.78864068917159 110-114 23.75657400450789 28.715251690458306 27.392937640871523 20.135236664162285 115-119 23.726521412471826 28.024042073628852 27.70848985725019 20.540946656649137 120-124 24.532932632106185 28.715251690458306 27.2526922113699 19.499123466065615 125-129 24.79839719509141 27.70848985725019 27.538191835712496 19.954921111945907 130-134 24.663160530929126 28.569997495617333 27.518156774355123 19.24868519909842 135-139 24.823441021788128 28.304532932632103 27.688454795892813 19.183571249686953 140-144 24.44778362133734 28.569997495617333 26.96218382168795 20.020035061357376 145-149 25.098923115452042 28.49987478086652 27.002253944402703 19.398948159278735 150-151 25.72608913370055 27.691537305958942 27.190786179268905 19.391587381071606 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 2.0 1 1.0 2 0.5 3 0.5 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 0.5 20 0.5 21 1.0 22 2.0 23 1.5 24 1.0 25 2.5 26 5.5 27 8.0 28 10.0 29 11.5 30 18.0 31 27.0 32 36.0 33 47.5 34 56.0 35 71.0 36 89.5 37 117.0 38 154.0 39 178.0 40 224.0 41 257.0 42 254.5 43 292.0 44 299.0 45 265.5 46 246.0 47 236.5 48 209.0 49 175.0 50 145.5 51 115.0 52 100.0 53 87.0 54 73.5 55 50.5 56 34.0 57 22.0 58 17.5 59 18.5 60 12.5 61 7.0 62 5.5 63 4.0 64 3.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.5 72 1.0 73 0.5 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.075 3 0.1 4 0.1 5 0.15 6 0.075 7 0.075 8 0.05 9 0.05 10-14 0.034999999999999996 15-19 0.075 20-24 0.08 25-29 0.145 30-34 0.16 35-39 0.165 40-44 0.11 45-49 0.08499999999999999 50-54 0.09 55-59 0.09 60-64 0.11499999999999999 65-69 0.165 70-74 0.17500000000000002 75-79 0.17500000000000002 80-84 0.17500000000000002 85-89 0.17500000000000002 90-94 0.17500000000000002 95-99 0.17500000000000002 100-104 0.155 105-109 0.16999999999999998 110-114 0.17500000000000002 115-119 0.17500000000000002 120-124 0.17500000000000002 125-129 0.17500000000000002 130-134 0.17500000000000002 135-139 0.17500000000000002 140-144 0.17500000000000002 145-149 0.17500000000000002 150-151 0.15 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.425 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54739753583102 98.97500000000001 2 0.35202413879808897 0.7000000000000001 3 0.07543374402816193 0.22499999999999998 4 0.025144581342720643 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.037500000000000006 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.0625 0.0 0.0 0.0 0.0 74-75 0.1 0.0 0.0 0.0 0.0 76-77 0.2 0.0 0.0 0.0 0.0 78-79 0.225 0.0 0.0 0.0 0.0 80-81 0.2625 0.0 0.0 0.0 0.0 82-83 0.325 0.0 0.0 0.0 0.0 84-85 0.4 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5625 0.0 0.0 0.0 0.0 90-91 0.65 0.0 0.0 0.0 0.0 92-93 0.825 0.0 0.0 0.0 0.0 94-95 0.975 0.0 0.0 0.0 0.0 96-97 1.125 0.0 0.0 0.0 0.0 98-99 1.3 0.0 0.0 0.0 0.0 100-101 1.475 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.875 0.0 0.0 0.0 0.0 106-107 2.0625 0.0 0.0 0.0 0.0 108-109 2.175 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5125 0.0 0.0 0.0 0.0 114-115 2.7875 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.2375 0.0 0.0 0.0 0.0 120-121 3.5 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 3.9875 0.0 0.0 0.0 0.0 126-127 4.1875 0.0 0.0 0.0 0.0 128-129 4.425 0.0 0.0 0.0 0.0 130-131 4.675 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.525 0.0 0.0 0.0 0.0 136-137 5.862500000000001 0.0 0.0 0.0 0.0 138-139 6.1625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTGGAAG 10 0.006830828 145.0 1 >>END_MODULE Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680388 spots for SRR7170488.sra Written 680388 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra Read 680382 spots for SRR7170488.sra Written 680382 spots for SRR7170488.sra SRR ids: ['SRR7170488.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xj_flcxu SRR7170488.sra spots: 13607646 blocks: [[1, 680382], [680383, 1360764], [1360765, 2041146], [2041147, 2721528], [2721529, 3401910], [3401911, 4082292], [4082293, 4762674], [4762675, 5443056], [5443057, 6123438], [6123439, 6803820], [6803821, 7484202], [7484203, 8164584], [8164585, 8844966], [8844967, 9525348], [9525349, 10205730], [10205731, 10886112], [10886113, 11566494], [11566495, 12246876], [12246877, 12927258], [12927259, 13607646]] SRR7170488 file size 4589484 SRR7170488 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170488 SRR7170488_1.fastq SRR7170488_2.fastq Input file: SRR7170488_1.fastq Paired file: SRR7170488_2.fastq trimmed: SRR7170488-trimmed-pair1.fastq, SRR7170488-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:43:15 2025 >> started Thu Feb 13 00:51:15 2025 >> done (480.410s) 13607646 read pairs processed; of these: 16399 ( 0.12%) short read pairs filtered out after trimming by size control 33287 ( 0.24%) empty read pairs filtered out after trimming by size control 13557960 (99.63%) read pairs available; of these: 9470019 (69.85%) trimmed read pairs available after processing 4087941 (30.15%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 1 0.00% 20 2 0.00% 21 12 0.00% 22 6 0.00% 23 4 0.00% 24 4 0.00% 25 1 0.00% 26 6 0.00% 27 12 0.00% 28 6 0.00% 29 9 0.00% 30 18 0.00% 31 10 0.00% 32 15 0.00% 33 16 0.00% 34 19 0.00% 35 26 0.00% 36 32 0.00% 37 38 0.00% 38 49 0.00% 39 55 0.00% 40 56 0.00% 41 77 0.00% 42 84 0.00% 43 68 0.00% 44 105 0.00% 45 99 0.00% 46 107 0.00% 47 134 0.00% 48 164 0.00% 49 187 0.00% 50 220 0.00% 51 260 0.00% 52 247 0.00% 53 275 0.00% 54 309 0.00% 55 347 0.00% 56 342 0.00% 57 393 0.00% 58 523 0.00% 59 577 0.00% 60 662 0.00% 61 736 0.01% 62 851 0.01% 63 910 0.01% 64 1026 0.01% 65 1115 0.01% 66 1214 0.01% 67 1318 0.01% 68 1409 0.01% 69 1630 0.01% 70 1874 0.01% 71 2160 0.02% 72 2402 0.02% 73 2790 0.02% 74 3022 0.02% 75 3206 0.02% 76 3447 0.03% 77 3806 0.03% 78 4020 0.03% 79 4435 0.03% 80 4893 0.04% 81 5534 0.04% 82 6153 0.05% 83 7117 0.05% 84 8256 0.06% 85 8420 0.06% 86 8613 0.06% 87 8877 0.07% 88 9379 0.07% 89 9638 0.07% 90 10223 0.08% 91 10972 0.08% 92 11833 0.09% 93 12539 0.09% 94 13306 0.10% 95 13827 0.10% 96 14299 0.11% 97 14574 0.11% 98 14715 0.11% 99 15355 0.11% 100 16014 0.12% 101 16074 0.12% 102 17100 0.13% 103 17872 0.13% 104 18653 0.14% 105 19487 0.14% 106 20125 0.15% 107 20467 0.15% 108 20315 0.15% 109 20554 0.15% 110 20620 0.15% 111 21482 0.16% 112 22597 0.17% 113 23252 0.17% 114 24077 0.18% 115 25263 0.19% 116 26058 0.19% 117 26650 0.20% 118 27080 0.20% 119 27689 0.20% 120 28829 0.21% 121 30038 0.22% 122 30753 0.23% 123 32351 0.24% 124 34450 0.25% 125 35858 0.26% 126 38394 0.28% 127 40175 0.30% 128 41709 0.31% 129 44193 0.33% 130 46998 0.35% 131 50082 0.37% 132 53590 0.40% 133 58268 0.43% 134 62628 0.46% 135 68139 0.50% 136 74697 0.55% 137 81469 0.60% 138 90627 0.67% 139 100688 0.74% 140 113835 0.84% 141 129468 0.95% 142 149216 1.10% 143 177006 1.31% 144 215273 1.59% 145 269808 1.99% 146 351562 2.59% 147 487628 3.60% 148 732785 5.40% 149 1326389 9.78% 150 3786210 27.93% 151 4087941 30.15% 13557960 reads passed initial QC criterion=sequence-density sequence-density=0.26 sequence-density-rank=1 fanout-score=2.46 fanout-score-rank=26 prefix-density=0.30 prefix-fanout=2.2 sequence=TACGCTTGTAAGGATTACAAGGTTTTTTCTTAGGACAATCTCGTTGGTAAATGCTACATCCACTGCCAGTTCGTGGGGCATAGGTAGGAGGCTGGCTTCTAGATGATACATCGCCAGTTGATGGGATATTGACGGTAACGCTATCTTTTCCATAGTCGACCAATTCTCGA criterion=fanout-score sequence-density=0.06 sequence-density-rank=32 fanout-score=30.38 fanout-score-rank=1 prefix-density=0.21 prefix-fanout=9.3 sequence=TCCTCCTTGTTGTACATGCCGGGAAGTTGCACATTTGTTGGGTTGTCAGCAATGTTCATGAGGGTAGCATTAACCATCTGGTTGTTGACAGTGTATTGGGTAGTTCCACCAAGCCTCCCAGCTCCGGCATCAAGATCATTGATGAAGAGGCAGCACATCTTTCCCTTCTTCTTGATTATATCAGCCGCCTCACGGTACCTTTGCCTGATAAGTTTTGCGGGTTCACCAGCGTTTCCACTTTCCAATTCTCCGGCACTCATCATGATTGGGCTAATTCCCATCTTGGCAAAGACCAGTTCACACTGGAAGGATTTTCCTTGACCTTTGCCTCCCCAAATACCCAAGATGAGAGGAACCTTGATATTAGGCAGGCTCATGAAGTTCTTGGAGATGTGAACAACAATCTTGTCCATGAAAGCAGGAGCAATGTAGAAACCATCCATCATGTTGTCCAGGTTGTACGTACGAAGACCTTGACTGAGGTACTCATAAGAACTCAAAACGGGGTTGT criterion=sequence-density sequence-density=0.71 sequence-density-rank=1 fanout-score=2.03 fanout-score-rank=30 prefix-density=0.70 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTAT criterion=fanout-score sequence-density=0.08 sequence-density-rank=27 fanout-score=28.47 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=9.8 sequence=AAGGCCAAGATCCAGGACAAGGA SRR7170488 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:20:00 Started mapping on | Feb 13 01:20:02 Finished on | Feb 13 01:22:35 Mapping speed, Million of reads per hour | 319.01 Number of input reads | 13557960 Average input read length | 291 UNIQUE READS: Uniquely mapped reads number | 12532599 Uniquely mapped reads % | 92.44% Average mapped length | 290.16 Number of splices: Total | 12061533 Number of splices: Annotated (sjdb) | 11738356 Number of splices: GT/AG | 11841265 Number of splices: GC/AG | 167971 Number of splices: AT/AC | 7723 Number of splices: Non-canonical | 44574 Mismatch rate per base, % | 0.40% Deletion rate per base | 0.03% Deletion average length | 2.66 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 375809 % of reads mapped to multiple loci | 2.77% Number of reads mapped to too many loci | 43817 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.38% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 660632 660632 660632 N_multimapping 375809 375809 375809 N_noFeature 554415 12346798 625452 N_ambiguous 239654 817 124518 UnstrandedReadsAssigned:11738530 PositiveStrandReadsAssigned:184984 NegativeStrandReadsAssigned:11782629 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170488 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170488-trimmed-pair1.fastq SRR7170488-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,557,960 reads, 11,728,834 reads pseudoaligned [quant] estimated average fragment length: 268.622 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,003 rounds 52401 SRR7170488.ke.tsv 34699 SRR7170488.se.tsv 87100 total ==> SRR7170488.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1750.38 1140 55.624 Potri.005G024800.1.v4.1 1035 767.378 365 40.6231 Potri.004G059700.1.v4.1 961 693.41 6 0.739009 Potri.007G009000.2.v4.1 1416 1148.38 0 0 Potri.003G141000.2.v4.1 2943 2675.38 562.012 17.9411 Potri.016G087400.1.v4.1 270 82.6403 656 677.955 Potri.015G069301.1.v4.1 564 302.631 0 0 Potri.010G195200.1.v4.1 1773 1505.38 447 25.3601 Potri.012G127500.1.v4.1 977 709.404 255 30.6998 ==> SRR7170488.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 635 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 238 Potri.001G212900.v4.1 18 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 14 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 17 SRR7170488 completed mapping pipeline successfully