Starting /dee2/code/volunteer_pipeline.sh SRR7170489 current disk space = 3050723053568 free memory = 1568567912 SRR7170489 SRAfilesize 73183a6980d327c89782b0c0e4818113 SRR7170489.sra SRR7170489.sra file validated SRR7170489 is paired end SRR7170489 is conventional basespace SRR7170489 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170489_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 19.32675 18.0 18.0 18.0 18.0 32.0 2 24.4825 27.0 18.0 27.0 18.0 29.0 3 24.41475 25.0 18.0 29.0 18.0 31.0 4 28.27275 29.0 27.0 31.0 25.0 33.0 5 30.137 32.0 30.0 33.0 25.0 33.0 6 35.18675 37.0 34.0 38.0 29.0 38.0 7 36.84 38.0 37.0 38.0 35.0 38.0 8 37.07125 38.0 38.0 38.0 35.0 38.0 9 37.31025 38.0 38.0 38.0 36.0 38.0 10-14 37.434999999999995 38.0 38.0 38.0 36.8 38.0 15-19 37.52085 38.0 38.0 38.0 37.2 38.0 20-24 37.6332 38.0 38.0 38.0 38.0 38.0 25-29 37.60450000000001 38.0 38.0 38.0 38.0 38.0 30-34 37.6009 38.0 38.0 38.0 38.0 38.0 35-39 37.5556 38.0 38.0 38.0 37.8 38.0 40-44 37.541650000000004 38.0 38.0 38.0 37.8 38.0 45-49 37.494600000000005 38.0 38.0 38.0 37.2 38.0 50-54 37.4119 38.0 38.0 38.0 37.0 38.0 55-59 37.321999999999996 38.0 38.0 38.0 37.0 38.0 60-64 37.279250000000005 38.0 38.0 38.0 36.4 38.0 65-69 37.21595000000001 38.0 38.0 38.0 36.2 38.0 70-74 37.1349 38.0 38.0 38.0 36.0 38.0 75-79 37.025150000000004 38.0 38.0 38.0 36.0 38.0 80-84 36.98765 38.0 38.0 38.0 35.6 38.0 85-89 36.89765 38.0 38.0 38.0 35.0 38.0 90-94 36.86665 38.0 38.0 38.0 35.2 38.0 95-99 36.698299999999996 38.0 38.0 38.0 34.6 38.0 100-104 36.4653 38.0 37.4 38.0 34.0 38.0 105-109 36.3018 38.0 37.0 38.0 33.4 38.0 110-114 36.25195 38.0 37.0 38.0 33.8 38.0 115-119 36.062650000000005 38.0 37.0 38.0 32.8 38.0 120-124 35.8005 38.0 36.2 38.0 31.4 38.0 125-129 35.5516 38.0 36.0 38.0 31.0 38.0 130-134 35.20725 38.0 35.4 38.0 30.0 38.0 135-139 34.79934999999999 38.0 34.2 38.0 28.4 38.0 140-144 34.13095 38.0 33.0 38.0 25.2 38.0 145-149 32.9979 38.0 33.0 38.0 19.8 38.0 150-151 27.048125 33.5 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 2.0 18 2.0 19 3.0 20 4.0 21 2.0 22 3.0 23 3.0 24 5.0 25 4.0 26 9.0 27 12.0 28 21.0 29 21.0 30 31.0 31 48.0 32 84.0 33 111.0 34 219.0 35 468.0 36 1388.0 37 1557.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 20.965230928905036 35.00259470679813 8.406850025947069 35.62532433834977 2 25.775 14.924999999999999 32.625 26.674999999999997 3 23.775 19.6 26.424999999999997 30.2 4 23.625 28.025 22.325 26.025 5 23.075000000000003 32.800000000000004 23.575 20.549999999999997 6 20.150000000000002 36.225 23.175 20.45 7 13.925 27.400000000000002 41.5 17.175 8 17.45 27.575 30.8 24.175 9 17.45 24.625 34.475 23.45 10-14 19.665 30.025000000000002 27.185 23.125 15-19 19.705000000000002 28.505000000000003 28.139999999999997 23.65 20-24 19.775000000000002 28.675 27.48 24.07 25-29 20.095 28.849999999999998 27.37 23.685000000000002 30-34 20.095 29.15 27.065 23.69 35-39 19.96 28.615000000000002 27.279999999999998 24.145 40-44 20.255000000000003 29.044999999999998 27.605 23.095 45-49 20.555 28.82 27.07 23.555 50-54 20.14 29.03 27.3 23.53 55-59 20.255000000000003 28.89 27.029999999999998 23.825 60-64 20.77 28.515 27.175 23.54 65-69 20.275000000000002 28.89 26.755000000000003 24.08 70-74 20.21 28.77 27.284999999999997 23.735 75-79 20.375 28.215 27.495000000000005 23.915 80-84 20.325 28.79 27.625 23.26 85-89 20.175 28.15 27.715 23.96 90-94 20.765 28.42 26.840000000000003 23.974999999999998 95-99 20.66 28.12 27.175 24.044999999999998 100-104 20.0 29.095 27.125 23.78 105-109 20.375 27.839999999999996 27.43 24.355 110-114 21.425 27.955000000000002 27.22 23.400000000000002 115-119 21.345 27.775 27.73 23.150000000000002 120-124 20.39 28.249999999999996 26.979999999999997 24.38 125-129 20.51 28.144999999999996 27.07 24.275 130-134 20.915 27.939999999999998 27.025 24.12 135-139 21.445 27.905 26.665 23.985 140-144 20.615 27.505000000000003 27.439999999999998 24.44 145-149 20.674999999999997 27.400000000000002 27.46 24.465 150-151 20.6875 27.3625 27.737499999999997 24.212500000000002 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.0 22 0.0 23 1.0 24 1.5 25 2.5 26 5.5 27 7.5 28 9.0 29 15.0 30 19.5 31 25.5 32 32.0 33 46.0 34 69.0 35 78.5 36 84.0 37 104.5 38 129.5 39 160.5 40 186.0 41 218.5 42 246.0 43 256.0 44 261.5 45 274.0 46 270.0 47 245.0 48 227.5 49 190.5 50 166.0 51 148.0 52 124.5 53 105.0 54 78.0 55 61.5 56 45.5 57 30.0 58 20.0 59 10.0 60 10.5 61 10.5 62 9.0 63 5.0 64 1.0 65 1.0 66 2.5 67 2.5 68 1.0 69 0.5 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.65 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.3 #Duplication Level Percentage of deduplicated Percentage of total 1 99.37059415911381 98.675 2 0.5538771399798591 1.0999999999999999 3 0.0755287009063444 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2875 0.0 0.0 0.0 0.0 84-85 0.32499999999999996 0.0 0.0 0.0 0.0 86-87 0.4125 0.0 0.0 0.0 0.0 88-89 0.45 0.0 0.0 0.0 0.0 90-91 0.6 0.0 0.0 0.0 0.0 92-93 0.65 0.0 0.0 0.0 0.0 94-95 0.7375 0.0 0.0 0.0 0.0 96-97 0.8 0.0 0.0 0.0 0.0 98-99 0.9375 0.0 0.0 0.0 0.0 100-101 1.1625 0.0 0.0 0.0 0.0 102-103 1.3375 0.0 0.0 0.0 0.0 104-105 1.5625 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1625 0.0 0.0 0.0 0.0 110-111 2.4125 0.0 0.0 0.0 0.0 112-113 2.7 0.0 0.0 0.0 0.0 114-115 3.1125 0.0 0.0 0.0 0.0 116-117 3.4625 0.0 0.0 0.0 0.0 118-119 3.6375 0.0 0.0 0.0 0.0 120-121 3.8499999999999996 0.0 0.0 0.0 0.0 122-123 4.1875 0.0 0.0 0.0 0.0 124-125 4.525 0.0 0.0 0.0 0.0 126-127 4.85 0.0 0.0 0.0 0.0 128-129 5.225 0.0 0.0 0.0 0.0 130-131 5.5375 0.0 0.0 0.0 0.0 132-133 5.762499999999999 0.0 0.0 0.0 0.0 134-135 6.175000000000001 0.0 0.0 0.0 0.0 136-137 6.4875 0.0 0.0 0.0 0.0 138-139 6.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAGAA 10 0.0068343505 144.975 4 >>END_MODULE SRR7170489 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170489_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.83575 33.0 33.0 34.0 32.0 34.0 2 32.95125 34.0 33.0 34.0 32.0 34.0 3 33.02925 34.0 33.0 34.0 32.0 34.0 4 32.9605 34.0 33.0 34.0 32.0 34.0 5 32.975 34.0 33.0 34.0 32.0 34.0 6 37.18375 38.0 38.0 38.0 37.0 38.0 7 37.20525 38.0 38.0 38.0 37.0 38.0 8 37.22525 38.0 38.0 38.0 37.0 38.0 9 37.1775 38.0 38.0 38.0 37.0 38.0 10-14 37.16695 38.0 38.0 38.0 37.0 38.0 15-19 37.1577 38.0 38.0 38.0 37.0 38.0 20-24 37.152249999999995 38.0 38.0 38.0 37.0 38.0 25-29 37.081300000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.0214 38.0 38.0 38.0 37.0 38.0 35-39 37.0627 38.0 38.0 38.0 37.0 38.0 40-44 37.036699999999996 38.0 38.0 38.0 36.8 38.0 45-49 37.087599999999995 38.0 38.0 38.0 37.0 38.0 50-54 37.0553 38.0 38.0 38.0 37.0 38.0 55-59 36.97485 38.0 38.0 38.0 36.0 38.0 60-64 36.94345 38.0 38.0 38.0 36.0 38.0 65-69 36.895849999999996 38.0 38.0 38.0 36.0 38.0 70-74 36.81655 38.0 38.0 38.0 35.8 38.0 75-79 36.745050000000006 38.0 38.0 38.0 35.8 38.0 80-84 36.67285 38.0 38.0 38.0 35.4 38.0 85-89 36.597950000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.4399 38.0 38.0 38.0 34.4 38.0 95-99 36.37665 38.0 38.0 38.0 34.0 38.0 100-104 36.219699999999996 38.0 37.8 38.0 33.8 38.0 105-109 36.19845 38.0 37.8 38.0 33.8 38.0 110-114 35.8949 38.0 37.4 38.0 33.2 38.0 115-119 35.78535 38.0 37.0 38.0 32.0 38.0 120-124 35.402049999999996 38.0 36.6 38.0 30.2 38.0 125-129 35.056 38.0 36.0 38.0 29.6 38.0 130-134 34.4126 38.0 34.4 38.0 26.2 38.0 135-139 33.71065 38.0 33.0 38.0 22.0 38.0 140-144 33.1881 38.0 33.0 38.0 20.2 38.0 145-149 32.2087 38.0 33.0 38.0 11.0 38.0 150-151 26.2025 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 4.0 4 3.0 5 3.0 6 1.0 7 1.0 8 1.0 9 1.0 10 1.0 11 1.0 12 2.0 13 0.0 14 2.0 15 6.0 16 1.0 17 6.0 18 7.0 19 2.0 20 5.0 21 7.0 22 6.0 23 10.0 24 12.0 25 14.0 26 22.0 27 20.0 28 22.0 29 27.0 30 42.0 31 61.0 32 68.0 33 106.0 34 160.0 35 305.0 36 800.0 37 2262.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.459114778694676 21.780445111277817 14.17854463615904 27.581895473868467 2 27.406851712928233 26.481620405101275 29.057264316079017 17.05426356589147 3 21.955488872218055 28.207051762940733 31.357839459864966 18.479619904976243 4 22.88072018004501 35.033758439609905 23.655913978494624 18.42960740185046 5 24.23105776444111 36.384096024006 22.780695173793447 16.60415103775944 6 21.5 37.875 22.85 17.775 7 20.825 21.2 38.125 19.85 8 22.650000000000002 26.75 26.575 24.025 9 23.200000000000003 25.35 27.925 23.525 10-14 23.064999999999998 29.315 26.284999999999997 21.335 15-19 23.546177308865442 28.16140807040352 27.646382319115958 20.64603230161508 20-24 23.61090272568142 28.267066766691674 27.28182045511378 20.84021005251313 25-29 23.63090772693173 28.00700175043761 27.291822955738937 21.070267566891722 30-34 23.005751437859466 28.712178044511127 27.54688672168042 20.735183795948984 35-39 23.07576894223556 27.826956739184794 27.266816704176044 21.8304576144036 40-44 23.330832708177045 28.292073018254566 27.701925481370342 20.675168792198047 45-49 23.280820205051263 28.417104276069015 26.541635408852216 21.760440110027506 50-54 23.250812703175793 27.561890472618156 27.796949237309327 21.390347586896723 55-59 23.305826456614152 27.131782945736433 27.871967991997998 21.690422605651413 60-64 23.59089772443111 27.556889222305575 27.551887971993 21.30032508127032 65-69 23.725931482870717 27.656914228557138 27.206801700425103 21.410352588147035 70-74 23.875968992248062 27.746936734183546 27.066766691672917 21.310327581895475 75-79 23.797139141742523 27.368210463138944 27.6332899869961 21.201360408122436 80-84 23.785946486621658 27.54688672168042 27.306826706676667 21.360340085021257 85-89 23.737121136340903 27.678303491047313 27.25817745323597 21.326397919375815 90-94 23.710927731932983 27.981995498874717 27.406851712928233 20.900225056264066 95-99 24.68617154288572 27.871967991997998 26.966741685421354 20.475118779694924 100-104 23.640910227556887 27.29682420605151 28.182045511377847 20.880220055013755 105-109 24.006001500375092 27.056764191047762 27.751937984496124 21.185296324081023 110-114 24.07101775443861 27.79194798699675 27.286821705426355 20.850212553138284 115-119 24.321080270067515 27.2768192048012 27.861965491372843 20.54013503375844 120-124 24.028409943480217 27.364577602160757 27.61466513279648 20.992347321562548 125-129 24.59483793517407 26.91576630652261 27.696078431372552 20.793317326930772 130-134 24.752376188094047 27.71885942971486 27.04352176088044 20.485242621310658 135-139 25.20634285428443 27.082186984142865 27.42234005302386 20.289130108548846 140-144 24.420989445250363 27.547396328347755 27.527387324295933 20.50422690210595 145-149 25.19007603041217 27.275910364145656 27.275910364145656 20.258103241296517 150-151 24.546705014380393 26.634988120545206 27.83543828935851 20.982868575715894 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.5 21 0.5 22 0.0 23 0.5 24 0.5 25 1.0 26 2.5 27 3.5 28 5.0 29 7.0 30 13.5 31 19.5 32 21.0 33 24.5 34 36.5 35 49.0 36 73.0 37 103.5 38 124.5 39 157.5 40 189.0 41 213.5 42 239.0 43 256.5 44 262.0 45 275.0 46 283.5 47 263.0 48 241.5 49 224.0 50 190.5 51 140.5 52 118.5 53 111.5 54 91.0 55 71.0 56 53.0 57 40.0 58 31.5 59 20.5 60 10.5 61 7.0 62 5.0 63 6.0 64 3.5 65 1.5 66 1.0 67 0.5 68 0.5 69 1.0 70 1.0 71 0.5 72 0.5 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.025 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.005 20-24 0.025 25-29 0.025 30-34 0.025 35-39 0.025 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.025 60-64 0.025 65-69 0.025 70-74 0.025 75-79 0.03 80-84 0.025 85-89 0.03 90-94 0.025 95-99 0.025 100-104 0.025 105-109 0.025 110-114 0.025 115-119 0.025 120-124 0.034999999999999996 125-129 0.04 130-134 0.05 135-139 0.045 140-144 0.045 145-149 0.04 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.15 #Duplication Level Percentage of deduplicated Percentage of total 1 99.31921331316188 98.475 2 0.5799293998991427 1.15 3 0.05042864346949068 0.15 4 0.02521432173474534 0.1 5 0.02521432173474534 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.037500000000000006 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.0875 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.16249999999999998 0.0 0.0 0.0 0.0 78-79 0.2 0.0 0.0 0.0 0.0 80-81 0.2 0.0 0.0 0.0 0.0 82-83 0.2625 0.0 0.0 0.0 0.0 84-85 0.30000000000000004 0.0 0.0 0.0 0.0 86-87 0.3875 0.0 0.0 0.0 0.0 88-89 0.425 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.625 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.75 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.2875 0.0 0.0 0.0 0.0 104-105 1.5125000000000002 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.1125 0.0 0.0 0.0 0.0 110-111 2.375 0.0 0.0 0.0 0.0 112-113 2.675 0.0 0.0 0.0 0.0 114-115 3.075 0.0 0.0 0.0 0.0 116-117 3.3875 0.0 0.0 0.0 0.0 118-119 3.5625 0.0 0.0 0.0 0.0 120-121 3.7750000000000004 0.0 0.0 0.0 0.0 122-123 4.1 0.0 0.0 0.0 0.0 124-125 4.425000000000001 0.0 0.0 0.0 0.0 126-127 4.75 0.0 0.0 0.0 0.0 128-129 5.1 0.0 0.0 0.0 0.0 130-131 5.4125 0.0 0.0 0.0 0.0 132-133 5.637499999999999 0.0 0.0 0.0 0.0 134-135 6.050000000000001 0.0 0.0 0.0 0.0 136-137 6.3375 0.0 0.0 0.0 0.0 138-139 6.6875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TCGATTT 10 0.006830828 145.0 145 >>END_MODULE Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720963 spots for SRR7170489.sra Written 720963 spots for SRR7170489.sra Read 720976 spots for SRR7170489.sra Written 720976 spots for SRR7170489.sra SRR ids: ['SRR7170489.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_nrw11yfb SRR7170489.sra spots: 14419273 blocks: [[1, 720963], [720964, 1441926], [1441927, 2162889], [2162890, 2883852], [2883853, 3604815], [3604816, 4325778], [4325779, 5046741], [5046742, 5767704], [5767705, 6488667], [6488668, 7209630], [7209631, 7930593], [7930594, 8651556], [8651557, 9372519], [9372520, 10093482], [10093483, 10814445], [10814446, 11535408], [11535409, 12256371], [12256372, 12977334], [12977335, 13698297], [13698298, 14419273]] SRR7170489 file size 4864518 SRR7170489 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170489 SRR7170489_1.fastq SRR7170489_2.fastq Input file: SRR7170489_1.fastq Paired file: SRR7170489_2.fastq trimmed: SRR7170489-trimmed-pair1.fastq, SRR7170489-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:54:13 2025 >> started Thu Feb 13 01:00:00 2025 >> done (347.843s) 14419273 read pairs processed; of these: 16394 ( 0.11%) short read pairs filtered out after trimming by size control 27369 ( 0.19%) empty read pairs filtered out after trimming by size control 14375510 (99.70%) read pairs available; of these: 8932674 (62.14%) trimmed read pairs available after processing 5442836 (37.86%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 3 0.00% 20 5 0.00% 21 1 0.00% 22 2 0.00% 23 5 0.00% 24 3 0.00% 25 6 0.00% 26 3 0.00% 27 2 0.00% 28 5 0.00% 29 12 0.00% 30 10 0.00% 31 10 0.00% 32 8 0.00% 33 18 0.00% 34 15 0.00% 35 15 0.00% 36 16 0.00% 37 15 0.00% 38 30 0.00% 39 30 0.00% 40 42 0.00% 41 37 0.00% 42 45 0.00% 43 45 0.00% 44 49 0.00% 45 61 0.00% 46 66 0.00% 47 79 0.00% 48 85 0.00% 49 77 0.00% 50 125 0.00% 51 145 0.00% 52 188 0.00% 53 186 0.00% 54 192 0.00% 55 222 0.00% 56 237 0.00% 57 280 0.00% 58 312 0.00% 59 349 0.00% 60 448 0.00% 61 493 0.00% 62 545 0.00% 63 625 0.00% 64 703 0.00% 65 750 0.01% 66 773 0.01% 67 877 0.01% 68 990 0.01% 69 1108 0.01% 70 1264 0.01% 71 1457 0.01% 72 1791 0.01% 73 1912 0.01% 74 2150 0.01% 75 2368 0.02% 76 2616 0.02% 77 2927 0.02% 78 3012 0.02% 79 3320 0.02% 80 3585 0.02% 81 4303 0.03% 82 4733 0.03% 83 5388 0.04% 84 6669 0.05% 85 6973 0.05% 86 7227 0.05% 87 7754 0.05% 88 7891 0.05% 89 7813 0.05% 90 8488 0.06% 91 9230 0.06% 92 10009 0.07% 93 10654 0.07% 94 11604 0.08% 95 12090 0.08% 96 12683 0.09% 97 12981 0.09% 98 13218 0.09% 99 13705 0.10% 100 14555 0.10% 101 14628 0.10% 102 16080 0.11% 103 16583 0.12% 104 17550 0.12% 105 18284 0.13% 106 19146 0.13% 107 19460 0.14% 108 19481 0.14% 109 20277 0.14% 110 20150 0.14% 111 20749 0.14% 112 21784 0.15% 113 22241 0.15% 114 23124 0.16% 115 24603 0.17% 116 24827 0.17% 117 25629 0.18% 118 26031 0.18% 119 26716 0.19% 120 27267 0.19% 121 28108 0.20% 122 29077 0.20% 123 30566 0.21% 124 32033 0.22% 125 33194 0.23% 126 34703 0.24% 127 36317 0.25% 128 37883 0.26% 129 39848 0.28% 130 41661 0.29% 131 43914 0.31% 132 47177 0.33% 133 50550 0.35% 134 53915 0.38% 135 57900 0.40% 136 62426 0.43% 137 67931 0.47% 138 73869 0.51% 139 81568 0.57% 140 89667 0.62% 141 102604 0.71% 142 117370 0.82% 143 136954 0.95% 144 166668 1.16% 145 206953 1.44% 146 275648 1.92% 147 396609 2.76% 148 617431 4.30% 149 1204129 8.38% 150 4086673 28.43% 151 5442836 37.86% 14375510 reads passed initial QC criterion=sequence-density sequence-density=0.42 sequence-density-rank=1 fanout-score=4.54 fanout-score-rank=19 prefix-density=0.56 prefix-fanout=3.4 sequence=TCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=fanout-score sequence-density=0.03 sequence-density-rank=36 fanout-score=83.94 fanout-score-rank=1 prefix-density=0.23 prefix-fanout=12.0 sequence=TGCTGCTGCTGCATTTATTAGAGAAGGAGATGCTGGTAATCTCCATTTCACAAGTTCATTAATCTCGATCGAAAATATGGCTCATTTAAGCATATACAAAGTACATCTGGGAAAGAAAGTTAAGAACCAAGATAGGGTCACTGATATTTGGATGATGTTCATACGGAGAGGGAGGGAGAAAGGCTGTACTCAAGCCCCCAGAGCTCAAAACTGCCTTTGACAAAATCATAATAACCACCCTTCAGTCCTAGAGTTTTGTTCACCAAGCCATCTCTCACAAACGGGTAGGTTAGCAAGTGTCCAAGGGACACGTTCACTGCCTCCTTTTCACATTGTGTACAGAGGTCTGGGAAAGGTGCATTGGCATGTTCTGCTAAAACCTTAGTCTTGGCAGGGTA criterion=sequence-density sequence-density=0.55 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=31 prefix-density=0.56 prefix-fanout=2.1 sequence=GCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGCTAACAATGACATTACTTCCATTGCAAGCAATGGCGGAAGAGTTCAATGCATGCAGGTGTGGCCTCCAACTGGATTGAAGAAGTTCGAGACTCTTTCTTACCTTCCAGATCTCACTACTGAGCAATTGGCCCAGGAAATTGAGTACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAAACTACCCATGTTTGGATGCACTGAGGCATCTCAGGTGCTGATTGAGCTCGAGGAGGCGAAGAAAGCTTACCCTAACTCCTTTATCCGTATCATTGGATTCGACAACACTCGTCAAGTGCAGTGCATCAGTTTTATCGCCTCCAAGCCGAAGGGTGTCTAGGTT criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=43.67 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.4 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGGCAGTGGCTGCAATGGATGCAGCATGTACCCAGACTTGAGTTTCTCCGAGACCACCACAAGTCAGACAATCATTGCTGGTGTAGCTCCAGTTAGGATGTTCTACGAGAGCTCTGAGATGAACTTTGGTGCTGAGAATGGCTGCAAATGTGGATCAAACTGCACCTGTGATCCATGCTCCTGCAAATGAGAAAACGTCGCCGCATGGCTCCAACCAAGCAGTTTTATGGAACTATAATAAATAAAAAGAAGAAGTCTGGTCACTCCATGTTTGTCTAATATAGTATTTGCTGTAAATTAAAGTACAGTTAGCTAGCCATGGCCTCCTCAAATCCTTTCTACAGGATCTCATTTGATGGCTAGTAATCTGTAAGTGTCTTGTATTTCCT SRR7170489 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:20:05 Started mapping on | Feb 13 01:20:05 Finished on | Feb 13 01:22:35 Mapping speed, Million of reads per hour | 345.01 Number of input reads | 14375510 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13396424 Uniquely mapped reads % | 93.19% Average mapped length | 292.01 Number of splices: Total | 12876297 Number of splices: Annotated (sjdb) | 12612330 Number of splices: GT/AG | 12612320 Number of splices: GC/AG | 219994 Number of splices: AT/AC | 7909 Number of splices: Non-canonical | 36074 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.02% Deletion average length | 2.52 Insertion rate per base | 0.02% Insertion average length | 2.12 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 442550 % of reads mapped to multiple loci | 3.08% Number of reads mapped to too many loci | 45936 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.32% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 547325 547325 547325 N_multimapping 442550 442550 442550 N_noFeature 352223 13194906 402995 N_ambiguous 261465 633 110518 UnstrandedReadsAssigned:12782736 PositiveStrandReadsAssigned:200885 NegativeStrandReadsAssigned:12882911 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=148 echo kmer=143 SRR7170489 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170489-trimmed-pair1.fastq SRR7170489-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,375,510 reads, 12,894,655 reads pseudoaligned [quant] estimated average fragment length: 258.456 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7170489.ke.tsv 34699 SRR7170489.se.tsv 87100 total ==> SRR7170489.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.54 569 21.9872 Potri.005G024800.1.v4.1 1035 777.544 297 25.9858 Potri.004G059700.1.v4.1 961 703.55 10 0.966963 Potri.007G009000.2.v4.1 1416 1158.54 0 0 Potri.003G141000.2.v4.1 2943 2685.54 444 11.2475 Potri.016G087400.1.v4.1 270 78.625 769 665.381 Potri.015G069301.1.v4.1 564 309.974 0 0 Potri.010G195200.1.v4.1 1773 1515.54 28 1.25688 Potri.012G127500.1.v4.1 977 719.55 195 18.4365 ==> SRR7170489.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 151 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 239 Potri.001G212900.v4.1 73 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 158 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 9 SRR7170489 completed mapping pipeline successfully