Starting /dee2/code/volunteer_pipeline.sh SRR7170490 current disk space = 2818739044352 free memory = 1463488832 SRR7170490 SRAfilesize 5fec73ffdd94b2b4d5fa5360f74464cb SRR7170490.sra SRR7170490.sra file validated SRR7170490 is paired end SRR7170490 is conventional basespace SRR7170490 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170490_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 45 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.54625 27.0 18.0 33.0 18.0 33.0 2 27.183 29.0 25.0 31.0 18.0 33.0 3 29.8405 31.0 29.0 33.0 25.0 33.0 4 31.5975 33.0 31.0 33.0 29.0 33.0 5 32.499 33.0 33.0 33.0 32.0 34.0 6 36.402 38.0 36.0 38.0 34.0 38.0 7 36.73225 38.0 37.0 38.0 34.0 38.0 8 37.15325 38.0 38.0 38.0 36.0 38.0 9 37.4455 38.0 38.0 38.0 37.0 38.0 10-14 37.5169 38.0 38.0 38.0 37.2 38.0 15-19 37.5056 38.0 38.0 38.0 37.6 38.0 20-24 37.5476 38.0 38.0 38.0 38.0 38.0 25-29 37.5649 38.0 38.0 38.0 38.0 38.0 30-34 37.53425 38.0 38.0 38.0 38.0 38.0 35-39 37.4894 38.0 38.0 38.0 37.6 38.0 40-44 37.4041 38.0 38.0 38.0 37.0 38.0 45-49 37.46935 38.0 38.0 38.0 37.0 38.0 50-54 37.327999999999996 38.0 38.0 38.0 37.0 38.0 55-59 37.2919 38.0 38.0 38.0 37.0 38.0 60-64 37.2247 38.0 38.0 38.0 36.0 38.0 65-69 37.1274 38.0 38.0 38.0 36.0 38.0 70-74 37.08515 38.0 38.0 38.0 36.0 38.0 75-79 36.65725 38.0 38.0 38.0 35.2 38.0 80-84 36.450450000000004 38.0 38.0 38.0 34.8 38.0 85-89 36.344800000000006 38.0 38.0 38.0 34.2 38.0 90-94 36.2783 38.0 38.0 38.0 34.0 38.0 95-99 36.14319999999999 38.0 38.0 38.0 34.0 38.0 100-104 35.882400000000004 38.0 37.4 38.0 33.0 38.0 105-109 35.8221 38.0 37.0 38.0 33.0 38.0 110-114 35.64685 38.0 37.0 38.0 32.0 38.0 115-119 35.4156 38.0 36.4 38.0 30.6 38.0 120-124 35.117450000000005 38.0 36.0 38.0 29.2 38.0 125-129 34.72985 38.0 35.0 38.0 27.8 38.0 130-134 34.3928 38.0 34.6 38.0 26.2 38.0 135-139 34.00505 38.0 33.0 38.0 24.4 38.0 140-144 33.2898 38.0 33.0 38.0 20.4 38.0 145-149 32.12455 38.0 32.6 38.0 11.4 38.0 150-151 26.72725 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 1.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 13.0 19 39.0 20 6.0 21 2.0 22 4.0 23 6.0 24 14.0 25 7.0 26 11.0 27 13.0 28 22.0 29 40.0 30 29.0 31 45.0 32 88.0 33 110.0 34 220.0 35 407.0 36 1140.0 37 1778.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 37.013319672131146 11.270491803278688 8.529713114754097 43.18647540983606 2 21.0 14.499999999999998 30.975 33.525 3 19.0 18.85 26.775 35.375 4 22.0 25.2 23.0 29.799999999999997 5 24.025 29.525000000000002 24.5 21.95 6 20.0 32.925 25.35 21.725 7 14.85 28.199999999999996 40.125 16.825000000000003 8 19.05 26.0 28.95 26.0 9 18.65 24.275 32.475 24.6 10-14 20.0 29.765000000000004 26.424999999999997 23.810000000000002 15-19 20.49 27.655 27.145000000000003 24.709999999999997 20-24 20.4 27.689999999999998 26.995 24.915000000000003 25-29 20.150000000000002 27.779999999999998 26.695 25.374999999999996 30-34 20.327032703270326 27.952795279527955 26.612661266126615 25.107510751075107 35-39 20.647064706470648 27.802780278027804 26.607660766076606 24.942494249424943 40-44 20.880000000000003 28.49 26.155 24.474999999999998 45-49 20.544999999999998 27.389999999999997 27.12 24.945 50-54 20.94 27.805000000000003 26.495 24.759999999999998 55-59 20.62 27.33 27.474999999999998 24.575 60-64 20.68 27.425 27.205000000000002 24.69 65-69 20.815 28.585 26.195 24.404999999999998 70-74 20.29 28.7 26.165 24.845 75-79 20.703105465819874 28.069210381557237 26.618992848927338 24.608691303695554 80-84 21.134226845369074 28.390678135627123 25.71014202840568 24.76495299059812 85-89 21.435000000000002 27.384999999999998 26.290000000000003 24.89 90-94 20.880000000000003 27.625 26.51 24.985 95-99 20.705000000000002 27.33 27.205000000000002 24.759999999999998 100-104 20.93 27.91 26.384999999999998 24.775 105-109 21.335 27.534999999999997 26.555 24.575 110-114 21.385 28.035 26.450000000000003 24.13 115-119 21.875 27.584999999999997 25.905 24.635 120-124 20.995 28.000000000000004 26.479999999999997 24.525 125-129 21.37 27.93 26.02 24.68 130-134 22.13 27.71 25.679999999999996 24.48 135-139 21.485000000000003 27.555000000000003 26.46 24.5 140-144 21.92 27.555000000000003 25.540000000000003 24.985 145-149 21.475 27.505000000000003 26.1 24.92 150-151 21.4875 28.262500000000003 25.775 24.474999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 1.0 21 1.5 22 1.5 23 3.0 24 3.5 25 2.5 26 3.0 27 3.0 28 7.5 29 10.0 30 10.5 31 18.0 32 24.5 33 31.5 34 44.5 35 63.0 36 78.5 37 92.5 38 118.0 39 133.0 40 149.0 41 177.0 42 200.0 43 222.5 44 228.5 45 228.0 46 234.5 47 232.0 48 228.5 49 216.5 50 188.5 51 165.5 52 143.5 53 132.0 54 119.5 55 96.0 56 86.5 57 76.0 58 51.0 59 34.0 60 34.0 61 27.0 62 18.5 63 14.0 64 8.0 65 6.5 66 4.5 67 5.5 68 5.5 69 3.0 70 2.5 71 2.0 72 1.0 73 3.5 74 4.0 75 1.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.01 35-39 0.01 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.015 80-84 0.02 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.45 #Duplication Level Percentage of deduplicated Percentage of total 1 98.13374805598755 94.65 2 1.503369621565578 2.9000000000000004 3 0.20736132711249353 0.6 4 0.07776049766718507 0.3 5 0.02592016588906169 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02592016588906169 0.22499999999999998 >10 0.02592016588906169 1.2 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCACACGTCTGAACTCCAGTCACTCCGGAGAATCTCGTAT 48 1.2 TruSeq Adapter, Index 6 (97% over 36bp) CTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAAC 9 0.22499999999999998 No Hit GCCCGATTCAGCATCCGAATCCAGAAGCTAAAAACAAAAACAAAGTAGAA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4875 0.0 0.0 0.0 0.0 84-85 0.5375000000000001 0.0 0.0 0.0 0.0 86-87 0.5874999999999999 0.0 0.0 0.0 0.0 88-89 0.675 0.0 0.0 0.0 0.0 90-91 0.85 0.0 0.0 0.0 0.0 92-93 0.9874999999999999 0.0 0.0 0.0 0.0 94-95 1.1375000000000002 0.0 0.0 0.0 0.0 96-97 1.35 0.0 0.0 0.0 0.0 98-99 1.5 0.0 0.0 0.0 0.0 100-101 1.7625 0.0 0.0 0.0 0.0 102-103 1.875 0.0 0.0 0.0 0.0 104-105 2.0375 0.0 0.0 0.0 0.0 106-107 2.2249999999999996 0.0 0.0 0.0 0.0 108-109 2.45 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.95 0.0 0.0 0.0 0.0 114-115 3.1875 0.0 0.0 0.0 0.0 116-117 3.45 0.0 0.0 0.0 0.0 118-119 3.6875 0.0 0.0 0.0 0.0 120-121 3.9125 0.0 0.0 0.0 0.0 122-123 4.1625 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.7125 0.0 0.0 0.0 0.0 128-129 5.025 0.0 0.0 0.0 0.0 130-131 5.387499999999999 0.0 0.0 0.0 0.0 132-133 5.6125 0.0 0.0 0.0 0.0 134-135 5.8875 0.0 0.0 0.0 0.0 136-137 6.275 0.0 0.0 0.0 0.0 138-139 6.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GTAGTGC 10 0.006836113 144.9625 145 >>END_MODULE SRR7170490 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170490_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 46 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.73925 33.0 33.0 34.0 32.0 34.0 2 32.85575 33.0 33.0 34.0 32.0 34.0 3 32.927 34.0 33.0 34.0 32.0 34.0 4 32.80275 34.0 33.0 34.0 32.0 34.0 5 32.81225 34.0 33.0 34.0 32.0 34.0 6 37.05925 38.0 38.0 38.0 36.0 38.0 7 37.01175 38.0 38.0 38.0 36.0 38.0 8 37.02375 38.0 38.0 38.0 37.0 38.0 9 37.0045 38.0 38.0 38.0 37.0 38.0 10-14 37.09505 38.0 38.0 38.0 36.8 38.0 15-19 37.0069 38.0 38.0 38.0 36.6 38.0 20-24 36.98605 38.0 38.0 38.0 36.6 38.0 25-29 36.93685 38.0 38.0 38.0 36.0 38.0 30-34 36.89305 38.0 38.0 38.0 36.2 38.0 35-39 36.8627 38.0 38.0 38.0 36.0 38.0 40-44 36.90015 38.0 38.0 38.0 36.0 38.0 45-49 36.7479 38.0 38.0 38.0 36.0 38.0 50-54 36.76395 38.0 38.0 38.0 36.0 38.0 55-59 36.63680000000001 38.0 38.0 38.0 35.8 38.0 60-64 36.5299 38.0 38.0 38.0 35.0 38.0 65-69 36.5318 38.0 38.0 38.0 35.0 38.0 70-74 36.527100000000004 38.0 38.0 38.0 35.0 38.0 75-79 36.34955 38.0 38.0 38.0 34.2 38.0 80-84 35.9926 38.0 38.0 38.0 34.0 38.0 85-89 35.920849999999994 38.0 38.0 38.0 33.8 38.0 90-94 35.68575 38.0 38.0 38.0 33.0 38.0 95-99 35.66245 38.0 37.8 38.0 33.0 38.0 100-104 35.3798 38.0 37.0 38.0 31.4 38.0 105-109 35.351600000000005 38.0 37.0 38.0 31.0 38.0 110-114 35.15625 38.0 36.6 38.0 30.0 38.0 115-119 34.9974 38.0 36.0 38.0 28.6 38.0 120-124 34.5961 38.0 35.8 38.0 27.0 38.0 125-129 34.15605 38.0 34.4 38.0 24.6 38.0 130-134 33.49085 38.0 33.0 38.0 20.8 38.0 135-139 32.809400000000004 38.0 33.0 38.0 15.2 38.0 140-144 32.010450000000006 38.0 32.6 38.0 13.0 38.0 145-149 31.05235 37.8 30.8 38.0 5.8 38.0 150-151 25.208750000000002 33.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 13.0 3 1.0 4 6.0 5 1.0 6 4.0 7 3.0 8 3.0 9 1.0 10 3.0 11 3.0 12 5.0 13 5.0 14 1.0 15 6.0 16 6.0 17 7.0 18 14.0 19 18.0 20 20.0 21 13.0 22 12.0 23 15.0 24 11.0 25 16.0 26 23.0 27 29.0 28 29.0 29 34.0 30 47.0 31 60.0 32 74.0 33 116.0 34 183.0 35 316.0 36 856.0 37 2046.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.20430645968953 20.15523284927391 14.897346019028543 28.743114672008012 2 26.514772158237353 26.164246369554334 28.367551326990487 18.953430145217826 3 19.203805708562843 27.1407110665999 32.49874812218327 21.156735102653982 4 23.360040060090135 32.8743114672008 23.25988983475213 20.505758637956937 5 26.22745490981964 34.81963927855711 21.46793587174349 17.48496993987976 6 21.710855427713856 36.21810905452726 23.536768384192097 18.534267133566786 7 20.410205102551277 22.136068034017008 36.343171585792895 21.11055527763882 8 20.83541770885443 27.33866933466733 26.313156578289142 25.512756378189096 9 22.786393196598297 24.412206103051524 29.664832416208103 23.13656828414207 10-14 24.07583412535641 28.077634935721075 25.836626481916863 22.009904457005653 15-19 23.546482537776445 27.154007805463827 27.46422495747023 21.835284699289502 20-24 23.6986986986987 27.902902902902905 26.78178178178178 21.616616616616614 25-29 23.713198477869017 28.12938113358702 26.627278189465255 21.53014219907871 30-34 23.59775641025641 27.223557692307693 27.423878205128204 21.754807692307693 35-39 23.4872770987778 27.3893007413344 27.55960729312763 21.56381486676017 40-44 24.191286930395595 27.275913870806207 27.255883825738607 21.27691537305959 45-49 23.45814977973568 27.50800961153384 27.162595114136966 21.87124549459351 50-54 24.559471365638768 26.576892270724873 27.09751702042451 21.766119343211855 55-59 23.947539670621214 27.151223907493616 26.885918806627622 22.015317615257544 60-64 24.445556946182727 26.753441802252816 26.433041301627036 22.367959949937422 65-69 23.865344153892394 26.104598737601442 27.67758741609057 22.35246969241559 70-74 23.99639152007217 27.504635894351726 26.602515912394125 21.896456673181977 75-79 23.953686532003406 28.41461580873139 26.324495012781313 21.307202646483887 80-84 24.09541946476897 27.723764658715044 25.934649694296887 22.246166182219103 85-89 24.7105408250213 26.96105458373014 26.60518269760914 21.723221893639415 90-94 24.318500701543396 27.174784525957108 26.63359390659451 21.87312086590499 95-99 24.341248371906623 27.447149584210003 26.525398256687705 21.68620378719567 100-104 25.186557820403664 26.69905343817299 26.423598938248112 21.69078980317524 105-109 24.509214743589745 26.47235576923077 26.7578125 22.26061698717949 110-114 25.30929125970448 27.1274730778863 26.651640370648632 20.91159529176058 115-119 25.1240166357669 27.39890765145062 26.216365185148067 21.260710527634412 120-124 24.977443609022558 27.31829573934837 26.30576441102757 21.398496240601503 125-129 25.287010578031783 27.41765679049481 26.25958790795608 21.035744723517322 130-134 25.535221860115314 26.949110052644777 26.161945349711708 21.3537227375282 135-139 25.93502456632909 26.81740699889702 26.341121026772285 20.906447408001604 140-144 25.352183285707124 27.22715195267459 26.796009424976187 20.6246553366421 145-149 25.59526793322974 27.11414105970224 26.81337410396511 20.477216903102914 150-151 26.418639609169485 27.59614180132782 25.767255417762748 20.217963171739946 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 1.0 1 1.0 2 0.5 3 0.0 4 1.0 5 1.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.5 16 1.5 17 1.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.0 24 1.5 25 3.0 26 4.5 27 4.0 28 3.5 29 4.5 30 9.5 31 19.0 32 23.5 33 22.5 34 28.0 35 44.5 36 69.5 37 93.5 38 102.5 39 128.5 40 155.0 41 188.5 42 234.5 43 254.0 44 253.5 45 248.0 46 248.0 47 237.0 48 222.5 49 208.5 50 180.5 51 144.5 52 133.0 53 125.5 54 117.5 55 106.5 56 75.5 57 59.5 58 47.5 59 43.0 60 47.0 61 33.0 62 18.5 63 11.5 64 7.0 65 4.5 66 4.0 67 5.0 68 2.5 69 0.5 70 2.0 71 1.5 72 0.5 73 0.5 74 1.0 75 1.5 76 1.0 77 1.0 78 1.0 79 0.5 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.15 2 0.15 3 0.15 4 0.15 5 0.2 6 0.05 7 0.05 8 0.05 9 0.05 10-14 0.045 15-19 0.06999999999999999 20-24 0.1 25-29 0.13999999999999999 30-34 0.16 35-39 0.18 40-44 0.15 45-49 0.12 50-54 0.12 55-59 0.11499999999999999 60-64 0.125 65-69 0.19 70-74 0.23500000000000001 75-79 0.245 80-84 0.22999999999999998 85-89 0.245 90-94 0.22 95-99 0.19 100-104 0.165 105-109 0.16 110-114 0.17500000000000002 115-119 0.215 120-124 0.25 125-129 0.265 130-134 0.27499999999999997 135-139 0.27 140-144 0.265 145-149 0.255 150-151 0.21250000000000002 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 96.6 #Duplication Level Percentage of deduplicated Percentage of total 1 98.4472049689441 95.1 2 0.9834368530020704 1.9 3 0.38819875776397517 1.125 4 0.10351966873706005 0.4 5 0.051759834368530024 0.25 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.025879917184265012 1.225 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences fail #Sequence Count Percentage Possible Source GATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGGATAGGGTGTAGATCT 49 1.225 Illumina Single End PCR Primer 1 (97% over 34bp) GGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCA 5 0.125 No Hit ACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.05 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.075 0.0 0.0 0.0 0.0 68-69 0.1 0.0 0.0 0.0 0.0 70-71 0.1125 0.0 0.0 0.0 0.0 72-73 0.1375 0.0 0.0 0.0 0.0 74-75 0.2625 0.0 0.0 0.0 0.0 76-77 0.32499999999999996 0.0 0.0 0.0 0.0 78-79 0.375 0.0 0.0 0.0 0.0 80-81 0.4125 0.0 0.0 0.0 0.0 82-83 0.4625 0.0 0.0 0.0 0.0 84-85 0.5125 0.0 0.0 0.0 0.0 86-87 0.5625 0.0 0.0 0.0 0.0 88-89 0.65 0.0 0.0 0.0 0.0 90-91 0.825 0.0 0.0 0.0 0.0 92-93 0.9625 0.0 0.0 0.0 0.0 94-95 1.1124999999999998 0.0 0.0 0.0 0.0 96-97 1.325 0.0 0.0 0.0 0.0 98-99 1.475 0.0 0.0 0.0 0.0 100-101 1.7375 0.0 0.0 0.0 0.0 102-103 1.85 0.0 0.0 0.0 0.0 104-105 2.0 0.0 0.0 0.0 0.0 106-107 2.1875 0.0 0.0 0.0 0.0 108-109 2.425 0.0 0.0 0.0 0.0 110-111 2.6625 0.0 0.0 0.0 0.0 112-113 2.9625 0.0 0.0 0.0 0.0 114-115 3.2375 0.0 0.0 0.0 0.0 116-117 3.5125 0.0 0.0 0.0 0.0 118-119 3.7750000000000004 0.0 0.0 0.0 0.0 120-121 4.0125 0.0 0.0 0.0 0.0 122-123 4.2625 0.0 0.0 0.0 0.0 124-125 4.5125 0.0 0.0 0.0 0.0 126-127 4.8375 0.0 0.0 0.0 0.0 128-129 5.1625 0.0 0.0 0.0 0.0 130-131 5.525 0.0 0.0 0.0 0.0 132-133 5.7625 0.0 0.0 0.0 0.0 134-135 6.05 0.0 0.0 0.0 0.0 136-137 6.425000000000001 0.0 0.0 0.0 0.0 138-139 6.7875 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra Read 396047 spots for SRR7170490.sra Written 396047 spots for SRR7170490.sra Read 396041 spots for SRR7170490.sra Written 396041 spots for SRR7170490.sra SRR ids: ['SRR7170490.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_p8lmsfte SRR7170490.sra spots: 7920826 blocks: [[1, 396041], [396042, 792082], [792083, 1188123], [1188124, 1584164], [1584165, 1980205], [1980206, 2376246], [2376247, 2772287], [2772288, 3168328], [3168329, 3564369], [3564370, 3960410], [3960411, 4356451], [4356452, 4752492], [4752493, 5148533], [5148534, 5544574], [5544575, 5940615], [5940616, 6336656], [6336657, 6732697], [6732698, 7128738], [7128739, 7524779], [7524780, 7920826]] SRR7170490 file size 2666468 SRR7170490 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170490 SRR7170490_1.fastq SRR7170490_2.fastq Input file: SRR7170490_1.fastq Paired file: SRR7170490_2.fastq trimmed: SRR7170490-trimmed-pair1.fastq, SRR7170490-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Apr 10 15:58:57 2025 >> started Thu Apr 10 15:59:05 2025 >> done (8.313s) 7920826 read pairs processed; of these: 17856 ( 0.23%) short read pairs filtered out after trimming by size control 119557 ( 1.51%) empty read pairs filtered out after trimming by size control 7783413 (98.27%) read pairs available; of these: 4924017 (63.26%) trimmed read pairs available after processing 2859396 (36.74%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 4 0.00% 21 3 0.00% 22 6 0.00% 23 5 0.00% 24 8 0.00% 25 2 0.00% 26 3 0.00% 27 8 0.00% 28 9 0.00% 29 5 0.00% 30 6 0.00% 31 19 0.00% 32 9 0.00% 33 16 0.00% 34 18 0.00% 35 33 0.00% 36 18 0.00% 37 25 0.00% 38 24 0.00% 39 37 0.00% 40 32 0.00% 41 42 0.00% 42 41 0.00% 43 42 0.00% 44 61 0.00% 45 63 0.00% 46 88 0.00% 47 93 0.00% 48 101 0.00% 49 133 0.00% 50 144 0.00% 51 154 0.00% 52 144 0.00% 53 157 0.00% 54 161 0.00% 55 182 0.00% 56 234 0.00% 57 254 0.00% 58 285 0.00% 59 316 0.00% 60 353 0.00% 61 417 0.01% 62 474 0.01% 63 493 0.01% 64 585 0.01% 65 588 0.01% 66 637 0.01% 67 683 0.01% 68 806 0.01% 69 852 0.01% 70 981 0.01% 71 1084 0.01% 72 1252 0.02% 73 1453 0.02% 74 1539 0.02% 75 1733 0.02% 76 1961 0.03% 77 2298 0.03% 78 2198 0.03% 79 2338 0.03% 80 2537 0.03% 81 2874 0.04% 82 3193 0.04% 83 3684 0.05% 84 4753 0.06% 85 5043 0.06% 86 5021 0.06% 87 5429 0.07% 88 5554 0.07% 89 5724 0.07% 90 5819 0.07% 91 6177 0.08% 92 6409 0.08% 93 7035 0.09% 94 7335 0.09% 95 7999 0.10% 96 8012 0.10% 97 8182 0.11% 98 8395 0.11% 99 8357 0.11% 100 9116 0.12% 101 9026 0.12% 102 9523 0.12% 103 9604 0.12% 104 10107 0.13% 105 10605 0.14% 106 10840 0.14% 107 11206 0.14% 108 11376 0.15% 109 11683 0.15% 110 11749 0.15% 111 11744 0.15% 112 12205 0.16% 113 12813 0.16% 114 12979 0.17% 115 13569 0.17% 116 13984 0.18% 117 14186 0.18% 118 14898 0.19% 119 14752 0.19% 120 15368 0.20% 121 15882 0.20% 122 16179 0.21% 123 17153 0.22% 124 17844 0.23% 125 18440 0.24% 126 19172 0.25% 127 20215 0.26% 128 21312 0.27% 129 22142 0.28% 130 23460 0.30% 131 24806 0.32% 132 26652 0.34% 133 28664 0.37% 134 30247 0.39% 135 32469 0.42% 136 34932 0.45% 137 38513 0.49% 138 41438 0.53% 139 46307 0.59% 140 50615 0.65% 141 57984 0.74% 142 66225 0.85% 143 77199 0.99% 144 94048 1.21% 145 116236 1.49% 146 153120 1.97% 147 219764 2.82% 148 341395 4.39% 149 659039 8.47% 150 2197981 28.24% 151 2859396 36.74% 7783413 reads passed initial QC criterion=sequence-density sequence-density=0.53 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=32 prefix-density=0.53 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=28.69 fanout-score-rank=1 prefix-density=0.08 prefix-fanout=3.9 sequence=AAACAGAATATTTACTTTTAGCGCAAGTTTCAATTCATGAGCTCGTTACATCACAAGTTAACATTACAAGCCAATAGTCCCAGCACAGAAAAAACTCTTTTGTTGCTCACTTTCCGGGAACGAAGTTTGTGGCATATGCCCAGGCGTTGTTGTTTACTGGGTCAGAAAGGTGGTCAGCCAGGTTCTCCAGTGGTCCCTTTCCGGTCACAATGGCCTGGACAAAGAATCCGAACATTGAGAACATAGCCAACCTACCATTCTTGAG criterion=sequence-density sequence-density=1.16 sequence-density-rank=1 fanout-score=2.27 fanout-score-rank=25 prefix-density=1.18 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCA criterion=fanout-score sequence-density=0.01 sequence-density-rank=37 fanout-score=14.17 fanout-score-rank=1 prefix-density=0.04 prefix-fanout=2.1 sequence=CCCAAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170490 testing PE reads STAR mapping to Ensembl genome Started job on | Apr 10 15:59:52 Started mapping on | Apr 10 15:59:53 Finished on | Apr 10 16:01:19 Mapping speed, Million of reads per hour | 325.82 Number of input reads | 7783413 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 6719962 Uniquely mapped reads % | 86.34% Average mapped length | 291.78 Number of splices: Total | 6399421 Number of splices: Annotated (sjdb) | 6252119 Number of splices: GT/AG | 6283272 Number of splices: GC/AG | 93023 Number of splices: AT/AC | 3906 Number of splices: Non-canonical | 19220 Mismatch rate per base, % | 0.49% Deletion rate per base | 0.03% Deletion average length | 2.51 Insertion rate per base | 0.02% Insertion average length | 2.25 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 224076 % of reads mapped to multiple loci | 2.88% Number of reads mapped to too many loci | 265771 % of reads mapped to too many loci | 3.41% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 6.57% % of reads unmapped: other | 0.80% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 849035 849035 849035 N_multimapping 224076 224076 224076 N_noFeature 293130 6570813 325066 N_ambiguous 168036 676 50354 UnstrandedReadsAssigned:6258796 PositiveStrandReadsAssigned:148473 NegativeStrandReadsAssigned:6344542 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170490 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170490-trimmed-pair1.fastq SRR7170490-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 7,783,413 reads, 6,550,029 reads pseudoaligned [quant] estimated average fragment length: 265.826 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 993 rounds 52401 SRR7170490.ke.tsv 34699 SRR7170490.se.tsv 87100 total ==> SRR7170490.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1753.17 283 17.1379 Potri.005G024800.1.v4.1 1035 770.174 92 12.6822 Potri.004G059700.1.v4.1 961 696.2 10 1.52497 Potri.007G009000.2.v4.1 1416 1151.17 0 0 Potri.003G141000.2.v4.1 2943 2678.17 166 6.5806 Potri.016G087400.1.v4.1 270 78.3902 501 678.535 Potri.015G069301.1.v4.1 564 304.181 0 0 Potri.010G195200.1.v4.1 1773 1508.17 25 1.75989 Potri.012G127500.1.v4.1 977 712.184 53 7.90095 ==> SRR7170490.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 215 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 125 Potri.001G212900.v4.1 7 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 21 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170490 completed mapping pipeline successfully