Starting /dee2/code/volunteer_pipeline.sh SRR7170491 current disk space = 3050510712832 free memory = 1482173304 SRR7170491 SRAfilesize b59114de9e5e13242281d1497729aaa4 SRR7170491.sra SRR7170491.sra file validated SRR7170491 is paired end SRR7170491 is conventional basespace SRR7170491 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170491_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.673 25.0 18.0 33.0 18.0 33.0 2 24.57375 25.0 18.0 31.0 18.0 33.0 3 29.29175 30.0 27.0 33.0 25.0 33.0 4 31.239 33.0 31.0 33.0 29.0 33.0 5 32.2915 33.0 32.0 33.0 32.0 33.0 6 36.11375 38.0 36.0 38.0 33.0 38.0 7 36.81425 38.0 37.0 38.0 34.0 38.0 8 37.11675 38.0 38.0 38.0 35.0 38.0 9 37.278 38.0 38.0 38.0 36.0 38.0 10-14 37.39375 38.0 38.0 38.0 36.8 38.0 15-19 37.515049999999995 38.0 38.0 38.0 37.2 38.0 20-24 37.595600000000005 38.0 38.0 38.0 37.8 38.0 25-29 37.506150000000005 38.0 38.0 38.0 37.6 38.0 30-34 37.4842 38.0 38.0 38.0 37.4 38.0 35-39 37.43175 38.0 38.0 38.0 37.0 38.0 40-44 37.40565 38.0 38.0 38.0 37.0 38.0 45-49 37.342600000000004 38.0 38.0 38.0 37.0 38.0 50-54 37.22895 38.0 38.0 38.0 36.2 38.0 55-59 37.0381 38.0 38.0 38.0 36.0 38.0 60-64 36.99985 38.0 38.0 38.0 35.6 38.0 65-69 36.77575 38.0 38.0 38.0 34.8 38.0 70-74 36.7895 38.0 38.0 38.0 34.8 38.0 75-79 36.607150000000004 38.0 38.0 38.0 34.2 38.0 80-84 36.37955 38.0 37.6 38.0 34.0 38.0 85-89 36.32430000000001 38.0 37.0 38.0 33.8 38.0 90-94 36.055 38.0 37.0 38.0 32.8 38.0 95-99 36.079950000000004 38.0 37.0 38.0 33.0 38.0 100-104 35.380500000000005 38.0 36.0 38.0 29.2 38.0 105-109 35.4981 38.0 36.0 38.0 30.2 38.0 110-114 35.24614999999999 38.0 35.8 38.0 29.0 38.0 115-119 34.879200000000004 38.0 35.0 38.0 27.6 38.0 120-124 34.472150000000006 38.0 34.8 38.0 25.6 38.0 125-129 34.0249 38.0 34.0 38.0 23.2 38.0 130-134 33.8664 38.0 34.2 38.0 22.6 38.0 135-139 32.928650000000005 37.6 32.6 38.0 17.4 38.0 140-144 32.2362 36.4 31.4 38.0 14.4 38.0 145-149 30.251050000000003 35.8 29.8 38.0 8.6 38.0 150-151 25.637999999999998 33.5 15.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 2.0 17 2.0 18 3.0 19 5.0 20 4.0 21 1.0 22 3.0 23 9.0 24 14.0 25 16.0 26 21.0 27 26.0 28 32.0 29 48.0 30 49.0 31 77.0 32 107.0 33 170.0 34 325.0 35 621.0 36 1370.0 37 1087.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.52120592743996 9.32549821154829 7.715891670924885 42.437404190086866 2 19.725 12.049999999999999 34.075 34.150000000000006 3 18.725 19.1 27.075 35.099999999999994 4 22.125 27.250000000000004 23.724999999999998 26.900000000000002 5 23.724999999999998 31.2 24.5 20.575 6 20.549999999999997 34.225 25.174999999999997 20.05 7 14.424999999999999 25.924999999999997 42.175000000000004 17.474999999999998 8 17.075000000000003 26.650000000000002 31.6 24.675 9 16.0 24.349999999999998 35.425000000000004 24.224999999999998 10-14 19.060953047652383 30.05650282514126 27.566378318915945 23.316165808290414 15-19 19.32 28.96 28.205000000000002 23.515 20-24 19.41 28.95 28.09 23.549999999999997 25-29 19.405 28.74 28.02 23.835 30-34 19.800990049502477 29.141457072853644 27.51637581879094 23.541177058852945 35-39 19.77098854942747 28.841442072103607 27.636381819090953 23.751187559377968 40-44 19.6 29.104999999999997 27.384999999999998 23.91 45-49 20.265 28.465 27.584999999999997 23.685000000000002 50-54 19.535 28.849999999999998 27.589999999999996 24.025 55-59 19.71 28.285 27.994999999999997 24.01 60-64 19.735 28.694999999999997 27.544999999999998 24.025 65-69 19.88 28.285 27.845 23.990000000000002 70-74 19.895 28.57 27.845 23.69 75-79 20.256012800640033 28.026401320066004 28.091404570228512 23.62618130906545 80-84 19.746974697469746 29.007900790079006 27.652765276527653 23.592359235923592 85-89 20.265 28.375 27.785 23.575 90-94 20.235 27.965 28.005000000000003 23.794999999999998 95-99 20.345 28.08 27.834999999999997 23.74 100-104 20.28 28.675 27.57 23.474999999999998 105-109 20.21 28.035 28.015 23.74 110-114 20.150000000000002 28.405 27.555000000000003 23.89 115-119 21.02 28.12 27.54 23.32 120-124 20.990000000000002 28.255000000000003 27.544999999999998 23.21 125-129 21.275 27.595 27.345000000000002 23.785 130-134 20.560000000000002 27.935 27.555000000000003 23.95 135-139 20.84 27.750000000000004 27.689999999999998 23.72 140-144 20.48 28.449999999999996 26.87 24.2 145-149 20.035 28.09 27.61 24.265 150-151 20.7625 28.4 27.35 23.4875 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.5 19 1.5 20 1.5 21 0.5 22 1.0 23 3.0 24 3.5 25 3.5 26 4.0 27 6.5 28 9.0 29 13.0 30 17.0 31 23.0 32 33.0 33 37.0 34 54.5 35 75.5 36 96.0 37 117.5 38 137.5 39 172.5 40 195.0 41 213.0 42 232.0 43 254.0 44 273.0 45 265.0 46 250.5 47 246.5 48 234.5 49 207.0 50 178.0 51 144.0 52 119.0 53 94.5 54 69.0 55 56.5 56 46.5 57 36.0 58 23.5 59 14.5 60 12.5 61 8.5 62 4.5 63 4.0 64 1.5 65 0.5 66 1.0 67 1.5 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.15 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.005 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.005 80-84 0.01 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7077856420626896 1.4000000000000001 3 0.1263902932254803 0.375 4 0.05055611729019212 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.5750000000000002 0.0 0.0 0.0 0.0 112-113 1.8125 0.0 0.0 0.0 0.0 114-115 2.025 0.0 0.0 0.0 0.0 116-117 2.175 0.0 0.0 0.0 0.0 118-119 2.4375 0.0 0.0 0.0 0.0 120-121 2.7125000000000004 0.0 0.0 0.0 0.0 122-123 3.025 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.575 0.0 0.0 0.0 0.0 128-129 3.7375 0.0 0.0 0.0 0.0 130-131 3.9125 0.0 0.0 0.0 0.0 132-133 4.15 0.0 0.0 0.0 0.0 134-135 4.425 0.0 0.0 0.0 0.0 136-137 4.612500000000001 0.0 0.0 0.0 0.0 138-139 4.85 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAGTTCC 10 0.006832588 144.9875 5 AGGTGGT 10 0.006832588 144.9875 4 ACCTTGC 10 0.006832588 144.9875 8 GTGGTAA 10 0.006832588 144.9875 6 >>END_MODULE SRR7170491 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170491_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98225 33.0 33.0 34.0 32.0 34.0 2 33.1015 34.0 33.0 34.0 33.0 34.0 3 33.14675 34.0 33.0 34.0 33.0 34.0 4 33.088 34.0 33.0 34.0 33.0 34.0 5 33.0885 34.0 33.0 34.0 33.0 34.0 6 37.35025 38.0 38.0 38.0 37.0 38.0 7 37.3985 38.0 38.0 38.0 37.0 38.0 8 37.3545 38.0 38.0 38.0 38.0 38.0 9 37.3205 38.0 38.0 38.0 37.0 38.0 10-14 37.310649999999995 38.0 38.0 38.0 37.2 38.0 15-19 37.26774999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.2935 38.0 38.0 38.0 37.2 38.0 25-29 37.246500000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.13975 38.0 38.0 38.0 37.0 38.0 35-39 37.19685 38.0 38.0 38.0 37.0 38.0 40-44 37.1691 38.0 38.0 38.0 37.0 38.0 45-49 37.11480000000001 38.0 38.0 38.0 37.0 38.0 50-54 36.98455 38.0 38.0 38.0 36.4 38.0 55-59 37.037400000000005 38.0 38.0 38.0 36.8 38.0 60-64 36.9992 38.0 38.0 38.0 36.4 38.0 65-69 36.911500000000004 38.0 38.0 38.0 36.0 38.0 70-74 36.92375 38.0 38.0 38.0 36.0 38.0 75-79 36.83825 38.0 38.0 38.0 36.0 38.0 80-84 36.723699999999994 38.0 38.0 38.0 35.8 38.0 85-89 36.47365 38.0 38.0 38.0 34.2 38.0 90-94 36.41305 38.0 38.0 38.0 34.2 38.0 95-99 36.2285 38.0 37.8 38.0 33.6 38.0 100-104 36.1957 38.0 37.8 38.0 33.8 38.0 105-109 36.048950000000005 38.0 37.4 38.0 33.4 38.0 110-114 35.880700000000004 38.0 37.0 38.0 33.0 38.0 115-119 35.68085 38.0 37.0 38.0 31.8 38.0 120-124 35.44199999999999 38.0 36.2 38.0 31.0 38.0 125-129 34.968149999999994 38.0 36.0 38.0 28.8 38.0 130-134 34.559000000000005 38.0 34.6 38.0 26.8 38.0 135-139 33.91105 38.0 33.0 38.0 23.2 38.0 140-144 33.2726 38.0 33.0 38.0 20.4 38.0 145-149 32.06314999999999 38.0 32.6 38.0 10.8 38.0 150-151 26.235875 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 7.0 3 5.0 4 2.0 5 2.0 6 0.0 7 0.0 8 3.0 9 3.0 10 1.0 11 2.0 12 3.0 13 2.0 14 1.0 15 2.0 16 2.0 17 3.0 18 5.0 19 3.0 20 2.0 21 6.0 22 8.0 23 6.0 24 15.0 25 14.0 26 21.0 27 29.0 28 19.0 29 23.0 30 49.0 31 52.0 32 73.0 33 92.0 34 155.0 35 331.0 36 782.0 37 2277.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.11670423240671 20.9366391184573 15.226646631605309 25.720010017530683 2 27.680360721442888 24.949899799599198 30.861723446893784 16.50801603206413 3 20.510894064613073 27.62334084648134 31.980966691710496 19.88479839719509 4 24.148296593186373 33.842685370741485 23.04609218436874 18.962925851703407 5 22.670340681362724 36.49799599198397 23.296593186372746 17.535070140280563 6 20.095095095095093 37.487487487487485 24.124124124124123 18.293293293293296 7 19.004751187796952 21.80545136284071 38.8097024256064 20.38009502375594 8 21.891418563922944 26.51988991743808 27.545659244433324 24.043032274205654 9 21.441080810607957 24.74355766825119 29.74731048286215 24.06805103827871 10-14 22.927927927927925 29.144144144144146 26.886886886886884 21.04104104104104 15-19 22.916353806877908 28.012214046153076 28.172398257996694 20.89903388897232 20-24 22.942118966553174 28.650110154215902 27.598638093330663 20.80913278590026 25-29 23.356202113275575 28.78962391707146 27.347388452100756 20.506785517552206 30-34 22.50663727896609 28.24725742623854 28.026849671893 21.21925562290237 35-39 22.712017231878974 27.851525321845415 28.041877473325656 21.394579972949956 40-44 22.72340425531915 28.390488110137674 28.23028785982478 20.6558197747184 45-49 23.11351459616444 28.11076060287417 27.75023784487507 21.025486956086326 50-54 22.78303540133193 28.336087326623606 28.035651694957686 20.845225577086776 55-59 23.095023530589767 28.216681686192054 27.680985280865123 21.00730950235306 60-64 22.79963953139081 27.49574446780815 28.472013617703013 21.23260238309803 65-69 23.362379807692307 27.899639423076923 27.949719551282055 20.788261217948715 70-74 23.60484921350566 27.361987776775877 27.402063921450758 21.631099088267707 75-79 23.100045087921448 27.914433144632035 27.378387856319826 21.607133911126695 80-84 23.09619238476954 28.091182364729463 27.37975951903808 21.432865731462925 85-89 22.91082164328657 27.820641282565127 28.0561122244489 21.2124248496994 90-94 23.827655310621243 27.500000000000004 28.101202404809616 20.571142284569138 95-99 23.659037411729354 28.336755646817245 27.325086392547703 20.679120548905694 100-104 24.012021036814428 28.119208615076385 27.152516904583017 20.71625344352617 105-109 23.866993840452704 27.758024938654913 27.763032700686065 20.61194852020632 110-114 23.87057998597616 28.473404788139838 27.01592707602925 20.64008814985475 115-119 24.17230152767343 28.159278737791134 27.182569496619085 20.485850237916353 120-124 23.75751503006012 28.842685370741485 27.129258517034067 20.27054108216433 125-129 23.96793587174349 28.196392785571145 27.78056112224449 20.05511022044088 130-134 24.308617234468937 27.77555110220441 27.4749498997996 20.440881763527056 135-139 24.423847695390783 27.890781563126254 27.54008016032064 20.145290581162325 140-144 24.869739478957918 27.79559118236473 27.38977955911824 19.94488977955912 145-149 25.130260521042086 28.14128256513026 26.8687374749499 19.859719438877754 150-151 25.491423563290343 28.50882684362088 26.50557155377488 19.494178039313887 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 1.5 2 1.0 3 0.0 4 0.5 5 1.0 6 0.5 7 0.0 8 0.0 9 0.5 10 1.0 11 1.0 12 0.5 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 1.0 20 0.5 21 2.5 22 3.0 23 1.5 24 1.0 25 2.5 26 6.0 27 6.5 28 6.5 29 9.5 30 14.0 31 18.5 32 27.5 33 36.5 34 38.5 35 56.5 36 80.0 37 98.5 38 128.5 39 172.0 40 213.0 41 218.5 42 243.0 43 279.5 44 280.0 45 281.5 46 277.5 47 265.0 48 229.0 49 192.5 50 159.0 51 135.0 52 122.0 53 97.0 54 84.0 55 64.5 56 42.5 57 31.0 58 22.5 59 15.5 60 11.5 61 6.5 62 4.0 63 3.0 64 1.0 65 0.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.17500000000000002 2 0.2 3 0.17500000000000002 4 0.2 5 0.2 6 0.1 7 0.025 8 0.075 9 0.075 10-14 0.1 15-19 0.11499999999999999 20-24 0.13999999999999999 25-29 0.155 30-34 0.185 35-39 0.185 40-44 0.125 45-49 0.145 50-54 0.145 55-59 0.13 60-64 0.13 65-69 0.16 70-74 0.19 75-79 0.19499999999999998 80-84 0.2 85-89 0.2 90-94 0.2 95-99 0.165 100-104 0.17500000000000002 105-109 0.155 110-114 0.16999999999999998 115-119 0.17500000000000002 120-124 0.2 125-129 0.2 130-134 0.2 135-139 0.2 140-144 0.2 145-149 0.2 150-151 0.1625 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.6825075834175935 1.35 3 0.1769464105156724 0.525 4 0.02527805864509606 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.2 0.0 0.0 0.0 0.0 86-87 0.2625 0.0 0.0 0.0 0.0 88-89 0.3 0.0 0.0 0.0 0.0 90-91 0.4 0.0 0.0 0.0 0.0 92-93 0.44999999999999996 0.0 0.0 0.0 0.0 94-95 0.5625 0.0 0.0 0.0 0.0 96-97 0.65 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.8374999999999999 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0 0.0 0.0 0.0 0.0 106-107 1.1125 0.0 0.0 0.0 0.0 108-109 1.375 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.8375 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.225 0.0 0.0 0.0 0.0 118-119 2.4875 0.0 0.0 0.0 0.0 120-121 2.7625 0.0 0.0 0.0 0.0 122-123 3.1 0.0 0.0 0.0 0.0 124-125 3.4375 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.7875 0.0 0.0 0.0 0.0 130-131 3.9625 0.0 0.0 0.0 0.0 132-133 4.262499999999999 0.0 0.0 0.0 0.0 134-135 4.525 0.0 0.0 0.0 0.0 136-137 4.775 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609800 spots for SRR7170491.sra Written 609800 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra Read 609797 spots for SRR7170491.sra Written 609797 spots for SRR7170491.sra SRR ids: ['SRR7170491.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_fgmjqc83 SRR7170491.sra spots: 12195943 blocks: [[1, 609797], [609798, 1219594], [1219595, 1829391], [1829392, 2439188], [2439189, 3048985], [3048986, 3658782], [3658783, 4268579], [4268580, 4878376], [4878377, 5488173], [5488174, 6097970], [6097971, 6707767], [6707768, 7317564], [7317565, 7927361], [7927362, 8537158], [8537159, 9146955], [9146956, 9756752], [9756753, 10366549], [10366550, 10976346], [10976347, 11586143], [11586144, 12195943]] SRR7170491 file size 4111104 SRR7170491 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170491 SRR7170491_1.fastq SRR7170491_2.fastq Input file: SRR7170491_1.fastq Paired file: SRR7170491_2.fastq trimmed: SRR7170491-trimmed-pair1.fastq, SRR7170491-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 00:18:56 2025 >> started Thu Feb 13 00:22:42 2025 >> done (226.443s) 12195943 read pairs processed; of these: 17818 ( 0.15%) short read pairs filtered out after trimming by size control 22972 ( 0.19%) empty read pairs filtered out after trimming by size control 12155153 (99.67%) read pairs available; of these: 7765253 (63.88%) trimmed read pairs available after processing 4389900 (36.12%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 1 0.00% 20 2 0.00% 21 1 0.00% 22 3 0.00% 23 6 0.00% 24 4 0.00% 25 2 0.00% 26 5 0.00% 27 0 0.00% 28 5 0.00% 29 5 0.00% 30 1 0.00% 31 5 0.00% 32 12 0.00% 33 6 0.00% 34 12 0.00% 35 7 0.00% 36 11 0.00% 37 14 0.00% 38 17 0.00% 39 16 0.00% 40 21 0.00% 41 20 0.00% 42 27 0.00% 43 20 0.00% 44 22 0.00% 45 24 0.00% 46 40 0.00% 47 50 0.00% 48 44 0.00% 49 62 0.00% 50 56 0.00% 51 91 0.00% 52 90 0.00% 53 94 0.00% 54 93 0.00% 55 112 0.00% 56 111 0.00% 57 160 0.00% 58 205 0.00% 59 193 0.00% 60 267 0.00% 61 285 0.00% 62 298 0.00% 63 376 0.00% 64 374 0.00% 65 442 0.00% 66 478 0.00% 67 509 0.00% 68 535 0.00% 69 706 0.01% 70 773 0.01% 71 907 0.01% 72 1074 0.01% 73 1188 0.01% 74 1302 0.01% 75 1404 0.01% 76 1558 0.01% 77 1663 0.01% 78 1856 0.02% 79 2139 0.02% 80 2411 0.02% 81 2804 0.02% 82 3034 0.02% 83 3700 0.03% 84 4411 0.04% 85 4735 0.04% 86 5054 0.04% 87 5062 0.04% 88 5254 0.04% 89 5346 0.04% 90 5865 0.05% 91 6172 0.05% 92 6723 0.06% 93 7103 0.06% 94 7720 0.06% 95 8261 0.07% 96 8657 0.07% 97 8917 0.07% 98 9198 0.08% 99 9798 0.08% 100 10029 0.08% 101 10302 0.08% 102 11059 0.09% 103 11554 0.10% 104 12122 0.10% 105 12836 0.11% 106 13611 0.11% 107 13623 0.11% 108 13727 0.11% 109 14417 0.12% 110 14253 0.12% 111 14913 0.12% 112 15366 0.13% 113 15861 0.13% 114 16672 0.14% 115 17304 0.14% 116 17819 0.15% 117 18517 0.15% 118 18640 0.15% 119 19360 0.16% 120 19840 0.16% 121 20727 0.17% 122 21312 0.18% 123 22259 0.18% 124 23146 0.19% 125 24537 0.20% 126 26244 0.22% 127 27084 0.22% 128 28173 0.23% 129 29981 0.25% 130 31830 0.26% 131 33696 0.28% 132 35904 0.30% 133 38674 0.32% 134 41611 0.34% 135 45538 0.37% 136 49746 0.41% 137 55234 0.45% 138 61122 0.50% 139 69384 0.57% 140 79318 0.65% 141 91394 0.75% 142 106413 0.88% 143 127450 1.05% 144 157440 1.30% 145 202020 1.66% 146 271098 2.23% 147 386937 3.18% 148 609195 5.01% 149 1158301 9.53% 150 3437627 28.28% 151 4389900 36.12% 12155153 reads passed initial QC criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=16 prefix-density=0.61 prefix-fanout=2.0 sequence=GTGTTGTCGAATCC criterion=fanout-score sequence-density=0.11 sequence-density-rank=21 fanout-score=31.76 fanout-score-rank=1 prefix-density=0.34 prefix-fanout=10.4 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.56 sequence-density-rank=1 fanout-score=2.18 fanout-score-rank=22 prefix-density=0.57 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.03 sequence-density-rank=24 fanout-score=29.39 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=7.9 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7170491 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:12:55 Started mapping on | Feb 13 01:12:55 Finished on | Feb 13 01:17:55 Mapping speed, Million of reads per hour | 145.86 Number of input reads | 12155153 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11296102 Uniquely mapped reads % | 92.93% Average mapped length | 293.00 Number of splices: Total | 11095075 Number of splices: Annotated (sjdb) | 10855626 Number of splices: GT/AG | 10890496 Number of splices: GC/AG | 166596 Number of splices: AT/AC | 6706 Number of splices: Non-canonical | 31277 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.61 Insertion rate per base | 0.02% Insertion average length | 2.11 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 286977 % of reads mapped to multiple loci | 2.36% Number of reads mapped to too many loci | 30954 % of reads mapped to too many loci | 0.25% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.39% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 582196 582196 582196 N_multimapping 286977 286977 286977 N_noFeature 368136 11092046 424372 N_ambiguous 234027 742 85830 UnstrandedReadsAssigned:10693939 PositiveStrandReadsAssigned:203314 NegativeStrandReadsAssigned:10785900 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170491 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170491-trimmed-pair1.fastq SRR7170491-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,155,153 reads, 10,752,626 reads pseudoaligned [quant] estimated average fragment length: 276.5 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,086 rounds 52401 SRR7170491.ke.tsv 34699 SRR7170491.se.tsv 87100 total ==> SRR7170491.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1742.5 508 23.3735 Potri.005G024800.1.v4.1 1035 759.5 144 15.2008 Potri.004G059700.1.v4.1 961 685.511 7 0.818683 Potri.007G009000.2.v4.1 1416 1140.5 0 0 Potri.003G141000.2.v4.1 2943 2667.5 372 11.1807 Potri.016G087400.1.v4.1 270 76.2169 558.751 587.759 Potri.015G069301.1.v4.1 564 293.475 0 0 Potri.010G195200.1.v4.1 1773 1497.5 18 0.963691 Potri.012G127500.1.v4.1 977 701.505 79 9.02877 ==> SRR7170491.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 605 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 237 Potri.001G212900.v4.1 1 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 6 Potri.001G416900.v4.1 2 Potri.001G452600.v4.1 1 SRR7170491 completed mapping pipeline successfully