Starting /dee2/code/volunteer_pipeline.sh SRR7170492 current disk space = 3051027800064 free memory = 1570309704 SRR7170492 SRAfilesize 7721b137747d6df808ead0cda475823e SRR7170492.sra SRR7170492.sra file validated SRR7170492 is paired end SRR7170492 is conventional basespace SRR7170492 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170492_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 26.06975 27.0 18.0 33.0 18.0 33.0 2 24.89125 27.0 18.0 31.0 18.0 33.0 3 29.4915 30.0 27.0 33.0 25.0 33.0 4 31.38525 33.0 31.0 33.0 29.0 33.0 5 32.41425 33.0 32.0 33.0 32.0 33.0 6 36.174 38.0 36.0 38.0 33.0 38.0 7 36.89725 38.0 37.0 38.0 35.0 38.0 8 37.13375 38.0 38.0 38.0 36.0 38.0 9 37.4205 38.0 38.0 38.0 37.0 38.0 10-14 37.44345 38.0 38.0 38.0 37.0 38.0 15-19 37.520399999999995 38.0 38.0 38.0 37.6 38.0 20-24 37.53465 38.0 38.0 38.0 38.0 38.0 25-29 37.57785 38.0 38.0 38.0 38.0 38.0 30-34 37.504 38.0 38.0 38.0 37.8 38.0 35-39 37.4309 38.0 38.0 38.0 37.2 38.0 40-44 37.427099999999996 38.0 38.0 38.0 37.0 38.0 45-49 37.34335 38.0 38.0 38.0 37.0 38.0 50-54 37.2127 38.0 38.0 38.0 36.4 38.0 55-59 37.0325 38.0 38.0 38.0 36.0 38.0 60-64 37.0115 38.0 38.0 38.0 35.8 38.0 65-69 36.86785 38.0 38.0 38.0 35.0 38.0 70-74 36.770599999999995 38.0 38.0 38.0 34.8 38.0 75-79 36.6969 38.0 38.0 38.0 34.8 38.0 80-84 36.5007 38.0 38.0 38.0 34.0 38.0 85-89 36.3738 38.0 37.4 38.0 33.8 38.0 90-94 36.1844 38.0 37.2 38.0 33.4 38.0 95-99 36.135200000000005 38.0 37.0 38.0 32.8 38.0 100-104 35.530100000000004 38.0 36.4 38.0 30.2 38.0 105-109 35.63190000000001 38.0 36.0 38.0 30.8 38.0 110-114 35.4829 38.0 36.0 38.0 30.2 38.0 115-119 35.04845 38.0 35.4 38.0 28.0 38.0 120-124 34.5175 38.0 34.8 38.0 25.8 38.0 125-129 34.2013 38.0 34.2 38.0 23.8 38.0 130-134 34.1175 38.0 34.2 38.0 24.0 38.0 135-139 33.310649999999995 38.0 32.8 38.0 19.0 38.0 140-144 32.36735 36.8 31.8 38.0 14.4 38.0 145-149 30.5185 36.0 30.4 38.0 8.6 38.0 150-151 26.09 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 1.0 13 1.0 14 4.0 15 0.0 16 2.0 17 2.0 18 4.0 19 3.0 20 6.0 21 4.0 22 7.0 23 6.0 24 12.0 25 15.0 26 28.0 27 21.0 28 32.0 29 36.0 30 53.0 31 77.0 32 95.0 33 150.0 34 277.0 35 536.0 36 1354.0 37 1271.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.74173712528824 8.557519856520624 10.837817063797079 44.86292595439406 2 20.724999999999998 12.45 33.75 33.074999999999996 3 20.325 17.474999999999998 26.625 35.575 4 23.549999999999997 25.775 23.35 27.325 5 22.7 31.35 24.4 21.55 6 18.2 36.225 24.825 20.75 7 14.975 26.125 42.425000000000004 16.475 8 18.625 26.474999999999998 30.575000000000003 24.325 9 17.175 25.8 34.875 22.15 10-14 19.655 30.59 26.85 22.905 15-19 19.405 29.299999999999997 27.965 23.330000000000002 20-24 19.99 29.854999999999997 27.26 22.895 25-29 20.025000000000002 29.470000000000002 27.765 22.74 30-34 20.07 29.48 27.310000000000002 23.14 35-39 20.46 29.86 26.91 22.770000000000003 40-44 19.759999999999998 29.59 27.52 23.13 45-49 20.18 29.315 27.265 23.24 50-54 19.985 29.375 27.41 23.23 55-59 19.85 28.76 28.084999999999997 23.305 60-64 20.200000000000003 28.99 27.435 23.375 65-69 19.939999999999998 28.99 27.215 23.855 70-74 19.755 28.76 27.775 23.71 75-79 19.77 28.515 27.915 23.799999999999997 80-84 20.215 28.93 27.439999999999998 23.415 85-89 20.14 28.405 27.66 23.794999999999998 90-94 20.82 28.615000000000002 27.43 23.135 95-99 20.3 28.515 27.474999999999998 23.71 100-104 20.119999999999997 28.439999999999998 27.279999999999998 24.16 105-109 20.365 28.415000000000003 27.575 23.645 110-114 20.544999999999998 28.53 27.72 23.205000000000002 115-119 20.71 28.565 27.229999999999997 23.494999999999997 120-124 20.705000000000002 28.57 27.495000000000005 23.23 125-129 20.65 28.58 27.005000000000003 23.765 130-134 20.925 28.71 26.83 23.535 135-139 20.53 27.91 27.595 23.965 140-144 20.645 28.315 26.82 24.22 145-149 20.465 28.375 27.150000000000002 24.01 150-151 20.9375 27.200000000000003 26.637499999999996 25.224999999999998 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.5 19 1.0 20 1.0 21 1.0 22 1.5 23 2.0 24 3.5 25 5.5 26 6.5 27 7.5 28 9.5 29 15.5 30 21.5 31 26.0 32 38.5 33 51.5 34 62.5 35 75.0 36 98.5 37 118.0 38 143.5 39 183.0 40 197.0 41 207.5 42 232.0 43 239.5 44 244.0 45 242.0 46 237.5 47 248.5 48 246.0 49 221.0 50 186.5 51 153.5 52 120.0 53 95.0 54 63.5 55 47.5 56 47.5 57 31.5 58 17.5 59 18.5 60 14.5 61 4.5 62 2.5 63 0.5 64 0.5 65 2.0 66 1.5 67 1.5 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 2.4250000000000003 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39592247671784 98.725 2 0.5537377296753083 1.0999999999999999 3 0.025169896803423106 0.075 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.025 0.0 0.0 0.0 0.0 48-49 0.025 0.0 0.0 0.0 0.0 50-51 0.025 0.0 0.0 0.0 0.0 52-53 0.025 0.0 0.0 0.0 0.0 54-55 0.025 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.0625 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.0875 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.125 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.1375 0.0 0.0 0.0 0.0 86-87 0.15 0.0 0.0 0.0 0.0 88-89 0.1875 0.0 0.0 0.0 0.0 90-91 0.21250000000000002 0.0 0.0 0.0 0.0 92-93 0.25 0.0 0.0 0.0 0.0 94-95 0.3375 0.0 0.0 0.0 0.0 96-97 0.4125 0.0 0.0 0.0 0.0 98-99 0.5249999999999999 0.0 0.0 0.0 0.0 100-101 0.65 0.0 0.0 0.0 0.0 102-103 0.7375 0.0 0.0 0.0 0.0 104-105 0.8625 0.0 0.0 0.0 0.0 106-107 1.0 0.0 0.0 0.0 0.0 108-109 1.15 0.0 0.0 0.0 0.0 110-111 1.2999999999999998 0.0 0.0 0.0 0.0 112-113 1.475 0.0 0.0 0.0 0.0 114-115 1.7125 0.0 0.0 0.0 0.0 116-117 1.8624999999999998 0.0 0.0 0.0 0.0 118-119 2.0875 0.0 0.0 0.0 0.0 120-121 2.25 0.0 0.0 0.0 0.0 122-123 2.45 0.0 0.0 0.0 0.0 124-125 2.7 0.0 0.0 0.0 0.0 126-127 3.025 0.0 0.0 0.0 0.0 128-129 3.2750000000000004 0.0 0.0 0.0 0.0 130-131 3.5250000000000004 0.0 0.0 0.0 0.0 132-133 3.8375 0.0 0.0 0.0 0.0 134-135 4.075 0.0 0.0 0.0 0.0 136-137 4.4375 0.0 0.0 0.0 0.0 138-139 4.675 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170492 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170492_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.0285 33.0 33.0 34.0 32.0 34.0 2 33.162 34.0 33.0 34.0 33.0 34.0 3 33.20225 34.0 33.0 34.0 33.0 34.0 4 33.1395 34.0 33.0 34.0 33.0 34.0 5 33.174 34.0 33.0 34.0 33.0 34.0 6 37.433 38.0 38.0 38.0 38.0 38.0 7 37.4385 38.0 38.0 38.0 38.0 38.0 8 37.38225 38.0 38.0 38.0 38.0 38.0 9 37.4175 38.0 38.0 38.0 38.0 38.0 10-14 37.351800000000004 38.0 38.0 38.0 37.8 38.0 15-19 37.3558 38.0 38.0 38.0 37.8 38.0 20-24 37.347449999999995 38.0 38.0 38.0 37.6 38.0 25-29 37.32745 38.0 38.0 38.0 38.0 38.0 30-34 37.28075 38.0 38.0 38.0 37.6 38.0 35-39 37.30815 38.0 38.0 38.0 37.6 38.0 40-44 37.26345 38.0 38.0 38.0 37.2 38.0 45-49 37.2751 38.0 38.0 38.0 37.0 38.0 50-54 37.21845 38.0 38.0 38.0 37.0 38.0 55-59 37.19225 38.0 38.0 38.0 37.0 38.0 60-64 37.173249999999996 38.0 38.0 38.0 37.0 38.0 65-69 37.1052 38.0 38.0 38.0 36.6 38.0 70-74 37.06445 38.0 38.0 38.0 36.6 38.0 75-79 37.0463 38.0 38.0 38.0 36.4 38.0 80-84 36.898 38.0 38.0 38.0 36.0 38.0 85-89 36.72085 38.0 38.0 38.0 35.6 38.0 90-94 36.63325 38.0 38.0 38.0 35.0 38.0 95-99 36.45185 38.0 38.0 38.0 34.4 38.0 100-104 36.4253 38.0 38.0 38.0 34.2 38.0 105-109 36.32170000000001 38.0 38.0 38.0 34.0 38.0 110-114 36.15305 38.0 37.8 38.0 33.8 38.0 115-119 35.9653 38.0 37.2 38.0 33.0 38.0 120-124 35.69214999999999 38.0 37.0 38.0 31.6 38.0 125-129 35.33855 38.0 36.0 38.0 31.0 38.0 130-134 34.98055000000001 38.0 35.8 38.0 29.4 38.0 135-139 34.50535 38.0 34.2 38.0 26.8 38.0 140-144 33.8879 38.0 33.2 38.0 23.6 38.0 145-149 32.9689 38.0 33.0 38.0 17.6 38.0 150-151 26.79625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 2.0 4 2.0 5 0.0 6 0.0 7 0.0 8 0.0 9 1.0 10 0.0 11 1.0 12 4.0 13 3.0 14 1.0 15 1.0 16 3.0 17 3.0 18 5.0 19 3.0 20 2.0 21 5.0 22 7.0 23 7.0 24 9.0 25 14.0 26 14.0 27 19.0 28 21.0 29 25.0 30 27.0 31 49.0 32 67.0 33 80.0 34 148.0 35 265.0 36 736.0 37 2467.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 33.083270817704424 19.32983245811453 17.779444861215303 29.80745186296574 2 26.331582895723933 24.381095273818453 31.782945736434108 17.504376094023506 3 19.454863715928983 28.857214303575894 31.23280820205051 20.455113778444613 4 22.85571392848212 33.983495873968494 24.15603900975244 19.004751187796952 5 25.162581290645324 34.667333666833414 22.936468234117058 17.2336168084042 6 21.330332583145786 38.63465866466617 22.355588897224308 17.67941985496374 7 20.175 22.325 38.4 19.1 8 22.6 26.025 27.425 23.95 9 22.930732683170792 25.131282820705174 29.607401850462615 22.330582645661416 10-14 23.51970394078816 28.970794158831765 26.24024804960992 21.269253850770152 15-19 23.485871467866968 27.80195048762191 27.696924231057764 21.015253813453363 20-24 22.850712678169543 28.252063015753937 27.881970492623154 21.015253813453363 25-29 23.442032609782935 28.233470041012303 27.408222466740025 20.916274882464737 30-34 23.16695008502551 27.82334700410123 28.108432529758925 20.901270381114333 35-39 22.97919167667067 28.08623449379752 27.66606642657063 21.268507402961184 40-44 23.625906476619154 28.037009252313077 27.87696924231058 20.46011502875719 45-49 23.26081520380095 27.536884221055264 28.162040510127532 21.040260065016252 50-54 23.775943985996502 27.776944236059016 27.746936734183546 20.70017504376094 55-59 23.579715943188635 27.545509101820365 27.660532106421282 21.214242848569715 60-64 23.275818954738682 27.591897974493623 28.33208302075519 20.800200050012503 65-69 24.346086521630408 26.731682920730183 27.71692923230808 21.205301325331334 70-74 23.284313725490197 27.841136454581832 27.380952380952383 21.49359743897559 75-79 23.5032261291452 27.634672135247335 27.709698394438053 21.15240334116941 80-84 23.479087452471482 28.111867120272166 27.416449869921955 20.9925955573344 85-89 24.35704993495447 27.56429500650455 27.37916541579105 20.699489642749924 90-94 23.944366619971984 27.92675605363218 27.336401841104664 20.792475485291178 95-99 23.928374931225928 28.29990496673836 26.88440954334017 20.887310558695543 100-104 24.317295188556567 27.65329598879664 27.748324497349202 20.281084325297588 105-109 24.137241172351708 27.28818645593678 28.02840852255677 20.54616384915475 110-114 24.391097774443608 28.22705676419105 26.82170542635659 20.560140035008754 115-119 23.977193157947386 27.888366509952984 27.308192457737324 20.82624787436231 120-124 23.78689344672336 27.533766883441718 28.099049524762382 20.580290145072535 125-129 23.843113712541896 27.910350692881085 27.475111311221173 20.771424283355845 130-134 25.02751926348444 27.154007805463827 27.829480636445513 19.988992294606227 135-139 24.836110694089978 27.603462943501977 27.99379472551669 19.56663163689136 140-144 25.040032025620494 27.597077662129703 27.296837469975983 20.06605284227382 145-149 24.681042677740532 27.35277930654926 28.003202081352878 19.96297593435733 150-151 25.13442540952857 27.672877328998375 27.047642866074778 20.145054395398272 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 1.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.5 18 1.0 19 1.0 20 0.5 21 1.0 22 2.0 23 1.5 24 2.5 25 3.0 26 1.5 27 1.5 28 2.5 29 6.5 30 9.5 31 13.0 32 24.5 33 39.5 34 47.5 35 52.0 36 71.5 37 91.0 38 120.0 39 156.5 40 190.0 41 216.0 42 248.5 43 281.0 44 287.5 45 281.0 46 260.0 47 250.0 48 241.0 49 223.0 50 183.0 51 139.0 52 123.0 53 110.5 54 93.5 55 66.0 56 41.0 57 32.0 58 26.0 59 19.5 60 13.0 61 5.5 62 4.0 63 4.0 64 2.0 65 2.0 66 1.5 67 2.0 68 1.5 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.025 2 0.025 3 0.025 4 0.025 5 0.05 6 0.025 7 0.0 8 0.0 9 0.025 10-14 0.02 15-19 0.025 20-24 0.025 25-29 0.03 30-34 0.03 35-39 0.04 40-44 0.025 45-49 0.025 50-54 0.025 55-59 0.02 60-64 0.025 65-69 0.025 70-74 0.04 75-79 0.034999999999999996 80-84 0.06 85-89 0.06999999999999999 90-94 0.06 95-99 0.034999999999999996 100-104 0.03 105-109 0.03 110-114 0.025 115-119 0.03 120-124 0.05 125-129 0.055 130-134 0.06999999999999999 135-139 0.08499999999999999 140-144 0.08 145-149 0.065 150-151 0.0375 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.05000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19232710752145 98.25 2 0.6814740030287734 1.35 3 0.10095911155981827 0.3 4 0.025239777889954566 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.025 0.0 0.0 7 0.0 0.0 0.025 0.0 0.0 8 0.0 0.0 0.025 0.0 0.0 9 0.0 0.0 0.025 0.0 0.0 10-11 0.0 0.0 0.025 0.0 0.0 12-13 0.0 0.0 0.025 0.0 0.0 14-15 0.0 0.0 0.025 0.0 0.0 16-17 0.0 0.0 0.025 0.0 0.0 18-19 0.0 0.0 0.025 0.0 0.0 20-21 0.0 0.0 0.025 0.0 0.0 22-23 0.0 0.0 0.025 0.0 0.0 24-25 0.0 0.0 0.025 0.0 0.0 26-27 0.0 0.0 0.025 0.0 0.0 28-29 0.0 0.0 0.025 0.0 0.0 30-31 0.0 0.0 0.025 0.0 0.0 32-33 0.0 0.0 0.025 0.0 0.0 34-35 0.0 0.0 0.025 0.0 0.0 36-37 0.0 0.0 0.025 0.0 0.0 38-39 0.0 0.0 0.025 0.0 0.0 40-41 0.0 0.0 0.025 0.0 0.0 42-43 0.0 0.0 0.025 0.0 0.0 44-45 0.0 0.0 0.025 0.0 0.0 46-47 0.025 0.0 0.025 0.0 0.0 48-49 0.025 0.0 0.025 0.0 0.0 50-51 0.025 0.0 0.025 0.0 0.0 52-53 0.025 0.0 0.025 0.0 0.0 54-55 0.025 0.0 0.025 0.0 0.0 56-57 0.025 0.0 0.025 0.0 0.0 58-59 0.025 0.0 0.025 0.0 0.0 60-61 0.025 0.0 0.025 0.0 0.0 62-63 0.025 0.0 0.025 0.0 0.0 64-65 0.025 0.0 0.025 0.0 0.0 66-67 0.025 0.0 0.025 0.0 0.0 68-69 0.0625 0.0 0.025 0.0 0.0 70-71 0.075 0.0 0.025 0.0 0.0 72-73 0.075 0.0 0.025 0.0 0.0 74-75 0.0875 0.0 0.025 0.0 0.0 76-77 0.1 0.0 0.025 0.0 0.0 78-79 0.1 0.0 0.025 0.0 0.0 80-81 0.125 0.0 0.025 0.0 0.0 82-83 0.125 0.0 0.025 0.0 0.0 84-85 0.1375 0.0 0.025 0.0 0.0 86-87 0.15 0.0 0.025 0.0 0.0 88-89 0.1875 0.0 0.025 0.0 0.0 90-91 0.21250000000000002 0.0 0.025 0.0 0.0 92-93 0.25 0.0 0.025 0.0 0.0 94-95 0.3375 0.0 0.025 0.0 0.0 96-97 0.4125 0.0 0.025 0.0 0.0 98-99 0.5249999999999999 0.0 0.025 0.0 0.0 100-101 0.65 0.0 0.025 0.0 0.0 102-103 0.75 0.0 0.025 0.0 0.0 104-105 0.8875 0.0 0.025 0.0 0.0 106-107 1.025 0.0 0.025 0.0 0.0 108-109 1.175 0.0 0.025 0.0 0.0 110-111 1.3250000000000002 0.0 0.025 0.0 0.0 112-113 1.5 0.0 0.025 0.0 0.0 114-115 1.7375 0.0 0.025 0.0 0.0 116-117 1.8875000000000002 0.0 0.025 0.0 0.0 118-119 2.1125 0.0 0.025 0.0 0.0 120-121 2.2875 0.0 0.025 0.0 0.0 122-123 2.5 0.0 0.025 0.0 0.0 124-125 2.75 0.0 0.025 0.0 0.0 126-127 3.0625 0.0 0.025 0.0 0.0 128-129 3.3 0.0 0.025 0.0 0.0 130-131 3.55 0.0 0.025 0.0 0.0 132-133 3.9 0.0 0.025 0.0 0.0 134-135 4.1875 0.0 0.025 0.0 0.0 136-137 4.6 0.0 0.025 0.0 0.0 138-139 4.8625 0.0 0.025 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra Read 588095 spots for SRR7170492.sra Written 588095 spots for SRR7170492.sra Read 588089 spots for SRR7170492.sra Written 588089 spots for SRR7170492.sra SRR ids: ['SRR7170492.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_8m60mliy SRR7170492.sra spots: 11761786 blocks: [[1, 588089], [588090, 1176178], [1176179, 1764267], [1764268, 2352356], [2352357, 2940445], [2940446, 3528534], [3528535, 4116623], [4116624, 4704712], [4704713, 5292801], [5292802, 5880890], [5880891, 6468979], [6468980, 7057068], [7057069, 7645157], [7645158, 8233246], [8233247, 8821335], [8821336, 9409424], [9409425, 9997513], [9997514, 10585602], [10585603, 11173691], [11173692, 11761786]] SRR7170492 file size 3963982 SRR7170492 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170492 SRR7170492_1.fastq SRR7170492_2.fastq Input file: SRR7170492_1.fastq Paired file: SRR7170492_2.fastq trimmed: SRR7170492-trimmed-pair1.fastq, SRR7170492-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:30:54 2025 >> started Thu Feb 13 01:31:07 2025 >> done (12.657s) 11761786 read pairs processed; of these: 15293 ( 0.13%) short read pairs filtered out after trimming by size control 20314 ( 0.17%) empty read pairs filtered out after trimming by size control 11726179 (99.70%) read pairs available; of these: 7219131 (61.56%) trimmed read pairs available after processing 4507048 (38.44%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 19 1 0.00% 20 4 0.00% 21 1 0.00% 22 1 0.00% 23 1 0.00% 24 2 0.00% 25 2 0.00% 26 3 0.00% 27 6 0.00% 28 4 0.00% 29 3 0.00% 30 2 0.00% 31 3 0.00% 32 6 0.00% 33 6 0.00% 34 2 0.00% 35 1 0.00% 36 1 0.00% 37 6 0.00% 38 12 0.00% 39 17 0.00% 40 15 0.00% 41 15 0.00% 42 20 0.00% 43 19 0.00% 44 18 0.00% 45 26 0.00% 46 17 0.00% 47 36 0.00% 48 31 0.00% 49 45 0.00% 50 32 0.00% 51 62 0.00% 52 81 0.00% 53 75 0.00% 54 83 0.00% 55 101 0.00% 56 93 0.00% 57 90 0.00% 58 130 0.00% 59 152 0.00% 60 164 0.00% 61 215 0.00% 62 204 0.00% 63 262 0.00% 64 313 0.00% 65 335 0.00% 66 357 0.00% 67 380 0.00% 68 428 0.00% 69 519 0.00% 70 605 0.01% 71 697 0.01% 72 750 0.01% 73 796 0.01% 74 984 0.01% 75 1146 0.01% 76 1260 0.01% 77 1371 0.01% 78 1555 0.01% 79 1739 0.01% 80 1887 0.02% 81 2185 0.02% 82 2637 0.02% 83 3097 0.03% 84 3767 0.03% 85 4211 0.04% 86 4177 0.04% 87 4351 0.04% 88 4641 0.04% 89 4800 0.04% 90 5154 0.04% 91 5605 0.05% 92 5907 0.05% 93 6407 0.05% 94 6864 0.06% 95 7496 0.06% 96 7771 0.07% 97 8099 0.07% 98 8481 0.07% 99 8778 0.07% 100 9309 0.08% 101 9627 0.08% 102 10341 0.09% 103 10893 0.09% 104 11716 0.10% 105 12269 0.10% 106 12834 0.11% 107 13278 0.11% 108 13450 0.11% 109 14089 0.12% 110 14150 0.12% 111 14676 0.13% 112 15066 0.13% 113 15664 0.13% 114 16418 0.14% 115 16896 0.14% 116 17468 0.15% 117 18080 0.15% 118 19029 0.16% 119 19072 0.16% 120 19755 0.17% 121 20329 0.17% 122 20974 0.18% 123 21878 0.19% 124 22851 0.19% 125 24041 0.21% 126 25297 0.22% 127 26133 0.22% 128 27540 0.23% 129 28725 0.24% 130 30152 0.26% 131 31656 0.27% 132 33747 0.29% 133 36224 0.31% 134 38612 0.33% 135 41891 0.36% 136 45769 0.39% 137 49536 0.42% 138 54596 0.47% 139 61959 0.53% 140 69297 0.59% 141 79387 0.68% 142 92126 0.79% 143 108699 0.93% 144 134226 1.14% 145 171118 1.46% 146 231116 1.97% 147 333271 2.84% 148 532235 4.54% 149 1045517 8.92% 150 3354529 28.61% 151 4507048 38.44% 11726179 reads passed initial QC criterion=sequence-density sequence-density=0.76 sequence-density-rank=1 fanout-score=2.01 fanout-score-rank=24 prefix-density=0.77 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.03 sequence-density-rank=26 fanout-score=54.32 fanout-score-rank=1 prefix-density=0.16 prefix-fanout=11.5 sequence=AAAAGAAAGAGTTGTGAACCACCACATTTGATCATGGACAAAAGGTAATCAAATAGTTGCCTCCACTAGGACAAGTAAACGTGCTCGATTTATCATCATAAGCATAACTATAAGCTTGAGGACACTGCTGCTTGAAAGTCATCGAATATTGGGTAGGAGGACATGTGTCAGCTGTATTATGGTCTCCTGTGCAGCAGTACTGCGGCTGGTTAAATGCCAAACACGCACTCTTGCAGGCAATCACAGTCCCATCTGAACCTTTCACTGCTAAACTAGGATCACAAACAGCATTCACGTTAGCTGCACAGCTTGTAGAAGAGCAGCCAGTAGAACCTCCTTGCGGGGTTACCGAAATTGGGAGGTTAAAGCCATCAACAAGGCTTATATCGTAATAATCTTTCCCACCATCACCGCTTAGAGTAAATTCTGCCAAGGATGCTGGTGGGATCGCACCGGCTCCATTGCATTCTACGACACCAGAGGCACAGTCAGCAGTAGCACAAACAAACTT criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=2.07 fanout-score-rank=22 prefix-density=0.66 prefix-fanout=2.1 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=16.68 fanout-score-rank=1 prefix-density=0.09 prefix-fanout=3.7 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTC SRR7170492 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:31:48 Started mapping on | Feb 13 01:31:48 Finished on | Feb 13 01:33:02 Mapping speed, Million of reads per hour | 570.46 Number of input reads | 11726179 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 11071327 Uniquely mapped reads % | 94.42% Average mapped length | 293.53 Number of splices: Total | 10457191 Number of splices: Annotated (sjdb) | 10240536 Number of splices: GT/AG | 10257561 Number of splices: GC/AG | 166524 Number of splices: AT/AC | 6490 Number of splices: Non-canonical | 26616 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.49 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 313427 % of reads mapped to multiple loci | 2.67% Number of reads mapped to too many loci | 23746 % of reads mapped to too many loci | 0.20% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.66% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 349603 349603 349603 N_multimapping 313427 313427 313427 N_noFeature 305928 10859220 356184 N_ambiguous 243066 892 80759 UnstrandedReadsAssigned:10522333 PositiveStrandReadsAssigned:211215 NegativeStrandReadsAssigned:10634384 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170492 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170492-trimmed-pair1.fastq SRR7170492-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 11,726,179 reads, 10,603,296 reads pseudoaligned [quant] estimated average fragment length: 263.61 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,051 rounds 52401 SRR7170492.ke.tsv 34699 SRR7170492.se.tsv 87100 total ==> SRR7170492.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1755.39 527 23.361 Potri.005G024800.1.v4.1 1035 772.39 293 29.5179 Potri.004G059700.1.v4.1 961 698.395 12 1.33701 Potri.007G009000.2.v4.1 1416 1153.39 0 0 Potri.003G141000.2.v4.1 2943 2680.39 365.293 10.6047 Potri.016G087400.1.v4.1 270 75.2424 735 760.114 Potri.015G069301.1.v4.1 564 304.425 0 0 Potri.010G195200.1.v4.1 1773 1510.39 69.8541 3.59879 Potri.012G127500.1.v4.1 977 714.395 205 22.329 ==> SRR7170492.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1169 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 281 Potri.001G212900.v4.1 29 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 43 Potri.001G416900.v4.1 1 Potri.001G452600.v4.1 7 SRR7170492 completed mapping pipeline successfully