Starting /dee2/code/volunteer_pipeline.sh SRR7170493 current disk space = 3051203579904 free memory = 1567709848 SRR7170493 SRAfilesize 5bf952d30a2b68ef5c4bdccb4b1f6922 SRR7170493.sra SRR7170493.sra file validated SRR7170493 is paired end SRR7170493 is conventional basespace SRR7170493 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170493_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.5245 27.0 18.0 33.0 18.0 33.0 2 25.3625 27.0 18.0 31.0 18.0 33.0 3 29.4985 30.0 27.0 33.0 25.0 33.0 4 31.3785 33.0 31.0 33.0 29.0 33.0 5 32.43275 33.0 33.0 33.0 32.0 33.0 6 36.4965 38.0 37.0 38.0 34.0 38.0 7 36.97625 38.0 37.0 38.0 35.0 38.0 8 37.2345 38.0 38.0 38.0 36.0 38.0 9 37.2055 38.0 38.0 38.0 36.0 38.0 10-14 37.428000000000004 38.0 38.0 38.0 36.8 38.0 15-19 37.465599999999995 38.0 38.0 38.0 37.0 38.0 20-24 37.4967 38.0 38.0 38.0 37.4 38.0 25-29 37.45635 38.0 38.0 38.0 37.0 38.0 30-34 37.47180000000001 38.0 38.0 38.0 37.2 38.0 35-39 37.363899999999994 38.0 38.0 38.0 37.0 38.0 40-44 37.3138 38.0 38.0 38.0 37.0 38.0 45-49 37.1105 38.0 38.0 38.0 36.0 38.0 50-54 37.1091 38.0 38.0 38.0 36.0 38.0 55-59 36.9769 38.0 38.0 38.0 35.8 38.0 60-64 36.9988 38.0 38.0 38.0 35.6 38.0 65-69 36.83565 38.0 38.0 38.0 35.0 38.0 70-74 36.732150000000004 38.0 38.0 38.0 34.8 38.0 75-79 36.40495 38.0 37.6 38.0 33.8 38.0 80-84 36.22279999999999 38.0 37.0 38.0 33.4 38.0 85-89 36.22360000000001 38.0 37.0 38.0 33.4 38.0 90-94 36.028 38.0 37.0 38.0 33.0 38.0 95-99 35.498200000000004 38.0 36.4 38.0 29.8 38.0 100-104 35.70305 38.0 36.2 38.0 30.6 38.0 105-109 35.42465 38.0 36.0 38.0 29.8 38.0 110-114 35.10675 38.0 35.8 38.0 28.4 38.0 115-119 34.738749999999996 38.0 35.0 38.0 26.4 38.0 120-124 34.406400000000005 38.0 34.6 38.0 25.0 38.0 125-129 33.89405 38.0 34.0 38.0 22.8 38.0 130-134 32.7081 37.4 31.8 38.0 16.2 38.0 135-139 32.0613 36.2 31.0 38.0 14.8 38.0 140-144 30.838149999999995 36.0 29.8 38.0 13.0 38.0 145-149 29.733999999999998 36.0 27.6 38.0 5.8 38.0 150-151 23.544874999999998 30.0 11.0 35.5 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 0.0 13 0.0 14 1.0 15 0.0 16 0.0 17 3.0 18 3.0 19 9.0 20 4.0 21 4.0 22 14.0 23 14.0 24 10.0 25 21.0 26 22.0 27 37.0 28 57.0 29 47.0 30 76.0 31 80.0 32 139.0 33 193.0 34 310.0 35 581.0 36 1319.0 37 1055.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 32.55935298721628 11.087920688755544 12.366292721106182 43.98643360292199 2 22.400000000000002 15.024999999999999 32.4 30.175 3 20.275000000000002 20.424999999999997 26.125 33.175 4 20.974999999999998 28.275 23.325000000000003 27.425 5 22.3 33.35 24.55 19.8 6 20.0 36.175000000000004 24.675 19.15 7 13.925 24.349999999999998 44.85 16.875 8 18.6 24.65 30.125 26.625 9 17.2 24.474999999999998 33.300000000000004 25.025 10-14 19.919999999999998 29.635 27.0 23.445 15-19 19.735 28.560000000000002 28.060000000000002 23.645 20-24 20.11 28.249999999999996 27.634999999999998 24.005000000000003 25-29 19.875 28.175 28.065 23.885 30-34 19.865 28.705000000000002 27.83 23.599999999999998 35-39 20.22 28.65 27.46 23.669999999999998 40-44 20.395 28.845 27.465 23.294999999999998 45-49 20.57 28.76 27.155 23.515 50-54 20.505000000000003 28.12 27.800000000000004 23.575 55-59 19.93 29.310000000000002 27.400000000000002 23.36 60-64 20.255000000000003 28.634999999999998 27.66 23.45 65-69 20.645 28.74 27.24 23.375 70-74 20.19 28.725 27.365000000000002 23.72 75-79 20.655 28.655 27.439999999999998 23.25 80-84 20.41 28.305000000000003 27.77 23.515 85-89 20.205000000000002 28.455000000000002 27.3 24.04 90-94 20.495 28.139999999999997 27.560000000000002 23.805 95-99 21.135 27.939999999999998 27.63 23.294999999999998 100-104 21.025 28.535 26.884999999999998 23.555 105-109 20.7 27.900000000000002 27.474999999999998 23.925 110-114 21.025 28.134999999999998 27.095000000000002 23.745 115-119 21.22 28.050000000000004 27.500000000000004 23.23 120-124 20.674999999999997 28.22 27.339999999999996 23.765 125-129 20.06 28.46 27.66 23.82 130-134 20.44 28.754999999999995 27.075 23.73 135-139 20.54 27.99 27.255000000000003 24.215 140-144 20.495 27.805000000000003 27.589999999999996 24.11 145-149 20.27 28.645 27.165 23.919999999999998 150-151 21.45 28.125 26.85 23.575 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.5 14 0.5 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 1.5 26 3.0 27 5.0 28 4.5 29 10.0 30 20.5 31 24.5 32 31.5 33 44.0 34 63.0 35 75.0 36 89.5 37 108.0 38 132.0 39 152.0 40 162.5 41 202.5 42 224.0 43 253.5 44 278.5 45 273.5 46 272.0 47 272.0 48 252.0 49 218.5 50 195.5 51 152.0 52 107.5 53 82.0 54 68.0 55 58.5 56 46.0 57 32.5 58 26.0 59 19.5 60 12.5 61 8.5 62 5.0 63 2.5 64 1.5 65 1.0 66 0.5 67 0.0 68 0.5 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.175 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.275 #Duplication Level Percentage of deduplicated Percentage of total 1 99.3704356585243 98.65 2 0.554016620498615 1.0999999999999999 3 0.0503651473180559 0.15 4 0.02518257365902795 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2125 0.0 0.0 0.0 0.0 98-99 1.35 0.0 0.0 0.0 0.0 100-101 1.4625 0.0 0.0 0.0 0.0 102-103 1.6 0.0 0.0 0.0 0.0 104-105 1.7000000000000002 0.0 0.0 0.0 0.0 106-107 1.9125 0.0 0.0 0.0 0.0 108-109 2.0999999999999996 0.0 0.0 0.0 0.0 110-111 2.3499999999999996 0.0 0.0 0.0 0.0 112-113 2.6125 0.0 0.0 0.0 0.0 114-115 2.7874999999999996 0.0 0.0 0.0 0.0 116-117 3.0250000000000004 0.0 0.0 0.0 0.0 118-119 3.2875 0.0 0.0 0.0 0.0 120-121 3.5625 0.0 0.0 0.0 0.0 122-123 3.6875 0.0 0.0 0.0 0.0 124-125 3.8875 0.0 0.0 0.0 0.0 126-127 4.1 0.0 0.0 0.0 0.0 128-129 4.3375 0.0 0.0 0.0 0.0 130-131 4.5125 0.0 0.0 0.0 0.0 132-133 4.825 0.0 0.0 0.0 0.0 134-135 5.0375 0.0 0.0 0.0 0.0 136-137 5.225 0.0 0.0 0.0 0.0 138-139 5.425 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACAGTG 10 0.006836113 144.9625 2 >>END_MODULE SRR7170493 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170493_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.98125 33.0 33.0 34.0 32.0 34.0 2 33.14625 34.0 33.0 34.0 32.0 34.0 3 33.08125 34.0 33.0 34.0 33.0 34.0 4 33.0745 34.0 33.0 34.0 32.0 34.0 5 33.07325 34.0 33.0 34.0 33.0 34.0 6 37.26425 38.0 38.0 38.0 37.0 38.0 7 37.35475 38.0 38.0 38.0 37.0 38.0 8 37.343 38.0 38.0 38.0 37.0 38.0 9 37.395 38.0 38.0 38.0 37.0 38.0 10-14 37.374 38.0 38.0 38.0 37.4 38.0 15-19 37.3164 38.0 38.0 38.0 37.0 38.0 20-24 37.3408 38.0 38.0 38.0 37.0 38.0 25-29 37.31305 38.0 38.0 38.0 37.0 38.0 30-34 37.27565 38.0 38.0 38.0 37.0 38.0 35-39 37.2961 38.0 38.0 38.0 37.0 38.0 40-44 37.30675 38.0 38.0 38.0 37.0 38.0 45-49 37.26645 38.0 38.0 38.0 37.0 38.0 50-54 37.235299999999995 38.0 38.0 38.0 37.0 38.0 55-59 37.224000000000004 38.0 38.0 38.0 36.8 38.0 60-64 37.123200000000004 38.0 38.0 38.0 36.6 38.0 65-69 37.04809999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.94815 38.0 38.0 38.0 36.0 38.0 75-79 36.91865 38.0 38.0 38.0 36.0 38.0 80-84 36.833600000000004 38.0 38.0 38.0 36.0 38.0 85-89 36.771049999999995 38.0 38.0 38.0 36.0 38.0 90-94 36.6662 38.0 38.0 38.0 35.2 38.0 95-99 36.55050000000001 38.0 38.0 38.0 34.2 38.0 100-104 36.415 38.0 38.0 38.0 34.0 38.0 105-109 36.249300000000005 38.0 38.0 38.0 34.0 38.0 110-114 36.05435 38.0 37.4 38.0 33.4 38.0 115-119 35.91555 38.0 37.0 38.0 33.0 38.0 120-124 35.5782 38.0 36.6 38.0 31.4 38.0 125-129 34.9741 38.0 36.0 38.0 28.8 38.0 130-134 34.66195 38.0 35.2 38.0 27.8 38.0 135-139 34.014799999999994 38.0 33.6 38.0 23.8 38.0 140-144 33.4077 38.0 33.0 38.0 20.2 38.0 145-149 32.609 38.0 33.0 38.0 14.4 38.0 150-151 27.105125 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 4.0 3 1.0 4 0.0 5 0.0 6 0.0 7 0.0 8 2.0 9 3.0 10 1.0 11 2.0 12 1.0 13 2.0 14 3.0 15 1.0 16 6.0 17 2.0 18 2.0 19 4.0 20 6.0 21 9.0 22 4.0 23 11.0 24 10.0 25 18.0 26 8.0 27 15.0 28 14.0 29 38.0 30 44.0 31 60.0 32 65.0 33 93.0 34 159.0 35 300.0 36 771.0 37 2341.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 32.175 17.9 20.0 29.925 2 27.725 26.125 29.9 16.25 3 21.025 29.425 30.825000000000003 18.725 4 24.425 34.5 21.875 19.2 5 23.875 36.25 21.725 18.15 6 20.3 37.824999999999996 23.625 18.25 7 19.3 21.8 39.85 19.05 8 23.125 25.775 26.275 24.825 9 21.6 27.250000000000004 29.425 21.725 10-14 23.46 28.815 26.424999999999997 21.3 15-19 23.215 27.865000000000002 27.450000000000003 21.47 20-24 23.175 28.754999999999995 27.24 20.830000000000002 25-29 23.426171308565426 28.24641232061603 27.66638331916596 20.661033051652584 30-34 22.441732519755927 28.39851955586676 27.688306491947586 21.471441432429728 35-39 23.15694708412524 28.06842052615785 27.70831249374812 21.066319895968793 40-44 22.545 28.005000000000003 27.525 21.925 45-49 23.03 27.72 27.955000000000002 21.295 50-54 22.875 28.28 27.61 21.235 55-59 23.135 27.51 27.595 21.759999999999998 60-64 22.727272727272727 27.92279227922792 27.557755775577558 21.79217921792179 65-69 22.987240430322743 27.035276457343006 28.246184638478862 21.731298473855393 70-74 23.17665315112379 27.70686289232617 27.44155779146018 21.674926165089854 75-79 22.806929701582217 27.974163829361103 27.75385539755658 21.4650510715001 80-84 23.193630764608685 28.195884031846173 27.279555355265135 21.330929848280007 85-89 23.23869610935857 28.11076060287417 27.890441139652495 20.76010214811477 90-94 23.325322919795735 27.771102433163115 27.325523180134176 21.578051466906977 95-99 23.935345043286794 27.488365110343793 27.258169444027423 21.318120402341993 100-104 23.23313159605862 28.484969739408793 27.59465813034562 20.687240534186966 105-109 23.69803391865526 27.610185602081145 27.650207614187806 21.041572865075793 110-114 23.173538831064853 27.70716573258607 28.172538030424338 20.94675740592474 115-119 24.218906469056677 28.60004005607851 26.692369317043863 20.48868415782095 120-124 24.271407110665997 28.467701552328496 26.53980971457186 20.72108162243365 125-129 24.727090635953928 27.88683024536805 27.150726089133702 20.235353029544317 130-134 24.506760140210314 27.521281922884327 27.641462193289932 20.330495743615423 135-139 24.69704556835253 27.906860290435652 27.035553329994993 20.360540811216826 140-144 24.787180771156734 27.87681522283425 27.230846269404108 20.105157736604905 145-149 24.361542313470206 28.5077616424637 27.361041562343512 19.769654481722583 150-151 25.719289467100324 27.745809357017766 27.120340255191394 19.41456092069052 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.5 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 1.0 20 1.5 21 0.5 22 1.5 23 2.5 24 1.5 25 1.5 26 2.5 27 5.5 28 6.0 29 5.5 30 11.5 31 20.5 32 22.5 33 26.5 34 47.0 35 63.5 36 70.0 37 97.5 38 134.5 39 158.5 40 188.5 41 230.0 42 251.0 43 246.5 44 257.0 45 280.0 46 271.5 47 261.5 48 262.5 49 227.5 50 185.5 51 148.0 52 112.0 53 99.5 54 80.0 55 60.0 56 45.5 57 28.0 58 23.0 59 18.0 60 14.5 61 10.5 62 5.5 63 4.5 64 2.5 65 1.0 66 1.5 67 1.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.005 30-34 0.03 35-39 0.03 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.01 65-69 0.075 70-74 0.11499999999999999 75-79 0.13999999999999999 80-84 0.145 85-89 0.145 90-94 0.13 95-99 0.08499999999999999 100-104 0.034999999999999996 105-109 0.055 110-114 0.08 115-119 0.13999999999999999 120-124 0.15 125-129 0.15 130-134 0.15 135-139 0.15 140-144 0.15 145-149 0.15 150-151 0.075 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.325 #Duplication Level Percentage of deduplicated Percentage of total 1 99.47143216712811 98.8 2 0.4027183488547697 0.8 3 0.10067958721369243 0.3 4 0.025169896803423106 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0125 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.05 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.15 0.0 0.0 0.0 0.0 82-83 0.2375 0.0 0.0 0.0 0.0 84-85 0.3125 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.6125 0.0 0.0 0.0 0.0 92-93 0.7875 0.0 0.0 0.0 0.0 94-95 1.025 0.0 0.0 0.0 0.0 96-97 1.2374999999999998 0.0 0.0 0.0 0.0 98-99 1.375 0.0 0.0 0.0 0.0 100-101 1.4874999999999998 0.0 0.0 0.0 0.0 102-103 1.65 0.0 0.0 0.0 0.0 104-105 1.75 0.0 0.0 0.0 0.0 106-107 1.9625 0.0 0.0 0.0 0.0 108-109 2.1500000000000004 0.0 0.0 0.0 0.0 110-111 2.425 0.0 0.0 0.0 0.0 112-113 2.6875 0.0 0.0 0.0 0.0 114-115 2.8625 0.0 0.0 0.0 0.0 116-117 3.0999999999999996 0.0 0.0 0.0 0.0 118-119 3.3875 0.0 0.0 0.0 0.0 120-121 3.6625 0.0 0.0 0.0 0.0 122-123 3.7874999999999996 0.0 0.0 0.0 0.0 124-125 3.9875000000000003 0.0 0.0 0.0 0.0 126-127 4.2 0.0 0.0 0.0 0.0 128-129 4.4375 0.0 0.0 0.0 0.0 130-131 4.6125 0.0 0.0 0.0 0.0 132-133 4.9 0.0 0.0 0.0 0.0 134-135 5.137499999999999 0.0 0.0 0.0 0.0 136-137 5.325 0.0 0.0 0.0 0.0 138-139 5.525 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTTTTT 45 6.8837026E-4 19.191668 35-39 >>END_MODULE Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696387 spots for SRR7170493.sra Written 696387 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra Read 696378 spots for SRR7170493.sra Written 696378 spots for SRR7170493.sra SRR ids: ['SRR7170493.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5a4ragng SRR7170493.sra spots: 13927569 blocks: [[1, 696378], [696379, 1392756], [1392757, 2089134], [2089135, 2785512], [2785513, 3481890], [3481891, 4178268], [4178269, 4874646], [4874647, 5571024], [5571025, 6267402], [6267403, 6963780], [6963781, 7660158], [7660159, 8356536], [8356537, 9052914], [9052915, 9749292], [9749293, 10445670], [10445671, 11142048], [11142049, 11838426], [11838427, 12534804], [12534805, 13231182], [13231183, 13927569]] SRR7170493 file size 4697895 SRR7170493 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170493 SRR7170493_1.fastq SRR7170493_2.fastq Input file: SRR7170493_1.fastq Paired file: SRR7170493_2.fastq trimmed: SRR7170493-trimmed-pair1.fastq, SRR7170493-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:31:49 2025 >> started Thu Feb 13 01:32:05 2025 >> done (15.790s) 13927569 read pairs processed; of these: 14292 ( 0.10%) short read pairs filtered out after trimming by size control 30921 ( 0.22%) empty read pairs filtered out after trimming by size control 13882356 (99.68%) read pairs available; of these: 9369362 (67.49%) trimmed read pairs available after processing 4512994 (32.51%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 3 0.00% 19 4 0.00% 20 3 0.00% 21 5 0.00% 22 2 0.00% 23 3 0.00% 24 5 0.00% 25 8 0.00% 26 6 0.00% 27 8 0.00% 28 6 0.00% 29 8 0.00% 30 6 0.00% 31 37 0.00% 32 4 0.00% 33 12 0.00% 34 8 0.00% 35 22 0.00% 36 22 0.00% 37 20 0.00% 38 39 0.00% 39 39 0.00% 40 39 0.00% 41 62 0.00% 42 49 0.00% 43 62 0.00% 44 69 0.00% 45 84 0.00% 46 73 0.00% 47 85 0.00% 48 116 0.00% 49 117 0.00% 50 139 0.00% 51 184 0.00% 52 197 0.00% 53 226 0.00% 54 219 0.00% 55 226 0.00% 56 305 0.00% 57 298 0.00% 58 310 0.00% 59 401 0.00% 60 475 0.00% 61 573 0.00% 62 623 0.00% 63 699 0.01% 64 744 0.01% 65 777 0.01% 66 827 0.01% 67 919 0.01% 68 962 0.01% 69 1041 0.01% 70 1300 0.01% 71 1462 0.01% 72 1718 0.01% 73 1967 0.01% 74 2084 0.02% 75 2342 0.02% 76 2419 0.02% 77 2595 0.02% 78 2802 0.02% 79 3001 0.02% 80 3427 0.02% 81 3829 0.03% 82 4456 0.03% 83 4975 0.04% 84 6052 0.04% 85 6180 0.04% 86 6172 0.04% 87 6497 0.05% 88 6734 0.05% 89 7014 0.05% 90 7362 0.05% 91 7981 0.06% 92 8480 0.06% 93 9042 0.07% 94 9820 0.07% 95 10312 0.07% 96 10473 0.08% 97 10867 0.08% 98 10999 0.08% 99 11122 0.08% 100 11760 0.08% 101 12174 0.09% 102 12798 0.09% 103 13543 0.10% 104 14347 0.10% 105 14967 0.11% 106 15589 0.11% 107 15445 0.11% 108 15894 0.11% 109 15892 0.11% 110 16162 0.12% 111 16300 0.12% 112 17560 0.13% 113 18497 0.13% 114 19611 0.14% 115 20395 0.15% 116 21207 0.15% 117 21892 0.16% 118 22459 0.16% 119 23006 0.17% 120 23663 0.17% 121 24955 0.18% 122 26256 0.19% 123 27713 0.20% 124 29345 0.21% 125 30832 0.22% 126 33239 0.24% 127 34856 0.25% 128 36758 0.26% 129 39064 0.28% 130 41659 0.30% 131 44561 0.32% 132 48687 0.35% 133 52975 0.38% 134 57187 0.41% 135 63338 0.46% 136 69456 0.50% 137 77698 0.56% 138 85683 0.62% 139 96755 0.70% 140 110259 0.79% 141 125084 0.90% 142 144990 1.04% 143 172435 1.24% 144 210488 1.52% 145 265871 1.92% 146 348640 2.51% 147 486056 3.50% 148 740304 5.33% 149 1349182 9.72% 150 3947220 28.43% 151 4512994 32.51% 13882356 reads passed initial QC criterion=sequence-density sequence-density=0.64 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=25 prefix-density=0.64 prefix-fanout=2.0 sequence=CGGTAGACCCAACCTTTCTCCAACTCGAATTCCAAGCAAGGAACCCACTT criterion=fanout-score sequence-density=0.01 sequence-density-rank=25 fanout-score=113.73 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=12.2 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=0.69 sequence-density-rank=1 fanout-score=1.98 fanout-score-rank=23 prefix-density=0.69 prefix-fanout=2.0 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=24 fanout-score=61.73 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=9.5 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7170493 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:32:46 Started mapping on | Feb 13 01:32:47 Finished on | Feb 13 01:34:20 Mapping speed, Million of reads per hour | 537.38 Number of input reads | 13882356 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 12994381 Uniquely mapped reads % | 93.60% Average mapped length | 292.33 Number of splices: Total | 12579986 Number of splices: Annotated (sjdb) | 12313481 Number of splices: GT/AG | 12341144 Number of splices: GC/AG | 198871 Number of splices: AT/AC | 8393 Number of splices: Non-canonical | 31578 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.02% Deletion average length | 2.59 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 346991 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 44571 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.51% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 549860 549860 549860 N_multimapping 346991 346991 346991 N_noFeature 371169 12800915 432981 N_ambiguous 226049 682 94098 UnstrandedReadsAssigned:12397163 PositiveStrandReadsAssigned:192784 NegativeStrandReadsAssigned:12467302 Dataset is classified negative stranded MeadianReadLen=150 20thPercentileLength=145 echo kmer=141 SRR7170493 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170493-trimmed-pair1.fastq SRR7170493-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 13,882,356 reads, 12,470,467 reads pseudoaligned [quant] estimated average fragment length: 281.889 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,074 rounds 52401 SRR7170493.ke.tsv 34699 SRR7170493.se.tsv 87100 total ==> SRR7170493.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1737.11 457 19.8454 Potri.005G024800.1.v4.1 1035 754.111 151 15.1047 Potri.004G059700.1.v4.1 961 680.15 3 0.332727 Potri.007G009000.2.v4.1 1416 1135.11 0 0 Potri.003G141000.2.v4.1 2943 2662.11 360 10.2011 Potri.016G087400.1.v4.1 270 75.8957 580 576.478 Potri.015G069301.1.v4.1 564 288.919 0 0 Potri.010G195200.1.v4.1 1773 1492.11 5 0.252779 Potri.012G127500.1.v4.1 977 696.134 281 30.4499 ==> SRR7170493.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 167 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 346 Potri.001G212900.v4.1 77 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 2 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 72 SRR7170493 completed mapping pipeline successfully