Starting /dee2/code/volunteer_pipeline.sh SRR7170494 current disk space = 3052078575616 free memory = 1582150704 SRR7170494 SRAfilesize 8563a9772b47cbcba85f4d44c9fee6fc SRR7170494.sra SRR7170494.sra file validated SRR7170494 is paired end SRR7170494 is conventional basespace SRR7170494 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170494_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 20.28575 18.0 18.0 25.0 18.0 32.0 2 29.479 30.0 27.0 31.0 27.0 33.0 3 30.71975 31.0 29.0 33.0 27.0 33.0 4 31.85125 33.0 31.0 33.0 29.0 33.0 5 32.7995 33.0 33.0 33.0 32.0 34.0 6 36.97275 38.0 37.0 38.0 35.0 38.0 7 37.3675 38.0 38.0 38.0 37.0 38.0 8 37.46025 38.0 38.0 38.0 37.0 38.0 9 37.4495 38.0 38.0 38.0 37.0 38.0 10-14 37.5064 38.0 38.0 38.0 37.0 38.0 15-19 37.52375 38.0 38.0 38.0 37.0 38.0 20-24 37.3908 38.0 38.0 38.0 36.8 38.0 25-29 37.444950000000006 38.0 38.0 38.0 37.0 38.0 30-34 37.388149999999996 38.0 38.0 38.0 37.0 38.0 35-39 37.3643 38.0 38.0 38.0 37.0 38.0 40-44 37.3137 38.0 38.0 38.0 36.6 38.0 45-49 37.22345 38.0 38.0 38.0 36.0 38.0 50-54 37.150549999999996 38.0 38.0 38.0 36.0 38.0 55-59 36.96169999999999 38.0 38.0 38.0 35.2 38.0 60-64 36.91825 38.0 38.0 38.0 35.2 38.0 65-69 36.88415 38.0 38.0 38.0 35.0 38.0 70-74 36.73795 38.0 38.0 38.0 34.2 38.0 75-79 36.58 38.0 37.6 38.0 34.0 38.0 80-84 36.61745 38.0 37.8 38.0 34.2 38.0 85-89 36.31735 38.0 37.0 38.0 33.6 38.0 90-94 36.1738 38.0 37.0 38.0 33.0 38.0 95-99 36.0407 38.0 37.0 38.0 32.4 38.0 100-104 36.020399999999995 38.0 37.0 38.0 33.0 38.0 105-109 35.660900000000005 38.0 36.0 38.0 31.0 38.0 110-114 35.51265 38.0 36.0 38.0 30.2 38.0 115-119 34.9892 38.0 35.0 38.0 27.8 38.0 120-124 34.997249999999994 38.0 35.0 38.0 28.0 38.0 125-129 34.6597 38.0 34.6 38.0 27.0 38.0 130-134 31.15595 34.2 27.4 37.8 17.6 38.0 135-139 33.054050000000004 37.2 32.6 38.0 21.0 38.0 140-144 29.215200000000003 32.8 24.0 37.2 14.0 38.0 145-149 30.911250000000003 35.8 31.0 38.0 11.0 38.0 150-151 26.390375 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 0.0 11 1.0 12 0.0 13 2.0 14 0.0 15 0.0 16 1.0 17 3.0 18 1.0 19 2.0 20 1.0 21 5.0 22 2.0 23 6.0 24 10.0 25 16.0 26 15.0 27 17.0 28 30.0 29 41.0 30 62.0 31 86.0 32 128.0 33 197.0 34 355.0 35 739.0 36 1428.0 37 851.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.92027097446587 11.073475768629494 13.78322042730589 38.22303282959875 2 21.76088044022011 15.282641320660332 33.01650825412706 29.939969984992498 3 19.375 18.75 26.525 35.35 4 23.400000000000002 27.575 22.225 26.8 5 21.7 33.025 25.374999999999996 19.900000000000002 6 19.025 35.025 24.95 21.0 7 14.524999999999999 25.95 41.925000000000004 17.599999999999998 8 18.525 25.25 31.85 24.375 9 16.6 25.4 33.175 24.825 10-14 19.625 30.17 27.655 22.55 15-19 19.650000000000002 28.79 27.595 23.965 20-24 19.645000000000003 28.77 27.735 23.849999999999998 25-29 19.63 29.049999999999997 28.084999999999997 23.235 30-34 19.195 28.505000000000003 28.134999999999998 24.165 35-39 19.845 29.054999999999996 27.589999999999996 23.51 40-44 19.965 28.765 27.74 23.53 45-49 19.509999999999998 29.025000000000002 27.735 23.73 50-54 19.39 29.404999999999998 27.860000000000003 23.345 55-59 19.935 28.765 27.810000000000002 23.49 60-64 20.04 28.74 27.68 23.54 65-69 19.75 28.205000000000002 28.165000000000003 23.880000000000003 70-74 19.715 28.96 27.365000000000002 23.96 75-79 20.695 28.29 27.775 23.24 80-84 19.8 28.999999999999996 27.235 23.965 85-89 20.405 28.405 27.66 23.53 90-94 20.200000000000003 28.67 27.229999999999997 23.9 95-99 20.599999999999998 27.275 28.035 24.09 100-104 20.205000000000002 28.585 27.48 23.73 105-109 20.57 28.23 27.245 23.955000000000002 110-114 20.495 28.79 26.77 23.945 115-119 20.915 28.18 27.205000000000002 23.7 120-124 20.86 27.800000000000004 27.860000000000003 23.48 125-129 20.5 28.215 27.275 24.01 130-134 20.655 28.035 27.400000000000002 23.91 135-139 20.755000000000003 28.08 27.689999999999998 23.474999999999998 140-144 20.78 28.349999999999998 27.24 23.630000000000003 145-149 20.674999999999997 27.310000000000002 28.23 23.785 150-151 21.125 28.487499999999997 26.674999999999997 23.7125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.5 24 3.0 25 3.5 26 4.0 27 8.0 28 11.5 29 14.5 30 19.0 31 28.0 32 39.0 33 51.5 34 65.5 35 78.5 36 107.5 37 124.5 38 135.5 39 166.0 40 197.5 41 224.0 42 230.0 43 252.0 44 258.0 45 237.0 46 237.5 47 240.0 48 233.0 49 209.5 50 177.5 51 146.5 52 119.0 53 93.5 54 74.0 55 57.5 56 36.0 57 28.0 58 24.0 59 21.0 60 18.5 61 8.5 62 5.0 63 3.0 64 1.0 65 1.5 66 1.0 67 0.5 68 1.0 69 1.0 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.05 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.125 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19293820933164 98.32499999999999 2 0.7313997477931904 1.4500000000000002 3 0.07566204287515763 0.22499999999999998 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.2375 0.0 0.0 0.0 0.0 78-79 0.275 0.0 0.0 0.0 0.0 80-81 0.3 0.0 0.0 0.0 0.0 82-83 0.3375 0.0 0.0 0.0 0.0 84-85 0.4375 0.0 0.0 0.0 0.0 86-87 0.4875 0.0 0.0 0.0 0.0 88-89 0.525 0.0 0.0 0.0 0.0 90-91 0.7250000000000001 0.0 0.0 0.0 0.0 92-93 0.8875 0.0 0.0 0.0 0.0 94-95 0.9624999999999999 0.0 0.0 0.0 0.0 96-97 1.025 0.0 0.0 0.0 0.0 98-99 1.075 0.0 0.0 0.0 0.0 100-101 1.225 0.0 0.0 0.0 0.0 102-103 1.375 0.0 0.0 0.0 0.0 104-105 1.5499999999999998 0.0 0.0 0.0 0.0 106-107 1.675 0.0 0.0 0.0 0.0 108-109 1.7999999999999998 0.0 0.0 0.0 0.0 110-111 1.8875000000000002 0.0 0.0 0.0 0.0 112-113 2.125 0.0 0.0 0.0 0.0 114-115 2.3375 0.0 0.0 0.0 0.0 116-117 2.625 0.0 0.0 0.0 0.0 118-119 3.075 0.0 0.0 0.0 0.0 120-121 3.3499999999999996 0.0 0.0 0.0 0.0 122-123 3.55 0.0 0.0 0.0 0.0 124-125 3.7 0.0 0.0 0.0 0.0 126-127 3.8625 0.0 0.0 0.0 0.0 128-129 4.1 0.0 0.0 0.0 0.0 130-131 4.262499999999999 0.0 0.0 0.0 0.0 132-133 4.487500000000001 0.0 0.0 0.0 0.0 134-135 4.6875 0.0 0.0 0.0 0.0 136-137 5.0 0.0 0.0 0.0 0.0 138-139 5.300000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CACTCCG 10 0.0068378756 144.95 145 >>END_MODULE SRR7170494 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170494_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.121 33.0 33.0 34.0 33.0 34.0 2 33.144 34.0 33.0 34.0 33.0 34.0 3 33.233 34.0 33.0 34.0 33.0 34.0 4 33.228 34.0 33.0 34.0 33.0 34.0 5 33.20575 34.0 33.0 34.0 33.0 34.0 6 37.4785 38.0 38.0 38.0 38.0 38.0 7 37.4295 38.0 38.0 38.0 38.0 38.0 8 37.41425 38.0 38.0 38.0 37.0 38.0 9 37.4155 38.0 38.0 38.0 38.0 38.0 10-14 37.3436 38.0 38.0 38.0 37.0 38.0 15-19 36.219800000000006 38.0 37.0 38.0 31.0 38.0 20-24 37.19689999999999 38.0 38.0 38.0 37.0 38.0 25-29 37.06935 38.0 38.0 38.0 36.8 38.0 30-34 37.18050000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.25625 38.0 38.0 38.0 37.0 38.0 40-44 37.204950000000004 38.0 38.0 38.0 37.0 38.0 45-49 37.15665 38.0 38.0 38.0 37.0 38.0 50-54 37.1152 38.0 38.0 38.0 36.4 38.0 55-59 37.135850000000005 38.0 38.0 38.0 36.6 38.0 60-64 37.0805 38.0 38.0 38.0 36.2 38.0 65-69 37.076499999999996 38.0 38.0 38.0 36.2 38.0 70-74 36.972849999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.92095 38.0 38.0 38.0 36.0 38.0 80-84 36.89705 38.0 38.0 38.0 36.0 38.0 85-89 36.4868 38.0 37.8 38.0 33.8 38.0 90-94 34.43535 37.6 33.8 38.0 24.0 38.0 95-99 36.449200000000005 38.0 37.8 38.0 34.0 38.0 100-104 36.4278 38.0 38.0 38.0 34.0 38.0 105-109 36.236749999999994 38.0 37.6 38.0 34.0 38.0 110-114 36.1094 38.0 37.0 38.0 33.8 38.0 115-119 35.888600000000004 38.0 37.0 38.0 32.8 38.0 120-124 35.3259 38.0 36.2 38.0 30.6 38.0 125-129 35.075399999999995 38.0 36.0 38.0 29.6 38.0 130-134 34.6323 38.0 35.0 38.0 27.8 38.0 135-139 33.87095000000001 38.0 33.0 38.0 23.4 38.0 140-144 33.07245 38.0 33.0 38.0 19.8 38.0 145-149 31.871249999999996 38.0 32.2 38.0 10.4 38.0 150-151 25.83775 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 3.0 3 2.0 4 2.0 5 1.0 6 1.0 7 0.0 8 3.0 9 1.0 10 1.0 11 1.0 12 1.0 13 1.0 14 1.0 15 3.0 16 4.0 17 3.0 18 8.0 19 2.0 20 3.0 21 6.0 22 3.0 23 8.0 24 7.0 25 16.0 26 20.0 27 20.0 28 28.0 29 33.0 30 41.0 31 61.0 32 66.0 33 123.0 34 216.0 35 365.0 36 940.0 37 2006.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 35.9 21.75 13.600000000000001 28.749999999999996 2 26.625 26.424999999999997 30.725 16.225 3 19.900000000000002 28.725 30.55 20.825 4 21.425 34.5 23.875 20.200000000000003 5 23.375 36.275 23.175 17.175 6 20.375 37.824999999999996 23.724999999999998 18.075 7 19.375 22.400000000000002 38.475 19.75 8 21.325 26.575 27.375 24.725 9 22.325 23.7 30.099999999999998 23.875 10-14 23.34 28.98 26.415 21.265 15-19 22.64 28.125 28.27 20.965 20-24 22.7 28.355000000000004 27.794999999999998 21.15 25-29 22.96 28.48 27.6 20.96 30-34 22.895 28.07 28.075 20.96 35-39 22.314999999999998 28.575 28.23 20.880000000000003 40-44 23.23 28.255000000000003 27.395000000000003 21.12 45-49 22.8 28.075 27.82 21.305 50-54 22.625 28.425 27.805000000000003 21.145 55-59 22.915 28.444999999999997 27.735 20.905 60-64 22.98 27.97 27.915 21.135 65-69 23.395 27.744999999999997 27.76 21.099999999999998 70-74 23.474999999999998 27.165 28.249999999999996 21.11 75-79 22.48 27.715 27.815 21.990000000000002 80-84 23.080000000000002 27.93 27.63 21.36 85-89 23.385 27.694999999999997 28.02 20.9 90-94 23.200000000000003 28.199999999999996 27.279999999999998 21.32 95-99 23.64 27.905 27.515 20.94 100-104 23.415 28.17 27.565 20.849999999999998 105-109 23.51 27.905 27.715 20.87 110-114 24.404999999999998 27.68 27.6 20.315 115-119 23.915 28.044999999999998 27.595 20.445 120-124 24.27 28.449999999999996 27.29 19.99 125-129 24.91 28.015 27.355 19.72 130-134 24.205 27.375 27.41 21.01 135-139 24.355 28.000000000000004 27.435 20.21 140-144 24.535 28.46 27.02 19.985 145-149 25.135 28.21 27.21 19.445 150-151 24.5 28.9375 27.55 19.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.5 23 1.0 24 2.0 25 3.5 26 3.5 27 4.5 28 8.0 29 11.5 30 14.5 31 26.5 32 32.0 33 39.0 34 59.5 35 76.5 36 91.5 37 107.0 38 129.5 39 151.5 40 177.0 41 217.5 42 246.0 43 261.5 44 276.0 45 277.5 46 264.0 47 257.0 48 231.5 49 190.0 50 168.5 51 140.5 52 113.5 53 102.5 54 93.0 55 69.0 56 39.0 57 29.0 58 23.0 59 16.0 60 12.5 61 7.0 62 5.0 63 6.0 64 7.0 65 3.0 66 0.0 67 1.0 68 1.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.11526794742164 98.02499999999999 2 0.7583417593528816 1.5 3 0.05055611729019212 0.15 4 0.05055611729019212 0.2 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CAGAGAACACATTCATACCCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.075 0.0 0.0 0.0 0.0 72-73 0.1125 0.0 0.0 0.0 0.0 74-75 0.15 0.0 0.0 0.0 0.0 76-77 0.225 0.0 0.0 0.0 0.0 78-79 0.25 0.0 0.0 0.0 0.0 80-81 0.275 0.0 0.0 0.0 0.0 82-83 0.3125 0.0 0.0 0.0 0.0 84-85 0.4125 0.0 0.0 0.0 0.0 86-87 0.4625 0.0 0.0 0.0 0.0 88-89 0.5 0.0 0.0 0.0 0.0 90-91 0.675 0.0 0.0 0.0 0.0 92-93 0.7875000000000001 0.0 0.0 0.0 0.0 94-95 0.8625 0.0 0.0 0.0 0.0 96-97 0.925 0.0 0.0 0.0 0.0 98-99 0.975 0.0 0.0 0.0 0.0 100-101 1.125 0.0 0.0 0.0 0.0 102-103 1.275 0.0 0.0 0.0 0.0 104-105 1.4500000000000002 0.0 0.0 0.0 0.0 106-107 1.575 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 1.8125 0.0 0.0 0.0 0.0 112-113 2.05 0.0 0.0 0.0 0.0 114-115 2.2875 0.0 0.0 0.0 0.0 116-117 2.575 0.0 0.0 0.0 0.0 118-119 3.0374999999999996 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.625 0.0 0.0 0.0 0.0 124-125 3.925 0.0 0.0 0.0 0.0 126-127 4.225 0.0 0.0 0.0 0.0 128-129 4.5 0.0 0.0 0.0 0.0 130-131 4.75 0.0 0.0 0.0 0.0 132-133 5.050000000000001 0.0 0.0 0.0 0.0 134-135 5.3125 0.0 0.0 0.0 0.0 136-137 5.675 0.0 0.0 0.0 0.0 138-139 6.050000000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708114 spots for SRR7170494.sra Written 708114 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra Read 708112 spots for SRR7170494.sra Written 708112 spots for SRR7170494.sra SRR ids: ['SRR7170494.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_mamt257v SRR7170494.sra spots: 14162242 blocks: [[1, 708112], [708113, 1416224], [1416225, 2124336], [2124337, 2832448], [2832449, 3540560], [3540561, 4248672], [4248673, 4956784], [4956785, 5664896], [5664897, 6373008], [6373009, 7081120], [7081121, 7789232], [7789233, 8497344], [8497345, 9205456], [9205457, 9913568], [9913569, 10621680], [10621681, 11329792], [11329793, 12037904], [12037905, 12746016], [12746017, 13454128], [13454129, 14162242]] SRR7170494 file size 4777418 SRR7170494 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170494 SRR7170494_1.fastq SRR7170494_2.fastq Input file: SRR7170494_1.fastq Paired file: SRR7170494_2.fastq trimmed: SRR7170494-trimmed-pair1.fastq, SRR7170494-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:32:20 2025 >> started Thu Feb 13 04:44:01 2025 >> done (700.978s) 14162242 read pairs processed; of these: 8548 ( 0.06%) short read pairs filtered out after trimming by size control 11223 ( 0.08%) empty read pairs filtered out after trimming by size control 14142471 (99.86%) read pairs available; of these: 8519178 (60.24%) trimmed read pairs available after processing 5623293 (39.76%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 2 0.00% 20 5 0.00% 21 1 0.00% 22 3 0.00% 23 3 0.00% 24 4 0.00% 25 5 0.00% 26 3 0.00% 27 4 0.00% 28 3 0.00% 29 4 0.00% 30 7 0.00% 31 14 0.00% 32 6 0.00% 33 13 0.00% 34 10 0.00% 35 10 0.00% 36 14 0.00% 37 14 0.00% 38 13 0.00% 39 25 0.00% 40 22 0.00% 41 28 0.00% 42 22 0.00% 43 35 0.00% 44 25 0.00% 45 47 0.00% 46 49 0.00% 47 61 0.00% 48 65 0.00% 49 83 0.00% 50 98 0.00% 51 110 0.00% 52 139 0.00% 53 123 0.00% 54 154 0.00% 55 160 0.00% 56 172 0.00% 57 231 0.00% 58 241 0.00% 59 302 0.00% 60 380 0.00% 61 427 0.00% 62 444 0.00% 63 520 0.00% 64 593 0.00% 65 611 0.00% 66 682 0.00% 67 742 0.01% 68 810 0.01% 69 935 0.01% 70 1149 0.01% 71 1302 0.01% 72 1449 0.01% 73 1713 0.01% 74 1761 0.01% 75 1982 0.01% 76 2201 0.02% 77 2409 0.02% 78 2528 0.02% 79 2793 0.02% 80 3180 0.02% 81 3506 0.02% 82 4053 0.03% 83 4325 0.03% 84 5352 0.04% 85 6026 0.04% 86 6011 0.04% 87 6416 0.05% 88 6944 0.05% 89 7181 0.05% 90 7783 0.06% 91 8323 0.06% 92 8825 0.06% 93 9753 0.07% 94 10310 0.07% 95 10966 0.08% 96 11231 0.08% 97 11832 0.08% 98 11924 0.08% 99 12330 0.09% 100 13165 0.09% 101 13474 0.10% 102 13909 0.10% 103 14856 0.11% 104 15448 0.11% 105 16171 0.11% 106 16575 0.12% 107 16879 0.12% 108 17161 0.12% 109 17537 0.12% 110 17823 0.13% 111 18357 0.13% 112 19326 0.14% 113 19995 0.14% 114 20628 0.15% 115 21530 0.15% 116 22160 0.16% 117 23029 0.16% 118 23153 0.16% 119 23504 0.17% 120 24443 0.17% 121 25015 0.18% 122 25590 0.18% 123 27039 0.19% 124 28301 0.20% 125 29342 0.21% 126 30848 0.22% 127 31956 0.23% 128 33605 0.24% 129 34799 0.25% 130 36724 0.26% 131 38719 0.27% 132 40831 0.29% 133 43903 0.31% 134 47349 0.33% 135 51103 0.36% 136 55724 0.39% 137 61467 0.43% 138 68124 0.48% 139 75928 0.54% 140 86073 0.61% 141 97475 0.69% 142 113102 0.80% 143 135817 0.96% 144 164398 1.16% 145 207456 1.47% 146 269873 1.91% 147 382038 2.70% 148 594329 4.20% 149 1146595 8.11% 150 3962498 28.02% 151 5623293 39.76% 14142471 reads passed initial QC criterion=sequence-density sequence-density=0.68 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=16 prefix-density=0.68 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAG criterion=fanout-score sequence-density=0.02 sequence-density-rank=23 fanout-score=46.18 fanout-score-rank=1 prefix-density=0.12 prefix-fanout=8.5 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.99 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=18 prefix-density=0.98 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.31 sequence-density-rank=13 fanout-score=6.15 fanout-score-rank=1 prefix-density=0.46 prefix-fanout=4.1 sequence=AAGAAAGCTTACCCTAAC SRR7170494 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:31:12 Started mapping on | Feb 13 05:31:24 Finished on | Feb 13 05:55:14 Mapping speed, Million of reads per hour | 35.60 Number of input reads | 14142471 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 13323939 Uniquely mapped reads % | 94.21% Average mapped length | 292.93 Number of splices: Total | 12788246 Number of splices: Annotated (sjdb) | 12505334 Number of splices: GT/AG | 12544447 Number of splices: GC/AG | 199457 Number of splices: AT/AC | 7725 Number of splices: Non-canonical | 36617 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 415867 % of reads mapped to multiple loci | 2.94% Number of reads mapped to too many loci | 63016 % of reads mapped to too many loci | 0.45% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.30% % of reads unmapped: other | 0.10% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 411458 411458 411458 N_multimapping 415867 415867 415867 N_noFeature 505768 13069921 595275 N_ambiguous 270474 1019 105317 UnstrandedReadsAssigned:12547697 PositiveStrandReadsAssigned:252999 NegativeStrandReadsAssigned:12623347 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170494 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170494-trimmed-pair1.fastq SRR7170494-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,142,471 reads, 12,584,662 reads pseudoaligned [quant] estimated average fragment length: 273.277 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170494.ke.tsv 34699 SRR7170494.se.tsv 87100 total ==> SRR7170494.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1745.72 634 25.4057 Potri.005G024800.1.v4.1 1035 762.723 145 13.299 Potri.004G059700.1.v4.1 961 688.739 9 0.914122 Potri.007G009000.2.v4.1 1416 1143.72 0 0 Potri.003G141000.2.v4.1 2943 2670.72 520 13.6204 Potri.016G087400.1.v4.1 270 77.8716 654 587.51 Potri.015G069301.1.v4.1 564 298.037 0 0 Potri.010G195200.1.v4.1 1773 1500.72 25 1.16535 Potri.012G127500.1.v4.1 977 704.739 167 16.5769 ==> SRR7170494.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1213 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 317 Potri.001G212900.v4.1 24 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 142 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170494 completed mapping pipeline successfully