Starting /dee2/code/volunteer_pipeline.sh SRR7170495 current disk space = 3052266631168 free memory = 1478724560 SRR7170495 SRAfilesize 2d4b1e5e4a5d58cdc8a46e7c4a3a05f6 SRR7170495.sra SRR7170495.sra file validated SRR7170495 is paired end SRR7170495 is conventional basespace SRR7170495 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170495_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.702 30.0 18.0 33.0 18.0 33.0 2 30.13875 31.0 29.0 33.0 27.0 33.0 3 31.33825 33.0 31.0 33.0 27.0 33.0 4 32.3155 33.0 33.0 33.0 31.0 34.0 5 32.957 33.0 33.0 34.0 32.0 34.0 6 37.07925 38.0 37.0 38.0 36.0 38.0 7 37.47825 38.0 38.0 38.0 37.0 38.0 8 37.5775 38.0 38.0 38.0 37.0 38.0 9 37.68175 38.0 38.0 38.0 38.0 38.0 10-14 37.6378 38.0 38.0 38.0 38.0 38.0 15-19 37.5793 38.0 38.0 38.0 38.0 38.0 20-24 37.585499999999996 38.0 38.0 38.0 38.0 38.0 25-29 37.571749999999994 38.0 38.0 38.0 38.0 38.0 30-34 37.546749999999996 38.0 38.0 38.0 38.0 38.0 35-39 37.4987 38.0 38.0 38.0 37.8 38.0 40-44 37.4709 38.0 38.0 38.0 37.0 38.0 45-49 37.459649999999996 38.0 38.0 38.0 37.0 38.0 50-54 37.3139 38.0 38.0 38.0 37.0 38.0 55-59 37.22805 38.0 38.0 38.0 36.0 38.0 60-64 37.1572 38.0 38.0 38.0 36.0 38.0 65-69 37.144349999999996 38.0 38.0 38.0 36.0 38.0 70-74 37.0606 38.0 38.0 38.0 35.8 38.0 75-79 36.902699999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.805949999999996 38.0 38.0 38.0 35.0 38.0 85-89 36.7271 38.0 38.0 38.0 35.0 38.0 90-94 36.628949999999996 38.0 38.0 38.0 34.0 38.0 95-99 36.5584 38.0 37.8 38.0 34.0 38.0 100-104 36.228750000000005 38.0 37.2 38.0 33.8 38.0 105-109 36.1471 38.0 37.0 38.0 33.2 38.0 110-114 35.92790000000001 38.0 37.0 38.0 32.8 38.0 115-119 35.70515 38.0 36.2 38.0 31.0 38.0 120-124 35.39300000000001 38.0 36.0 38.0 29.6 38.0 125-129 35.0842 38.0 35.4 38.0 28.2 38.0 130-134 34.720749999999995 38.0 34.8 38.0 27.2 38.0 135-139 34.30035 38.0 33.4 38.0 26.0 38.0 140-144 33.56635 38.0 33.0 38.0 22.2 38.0 145-149 32.31035000000001 38.0 32.8 38.0 12.8 38.0 150-151 26.618000000000002 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 8 1.0 9 0.0 10 1.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 2.0 17 2.0 18 2.0 19 2.0 20 3.0 21 1.0 22 7.0 23 11.0 24 7.0 25 12.0 26 13.0 27 14.0 28 23.0 29 35.0 30 39.0 31 43.0 32 62.0 33 122.0 34 190.0 35 446.0 36 1102.0 37 1857.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 40.405904059040594 10.04217185028993 9.488666315234582 40.0632577754349 2 21.675 15.425 36.675000000000004 26.224999999999998 3 18.825 20.1 28.000000000000004 33.074999999999996 4 22.2 29.4 22.6 25.8 5 22.725 33.4 25.025 18.85 6 19.175 34.275 26.75 19.8 7 14.224999999999998 23.9 43.175000000000004 18.7 8 18.05 24.575 32.1 25.275 9 16.75 24.4 34.025 24.825 10-14 19.325 29.715000000000003 27.43 23.53 15-19 19.405 28.694999999999997 27.955000000000002 23.945 20-24 19.88 28.720000000000002 27.93 23.47 25-29 19.73 29.349999999999998 27.935 22.985 30-34 19.555 28.994999999999997 28.21 23.24 35-39 19.744999999999997 28.7 27.584999999999997 23.97 40-44 19.725 29.425 27.775 23.075000000000003 45-49 19.39 28.595 28.315 23.7 50-54 19.905 28.89 28.09 23.115 55-59 19.455 28.585 28.37 23.59 60-64 19.785 28.305000000000003 28.384999999999998 23.525 65-69 19.965 29.110000000000003 27.905 23.02 70-74 20.03 28.82 27.575 23.575 75-79 19.6 28.660000000000004 28.000000000000004 23.74 80-84 20.0 28.43 27.58 23.990000000000002 85-89 19.85 28.199999999999996 28.33 23.62 90-94 20.095 28.185 28.17 23.549999999999997 95-99 20.16 28.765 28.294999999999998 22.78 100-104 20.24 28.65 27.334999999999997 23.775 105-109 20.080000000000002 28.645 27.515 23.76 110-114 20.21 28.715000000000003 27.67 23.405 115-119 20.16 28.615000000000002 27.639999999999997 23.585 120-124 20.495 28.494999999999997 27.35 23.66 125-129 20.285 28.27 27.49 23.955000000000002 130-134 20.185 29.054999999999996 26.735 24.025 135-139 20.215 27.634999999999998 28.055000000000003 24.095 140-144 20.09 28.465 27.689999999999998 23.755000000000003 145-149 19.71 28.285 27.855 24.15 150-151 19.9375 28.4375 27.6125 24.0125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.0 20 0.5 21 0.5 22 0.5 23 1.5 24 2.0 25 3.5 26 5.0 27 10.0 28 16.5 29 16.0 30 15.0 31 23.0 32 35.0 33 51.0 34 65.0 35 72.0 36 98.5 37 122.5 38 150.0 39 181.0 40 200.5 41 234.0 42 244.5 43 256.0 44 280.0 45 279.0 46 255.5 47 242.0 48 234.5 49 201.0 50 170.0 51 130.5 52 93.0 53 79.5 54 61.0 55 45.0 56 33.0 57 23.0 58 24.0 59 17.0 60 7.5 61 5.0 62 5.5 63 5.5 64 2.0 65 0.5 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content warn #Base N-Count 1 5.1499999999999995 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.875 #Duplication Level Percentage of deduplicated Percentage of total 1 99.89987484355444 99.775 2 0.0750938673341677 0.15 3 0.025031289111389236 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.925 0.0 0.0 0.0 0.0 102-103 1.1375000000000002 0.0 0.0 0.0 0.0 104-105 1.3875000000000002 0.0 0.0 0.0 0.0 106-107 1.625 0.0 0.0 0.0 0.0 108-109 1.9 0.0 0.0 0.0 0.0 110-111 2.0875 0.0 0.0 0.0 0.0 112-113 2.3125 0.0 0.0 0.0 0.0 114-115 2.5250000000000004 0.0 0.0 0.0 0.0 116-117 2.7875 0.0 0.0 0.0 0.0 118-119 3.0625 0.0 0.0 0.0 0.0 120-121 3.375 0.0 0.0 0.0 0.0 122-123 3.5875 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.25 0.0 0.0 0.0 0.0 128-129 4.5625 0.0 0.0 0.0 0.0 130-131 4.800000000000001 0.0 0.0 0.0 0.0 132-133 5.075 0.0 0.0 0.0 0.0 134-135 5.487500000000001 0.0 0.0 0.0 0.0 136-137 5.8375 0.0 0.0 0.0 0.0 138-139 6.0625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TATAAAA 10 0.0068396386 144.9375 7 ACTTATA 10 0.0068396386 144.9375 4 CTTATAA 10 0.0068396386 144.9375 5 >>END_MODULE SRR7170495 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170495_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.804 33.0 33.0 34.0 32.0 34.0 2 33.02575 34.0 33.0 34.0 32.0 34.0 3 33.09625 34.0 33.0 34.0 32.0 34.0 4 33.06875 34.0 33.0 34.0 32.0 34.0 5 32.99525 34.0 33.0 34.0 32.0 34.0 6 37.251 38.0 38.0 38.0 37.0 38.0 7 37.3115 38.0 38.0 38.0 37.0 38.0 8 37.31775 38.0 38.0 38.0 37.0 38.0 9 37.28875 38.0 38.0 38.0 37.0 38.0 10-14 37.2906 38.0 38.0 38.0 37.0 38.0 15-19 37.24934999999999 38.0 38.0 38.0 37.0 38.0 20-24 37.204750000000004 38.0 38.0 38.0 37.0 38.0 25-29 37.209700000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.09695000000001 38.0 38.0 38.0 37.0 38.0 35-39 37.144000000000005 38.0 38.0 38.0 37.0 38.0 40-44 37.1221 38.0 38.0 38.0 37.0 38.0 45-49 37.117149999999995 38.0 38.0 38.0 36.8 38.0 50-54 37.0905 38.0 38.0 38.0 36.6 38.0 55-59 37.015950000000004 38.0 38.0 38.0 36.2 38.0 60-64 36.967349999999996 38.0 38.0 38.0 36.2 38.0 65-69 36.89555 38.0 38.0 38.0 36.0 38.0 70-74 36.82275 38.0 38.0 38.0 36.0 38.0 75-79 36.737899999999996 38.0 38.0 38.0 35.4 38.0 80-84 36.634299999999996 38.0 38.0 38.0 35.2 38.0 85-89 36.62705 38.0 38.0 38.0 35.0 38.0 90-94 36.44245 38.0 38.0 38.0 34.0 38.0 95-99 36.36935 38.0 38.0 38.0 34.0 38.0 100-104 36.1397 38.0 37.6 38.0 33.8 38.0 105-109 36.06165 38.0 37.6 38.0 33.6 38.0 110-114 35.8898 38.0 37.0 38.0 33.0 38.0 115-119 35.723749999999995 38.0 37.0 38.0 31.4 38.0 120-124 35.37575 38.0 36.6 38.0 30.6 38.0 125-129 34.93325 38.0 36.0 38.0 28.2 38.0 130-134 34.3344 38.0 33.8 38.0 25.4 38.0 135-139 33.6158 38.0 33.0 38.0 22.0 38.0 140-144 32.85595 38.0 33.0 38.0 17.0 38.0 145-149 31.68 38.0 32.2 38.0 8.6 38.0 150-151 25.764375 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 5.0 3 2.0 4 2.0 5 5.0 6 0.0 7 0.0 8 0.0 9 2.0 10 1.0 11 1.0 12 1.0 13 1.0 14 2.0 15 2.0 16 4.0 17 4.0 18 10.0 19 5.0 20 6.0 21 6.0 22 10.0 23 10.0 24 11.0 25 23.0 26 21.0 27 26.0 28 25.0 29 33.0 30 39.0 31 47.0 32 81.0 33 102.0 34 170.0 35 297.0 36 842.0 37 2204.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 36.61161161161161 19.844844844844843 14.589589589589588 28.953953953953953 2 26.826826826826828 25.7007007007007 32.407407407407405 15.065065065065063 3 18.76876876876877 30.055055055055057 31.456456456456454 19.71971971971972 4 22.792094070552913 36.05203902927195 23.317488116087066 17.838378784088064 5 24.080100125156445 35.1188986232791 23.779724655819777 17.02127659574468 6 20.555138784696176 37.484371092773195 24.256064016004 17.704426106526633 7 18.63431715857929 20.23511755877939 41.39569784892446 19.734867433716857 8 21.0 25.95 28.299999999999997 24.75 9 20.43010752688172 24.88122030507627 31.407851962990748 23.280820205051263 10-14 23.237323732373238 28.95789578957896 26.72767276727673 21.077107710771077 15-19 22.460107048171675 28.963033365014258 27.932569656345358 20.644289930468712 20-24 22.75706780085064 28.786589942456843 28.06104578433825 20.395296472354264 25-29 23.129660211179505 27.913726667667515 28.389130761146973 20.567482360006007 30-34 21.89298763701887 28.429851343911107 28.640072075679463 21.03708894339056 35-39 22.19330296811652 28.509935432203815 28.76520346363682 20.531558136042847 40-44 23.33983886303358 28.25902016714207 28.188960616524046 20.212180353300305 45-49 22.81711283462597 28.43632724543407 28.19614711033275 20.550412809607206 50-54 22.808246597277822 28.31765412329864 28.33767013610889 20.536429143314653 55-59 23.112334250688015 28.701526144608458 27.455591693770327 20.7305479109332 60-64 23.358686949559647 28.27762209767814 27.93234587670136 20.43134507606085 65-69 23.600961057162877 27.560316347982784 28.661527680448494 20.177194914405845 70-74 23.615423134702056 28.357536304456687 27.496244366549828 20.530796194291437 75-79 23.233335002754547 28.256623428657285 28.066309410527367 20.4437321580608 80-84 22.98948422633951 28.758137205808715 27.806710065097644 20.44566850275413 85-89 23.043020984624633 27.82090449241248 28.80252416487204 20.33355035809085 90-94 23.377728820348487 28.079311035449628 28.299619467254157 20.243340676947728 95-99 23.450795875463008 28.861747922714986 27.675442987286015 20.01201321453599 100-104 24.170378897842735 28.119525501776867 27.8342259372341 19.875869663146304 105-109 23.647465091837244 28.39697712827186 28.061658575646863 19.893899204244033 110-114 23.460806887576332 28.130944038442284 28.11092201421564 20.297327059765742 115-119 24.475594493116397 28.390488110137674 27.28911138923655 19.844806007509387 120-124 23.71531603726335 28.182910948612644 27.52178703796454 20.57998597615947 125-129 24.192336589030806 28.119208615076385 27.43801652892562 20.250438266967194 130-134 24.127222639619333 27.63335837716003 28.054094665664913 20.18532431755572 135-139 24.14725770097671 28.149261207112446 28.234410217881294 19.46907087402955 140-144 24.441550636081338 28.14785134729039 27.526795552439147 19.88380246418912 145-149 24.72579756598387 27.89102018330245 28.016226774177394 19.366955476536283 150-151 25.046939541870074 28.27638002253098 27.400175240956315 19.276505194642635 >>END_MODULE >>Per sequence GC content warn #GC Content Count 0 0.0 1 0.5 2 0.5 3 0.5 4 1.0 5 0.5 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 1.0 19 3.0 20 2.5 21 0.5 22 1.0 23 3.0 24 2.0 25 3.0 26 5.5 27 5.0 28 8.0 29 11.0 30 15.0 31 20.5 32 31.0 33 50.5 34 61.5 35 67.0 36 91.5 37 124.0 38 149.0 39 176.5 40 226.0 41 268.0 42 265.5 43 270.5 44 287.0 45 274.0 46 255.5 47 231.0 48 208.0 49 204.5 50 160.0 51 108.5 52 91.5 53 73.0 54 58.0 55 45.0 56 33.5 57 26.0 58 22.0 59 18.0 60 13.0 61 10.5 62 6.5 63 2.5 64 2.0 65 1.5 66 0.5 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.5 74 0.5 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.1 2 0.1 3 0.1 4 0.075 5 0.125 6 0.025 7 0.05 8 0.0 9 0.025 10-14 0.01 15-19 0.045 20-24 0.075 25-29 0.08499999999999999 30-34 0.105 35-39 0.105 40-44 0.08499999999999999 45-49 0.075 50-54 0.08 55-59 0.075 60-64 0.08 65-69 0.11 70-74 0.15 75-79 0.165 80-84 0.15 85-89 0.165 90-94 0.13999999999999999 95-99 0.11 100-104 0.105 105-109 0.095 110-114 0.11 115-119 0.125 120-124 0.16999999999999998 125-129 0.17500000000000002 130-134 0.17500000000000002 135-139 0.17500000000000002 140-144 0.16999999999999998 145-149 0.165 150-151 0.13749999999999998 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.775 #Duplication Level Percentage of deduplicated Percentage of total 1 99.79954898521673 99.575 2 0.17539463793535454 0.35000000000000003 3 0.025056376847907794 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0125 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.037500000000000006 0.0 0.0 0.0 0.0 64-65 0.05 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.05 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.0625 0.0 0.0 0.0 0.0 76-77 0.1 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.125 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.1875 0.0 0.0 0.0 0.0 88-89 0.25 0.0 0.0 0.0 0.0 90-91 0.375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.525 0.0 0.0 0.0 0.0 96-97 0.6125 0.0 0.0 0.0 0.0 98-99 0.7875 0.0 0.0 0.0 0.0 100-101 0.95 0.0 0.0 0.0 0.0 102-103 1.1625 0.0 0.0 0.0 0.0 104-105 1.4125 0.0 0.0 0.0 0.0 106-107 1.65 0.0 0.0 0.0 0.0 108-109 1.925 0.0 0.0 0.0 0.0 110-111 2.1375 0.0 0.0 0.0 0.0 112-113 2.3625 0.0 0.0 0.0 0.0 114-115 2.575 0.0 0.0 0.0 0.0 116-117 2.8375 0.0 0.0 0.0 0.0 118-119 3.1125 0.0 0.0 0.0 0.0 120-121 3.425 0.0 0.0 0.0 0.0 122-123 3.6125 0.0 0.0 0.0 0.0 124-125 3.9125 0.0 0.0 0.0 0.0 126-127 4.237500000000001 0.0 0.0 0.0 0.0 128-129 4.5375 0.0 0.0 0.0 0.0 130-131 4.775 0.0 0.0 0.0 0.0 132-133 5.05 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.8125 0.0 0.0 0.0 0.0 138-139 6.05 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position ATTCCAA 10 0.006830828 145.0 8 CTCCGAT 10 0.006830828 145.0 1 >>END_MODULE Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819985 spots for SRR7170495.sra Written 819985 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra Read 819975 spots for SRR7170495.sra Written 819975 spots for SRR7170495.sra SRR ids: ['SRR7170495.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_5kh8ne07 SRR7170495.sra spots: 16399510 blocks: [[1, 819975], [819976, 1639950], [1639951, 2459925], [2459926, 3279900], [3279901, 4099875], [4099876, 4919850], [4919851, 5739825], [5739826, 6559800], [6559801, 7379775], [7379776, 8199750], [8199751, 9019725], [9019726, 9839700], [9839701, 10659675], [10659676, 11479650], [11479651, 12299625], [12299626, 13119600], [13119601, 13939575], [13939576, 14759550], [14759551, 15579525], [15579526, 16399510]] SRR7170495 file size 5535555 SRR7170495 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170495 SRR7170495_1.fastq SRR7170495_2.fastq Input file: SRR7170495_1.fastq Paired file: SRR7170495_2.fastq trimmed: SRR7170495-trimmed-pair1.fastq, SRR7170495-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 01:50:02 2025 >> started Thu Feb 13 01:50:21 2025 >> done (18.669s) 16399510 read pairs processed; of these: 15196 ( 0.09%) short read pairs filtered out after trimming by size control 17717 ( 0.11%) empty read pairs filtered out after trimming by size control 16366597 (99.80%) read pairs available; of these: 10447047 (63.83%) trimmed read pairs available after processing 5919550 (36.17%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 4 0.00% 19 5 0.00% 20 3 0.00% 21 7 0.00% 22 3 0.00% 23 3 0.00% 24 2 0.00% 25 3 0.00% 26 5 0.00% 27 4 0.00% 28 10 0.00% 29 7 0.00% 30 7 0.00% 31 7 0.00% 32 10 0.00% 33 7 0.00% 34 11 0.00% 35 17 0.00% 36 9 0.00% 37 13 0.00% 38 21 0.00% 39 22 0.00% 40 28 0.00% 41 35 0.00% 42 47 0.00% 43 34 0.00% 44 41 0.00% 45 45 0.00% 46 56 0.00% 47 62 0.00% 48 82 0.00% 49 106 0.00% 50 106 0.00% 51 129 0.00% 52 151 0.00% 53 160 0.00% 54 175 0.00% 55 180 0.00% 56 232 0.00% 57 241 0.00% 58 274 0.00% 59 330 0.00% 60 365 0.00% 61 443 0.00% 62 494 0.00% 63 511 0.00% 64 625 0.00% 65 641 0.00% 66 714 0.00% 67 822 0.01% 68 889 0.01% 69 1018 0.01% 70 1103 0.01% 71 1310 0.01% 72 1534 0.01% 73 1704 0.01% 74 1935 0.01% 75 2133 0.01% 76 2269 0.01% 77 2468 0.02% 78 2769 0.02% 79 3023 0.02% 80 3444 0.02% 81 3959 0.02% 82 4563 0.03% 83 5289 0.03% 84 6343 0.04% 85 6457 0.04% 86 6614 0.04% 87 6996 0.04% 88 7259 0.04% 89 7578 0.05% 90 8165 0.05% 91 8776 0.05% 92 9404 0.06% 93 10439 0.06% 94 10983 0.07% 95 11599 0.07% 96 12353 0.08% 97 13050 0.08% 98 13381 0.08% 99 13885 0.08% 100 14528 0.09% 101 15291 0.09% 102 16535 0.10% 103 17175 0.10% 104 18100 0.11% 105 19228 0.12% 106 19754 0.12% 107 20667 0.13% 108 20826 0.13% 109 21611 0.13% 110 21469 0.13% 111 22284 0.14% 112 23235 0.14% 113 23890 0.15% 114 25120 0.15% 115 26140 0.16% 116 26548 0.16% 117 27900 0.17% 118 28673 0.18% 119 29698 0.18% 120 30189 0.18% 121 31232 0.19% 122 32753 0.20% 123 34546 0.21% 124 36453 0.22% 125 37639 0.23% 126 40047 0.24% 127 41984 0.26% 128 43618 0.27% 129 46122 0.28% 130 48832 0.30% 131 52042 0.32% 132 56146 0.34% 133 60017 0.37% 134 64422 0.39% 135 69538 0.42% 136 75399 0.46% 137 82438 0.50% 138 90829 0.55% 139 99770 0.61% 140 112812 0.69% 141 128970 0.79% 142 147733 0.90% 143 173649 1.06% 144 211228 1.29% 145 262690 1.61% 146 347935 2.13% 147 493930 3.02% 148 759672 4.64% 149 1449213 8.85% 150 4646526 28.39% 151 5919550 36.17% 16366597 reads passed initial QC criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.00 fanout-score-rank=27 prefix-density=0.33 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=70.19 fanout-score-rank=1 prefix-density=0.44 prefix-fanout=16.4 sequence=TCTCATCAAACAT criterion=sequence-density sequence-density=0.33 sequence-density-rank=1 fanout-score=2.33 fanout-score-rank=30 prefix-density=0.35 prefix-fanout=2.2 sequence=CCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAATCATCATGTCTAGCACCTGCGACACCTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAA criterion=fanout-score sequence-density=0.01 sequence-density-rank=34 fanout-score=43.81 fanout-score-rank=1 prefix-density=0.05 prefix-fanout=5.9 sequence=AAAGCTCAAAAAAAATCTTAACTGCACCCGCTCATCCAGCAATGGCAGCAGCAACAATGGCCCTCTCCTCCCCTTCGCTAGCCGGAAAGGCGGTGAAGCTCAACCCCTCCTCCTCTGAGATCATGGGCAATGGCCGTGTCTCCATGAGGAAAACCACCAAGCCTGTTCCCTCCGGGAGCCCATGGTACGGACCAGACCGTGTTAAATACTTGGGCCCGTTCTCTGGTGAGCCCCCATCCTACTTGACTGGTGAGTTCCCTGGTGACTACGGCTGGGACACTGC SRR7170495 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 01:51:06 Started mapping on | Feb 13 01:51:06 Finished on | Feb 13 01:52:58 Mapping speed, Million of reads per hour | 526.07 Number of input reads | 16366597 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 15413760 Uniquely mapped reads % | 94.18% Average mapped length | 292.25 Number of splices: Total | 15110139 Number of splices: Annotated (sjdb) | 14751822 Number of splices: GT/AG | 14838667 Number of splices: GC/AG | 214421 Number of splices: AT/AC | 9077 Number of splices: Non-canonical | 47974 Mismatch rate per base, % | 0.46% Deletion rate per base | 0.03% Deletion average length | 2.57 Insertion rate per base | 0.02% Insertion average length | 2.20 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 485549 % of reads mapped to multiple loci | 2.97% Number of reads mapped to too many loci | 46048 % of reads mapped to too many loci | 0.28% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.48% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 475012 475012 475012 N_multimapping 485549 485549 485549 N_noFeature 572722 15203276 659681 N_ambiguous 257363 1022 133723 UnstrandedReadsAssigned:14583675 PositiveStrandReadsAssigned:209462 NegativeStrandReadsAssigned:14620356 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=147 echo kmer=143 SRR7170495 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170495-trimmed-pair1.fastq SRR7170495-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 16,366,597 reads, 14,551,266 reads pseudoaligned [quant] estimated average fragment length: 275.691 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7170495.ke.tsv 34699 SRR7170495.se.tsv 87100 total ==> SRR7170495.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1743.31 1047 42.9175 Potri.005G024800.1.v4.1 1035 760.309 351 32.9897 Potri.004G059700.1.v4.1 961 686.331 4 0.416475 Potri.007G009000.2.v4.1 1416 1141.31 0 0 Potri.003G141000.2.v4.1 2943 2668.31 910 24.3707 Potri.016G087400.1.v4.1 270 79.4893 1265 1137.22 Potri.015G069301.1.v4.1 564 296.208 0 0 Potri.010G195200.1.v4.1 1773 1498.31 1585.95 75.6397 Potri.012G127500.1.v4.1 977 702.325 65 6.61359 ==> SRR7170495.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 264 Potri.001G233950.v4.1 1 Potri.001G122700.v4.1 205 Potri.001G212900.v4.1 0 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 112 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 15 SRR7170495 completed mapping pipeline successfully