Starting /dee2/code/volunteer_pipeline.sh SRR7170496 current disk space = 3052003291136 free memory = 1577086364 SRR7170496 SRAfilesize 0cec422524bb12ca7b802e32298d9cc6 SRR7170496.sra SRR7170496.sra file validated SRR7170496 is paired end SRR7170496 is conventional basespace SRR7170496 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170496_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.96875 25.0 18.0 33.0 18.0 33.0 2 23.692 25.0 18.0 29.0 18.0 33.0 3 28.27775 29.0 27.0 31.0 25.0 33.0 4 30.7765 31.0 30.0 33.0 27.0 33.0 5 31.60425 33.0 31.0 33.0 29.0 33.0 6 35.9735 37.0 36.0 38.0 33.0 38.0 7 36.79 38.0 37.0 38.0 35.0 38.0 8 37.3375 38.0 38.0 38.0 37.0 38.0 9 37.41875 38.0 38.0 38.0 37.0 38.0 10-14 37.3908 38.0 38.0 38.0 36.8 38.0 15-19 37.516200000000005 38.0 38.0 38.0 37.0 38.0 20-24 37.4643 38.0 38.0 38.0 37.0 38.0 25-29 37.3303 38.0 38.0 38.0 37.0 38.0 30-34 37.40615 38.0 38.0 38.0 37.0 38.0 35-39 37.385149999999996 38.0 38.0 38.0 37.0 38.0 40-44 36.6272 38.0 37.2 38.0 32.8 38.0 45-49 36.17100000000001 38.0 37.0 38.0 29.6 38.0 50-54 36.9964 38.0 38.0 38.0 35.6 38.0 55-59 37.0484 38.0 38.0 38.0 36.0 38.0 60-64 37.023999999999994 38.0 38.0 38.0 36.0 38.0 65-69 36.92105000000001 38.0 38.0 38.0 35.4 38.0 70-74 36.74485 38.0 38.0 38.0 34.8 38.0 75-79 36.702099999999994 38.0 38.0 38.0 34.4 38.0 80-84 36.60625 38.0 37.8 38.0 34.0 38.0 85-89 36.384 38.0 37.2 38.0 33.8 38.0 90-94 36.07025 38.0 37.0 38.0 32.8 38.0 95-99 36.11635 38.0 37.0 38.0 33.2 38.0 100-104 36.0818 38.0 37.0 38.0 33.0 38.0 105-109 36.007400000000004 38.0 36.8 38.0 32.6 38.0 110-114 35.6182 38.0 36.4 38.0 30.6 38.0 115-119 35.161100000000005 38.0 35.8 38.0 28.2 38.0 120-124 35.1289 38.0 35.2 38.0 28.2 38.0 125-129 34.7945 38.0 35.2 38.0 26.8 38.0 130-134 34.373850000000004 38.0 34.6 38.0 25.0 38.0 135-139 33.91945 38.0 34.0 38.0 23.0 38.0 140-144 33.10515 37.8 33.0 38.0 18.6 38.0 145-149 32.068 37.2 31.6 38.0 13.8 38.0 150-151 26.6555 33.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 3.0 20 3.0 21 5.0 22 6.0 23 14.0 24 6.0 25 16.0 26 19.0 27 17.0 28 34.0 29 51.0 30 59.0 31 73.0 32 99.0 33 167.0 34 278.0 35 541.0 36 1309.0 37 1299.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 50.360824742268036 11.082474226804123 8.015463917525773 30.541237113402065 2 23.95598899724931 12.953238309577394 34.18354588647162 28.907226806701676 3 19.725 20.175 26.25 33.85 4 23.075000000000003 27.250000000000004 23.525 26.150000000000002 5 22.275 33.4 23.375 20.95 6 18.625 35.25 26.075 20.05 7 13.775 26.025 43.075 17.125 8 18.125 24.349999999999998 31.45 26.075 9 17.95 22.95 33.75 25.35 10-14 19.71 29.759999999999998 27.189999999999998 23.34 15-19 19.35 28.904999999999998 27.985 23.76 20-24 20.015 28.53 27.994999999999997 23.46 25-29 19.66 29.104999999999997 27.955000000000002 23.28 30-34 20.04 28.605000000000004 28.044999999999998 23.31 35-39 18.985 29.13 28.115000000000002 23.77 40-44 19.655982799139956 29.341467073353666 27.58137906895345 23.42117105855293 45-49 19.54 28.92 27.884999999999998 23.655 50-54 19.89 28.665000000000003 28.005000000000003 23.44 55-59 19.77 28.425 28.115000000000002 23.69 60-64 20.13 28.815 27.584999999999997 23.47 65-69 19.814999999999998 28.775000000000002 28.225 23.185 70-74 19.98 28.375 28.325 23.32 75-79 19.515 28.73 27.905 23.849999999999998 80-84 19.63 28.535 27.76 24.075 85-89 20.015 28.634999999999998 27.47 23.880000000000003 90-94 19.82099104955248 28.871443572178606 27.241362068103403 24.066203310165506 95-99 20.61 28.07 28.015 23.305 100-104 20.45 28.865000000000002 27.584999999999997 23.1 105-109 20.880000000000003 28.58 27.515 23.025000000000002 110-114 20.1 27.62 28.775000000000002 23.505000000000003 115-119 20.080000000000002 28.65 27.965 23.305 120-124 20.505000000000003 28.84 27.005000000000003 23.65 125-129 20.845 28.265 27.439999999999998 23.45 130-134 20.74 28.395 27.1 23.765 135-139 19.935 28.215 27.939999999999998 23.91 140-144 21.099999999999998 27.750000000000004 27.584999999999997 23.565 145-149 20.215 28.43 27.245 24.11 150-151 19.9125 28.000000000000004 28.525 23.5625 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.5 19 0.5 20 0.5 21 0.5 22 1.0 23 2.0 24 3.0 25 3.5 26 5.5 27 9.0 28 11.0 29 14.5 30 19.5 31 24.5 32 39.0 33 57.5 34 65.5 35 80.0 36 95.0 37 108.0 38 133.0 39 154.5 40 180.0 41 219.5 42 248.0 43 271.5 44 272.5 45 264.0 46 266.5 47 253.5 48 224.5 49 196.5 50 174.0 51 144.5 52 111.5 53 77.0 54 57.5 55 60.0 56 50.0 57 29.5 58 21.0 59 15.5 60 13.5 61 8.5 62 2.5 63 2.5 64 3.5 65 2.5 66 1.0 67 0.0 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.0 2 0.025 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.005 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.005 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.4 #Duplication Level Percentage of deduplicated Percentage of total 1 99.59758551307847 99.0 2 0.2515090543259557 0.5 3 0.1006036217303823 0.3 4 0.05030181086519115 0.2 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9875 0.0 0.0 0.0 0.0 98-99 1.0125 0.0 0.0 0.0 0.0 100-101 1.0375 0.0 0.0 0.0 0.0 102-103 1.0875 0.0 0.0 0.0 0.0 104-105 1.1625 0.0 0.0 0.0 0.0 106-107 1.325 0.0 0.0 0.0 0.0 108-109 1.4874999999999998 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.2125 0.0 0.0 0.0 0.0 118-119 2.3875 0.0 0.0 0.0 0.0 120-121 2.475 0.0 0.0 0.0 0.0 122-123 2.675 0.0 0.0 0.0 0.0 124-125 2.9625 0.0 0.0 0.0 0.0 126-127 3.2125 0.0 0.0 0.0 0.0 128-129 3.55 0.0 0.0 0.0 0.0 130-131 3.7875 0.0 0.0 0.0 0.0 132-133 4.025 0.0 0.0 0.0 0.0 134-135 4.2125 0.0 0.0 0.0 0.0 136-137 4.362500000000001 0.0 0.0 0.0 0.0 138-139 4.5375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GGACATT 10 0.0060887975 150.61038 1 TCCGAAT 10 0.006836113 144.9625 2 >>END_MODULE SRR7170496 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170496_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.254 33.0 32.0 34.0 28.0 34.0 2 32.65675 33.0 33.0 34.0 32.0 34.0 3 30.365 33.0 30.0 34.0 18.0 34.0 4 31.86225 33.0 32.0 34.0 27.0 34.0 5 32.468 33.0 33.0 34.0 32.0 34.0 6 36.955 38.0 38.0 38.0 36.0 38.0 7 36.73475 38.0 38.0 38.0 35.0 38.0 8 36.945 38.0 38.0 38.0 36.0 38.0 9 36.96425 38.0 38.0 38.0 36.0 38.0 10-14 36.9348 38.0 38.0 38.0 36.0 38.0 15-19 37.0105 38.0 38.0 38.0 36.0 38.0 20-24 36.79785 38.0 38.0 38.0 35.6 38.0 25-29 36.6213 38.0 38.0 38.0 34.8 38.0 30-34 36.77624999999999 38.0 38.0 38.0 35.4 38.0 35-39 36.87185 38.0 38.0 38.0 36.0 38.0 40-44 35.986599999999996 38.0 36.8 38.0 30.0 38.0 45-49 36.74765 38.0 38.0 38.0 35.4 38.0 50-54 36.769949999999994 38.0 38.0 38.0 35.6 38.0 55-59 35.5314 38.0 36.0 38.0 29.2 38.0 60-64 36.14235 38.0 37.4 38.0 32.6 38.0 65-69 35.96365 38.0 37.4 38.0 30.4 38.0 70-74 35.51505 38.0 36.4 38.0 29.6 38.0 75-79 36.24935 38.0 37.8 38.0 33.4 38.0 80-84 36.3655 38.0 38.0 38.0 34.0 38.0 85-89 36.2392 38.0 38.0 38.0 33.8 38.0 90-94 36.201350000000005 38.0 38.0 38.0 34.0 38.0 95-99 36.0073 38.0 37.0 38.0 33.0 38.0 100-104 35.77929999999999 38.0 37.0 38.0 31.4 38.0 105-109 35.5259 38.0 37.0 38.0 30.2 38.0 110-114 35.45895 38.0 36.6 38.0 29.8 38.0 115-119 35.10205 38.0 35.6 38.0 28.8 38.0 120-124 34.84655 38.0 35.6 38.0 27.6 38.0 125-129 34.3073 38.0 34.2 38.0 24.2 38.0 130-134 34.0241 38.0 33.4 38.0 24.0 38.0 135-139 33.226299999999995 38.0 33.0 38.0 19.2 38.0 140-144 32.14895 38.0 31.8 38.0 13.2 38.0 145-149 31.215600000000002 37.6 31.2 38.0 8.2 38.0 150-151 25.095875 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 8.0 3 3.0 4 0.0 5 1.0 6 0.0 7 1.0 8 3.0 9 1.0 10 1.0 11 4.0 12 3.0 13 3.0 14 1.0 15 2.0 16 7.0 17 5.0 18 4.0 19 3.0 20 8.0 21 12.0 22 11.0 23 14.0 24 20.0 25 27.0 26 32.0 27 26.0 28 35.0 29 50.0 30 66.0 31 72.0 32 108.0 33 153.0 34 268.0 35 411.0 36 964.0 37 1673.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 39.75 21.95 13.3 25.0 2 27.224999999999998 26.650000000000002 29.725 16.400000000000002 3 21.2 26.75 33.175 18.875 4 22.7 34.925 23.95 18.425 5 24.175 36.25 22.425 17.150000000000002 6 19.675 39.45 23.5 17.375 7 18.275 21.75 38.85 21.125 8 20.724999999999998 26.3 27.900000000000002 25.074999999999996 9 22.75 24.675 27.975 24.6 10-14 22.63 29.665000000000003 26.83 20.875 15-19 22.91 28.134999999999998 27.98 20.974999999999998 20-24 22.515 28.405 28.355000000000004 20.724999999999998 25-29 22.400000000000002 28.125 28.59 20.885 30-34 22.03 28.59 28.410000000000004 20.97 35-39 23.055 27.685 28.125 21.135 40-44 22.439999999999998 28.365000000000002 28.470000000000002 20.724999999999998 45-49 22.235 28.16 28.355000000000004 21.25 50-54 22.939999999999998 28.305000000000003 27.644999999999996 21.11 55-59 23.085 27.715 28.26 20.94 60-64 22.63 28.084999999999997 28.310000000000002 20.974999999999998 65-69 23.07 27.505000000000003 28.660000000000004 20.765 70-74 23.315 27.96 27.485 21.240000000000002 75-79 23.055 27.685 27.71 21.55 80-84 22.46 27.99 27.639999999999997 21.91 85-89 22.905 28.055000000000003 27.88 21.16 90-94 22.81 28.595 27.689999999999998 20.905 95-99 22.855 28.134999999999998 28.87 20.14 100-104 23.66 28.095 27.63 20.615 105-109 23.485 27.779999999999998 28.345 20.39 110-114 23.21 28.23 28.115000000000002 20.445 115-119 23.605 28.050000000000004 27.765 20.580000000000002 120-124 23.68 27.785 28.02 20.515 125-129 23.785 28.46 27.41 20.345 130-134 23.71 27.889999999999997 27.915 20.485 135-139 23.875 28.025 27.43 20.669999999999998 140-144 23.86 28.255000000000003 27.93 19.955000000000002 145-149 24.375 28.439999999999998 27.224999999999998 19.96 150-151 24.712500000000002 28.000000000000004 27.150000000000002 20.1375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.5 16 1.0 17 0.5 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 3.0 24 4.5 25 4.0 26 4.5 27 8.5 28 8.5 29 12.5 30 19.5 31 24.0 32 29.0 33 41.5 34 53.5 35 63.0 36 84.5 37 111.0 38 137.5 39 164.0 40 200.5 41 227.0 42 252.0 43 293.0 44 293.0 45 276.0 46 272.5 47 257.0 48 232.0 49 190.5 50 157.5 51 134.5 52 102.5 53 77.5 54 63.5 55 52.0 56 40.0 57 30.0 58 23.5 59 13.0 60 9.5 61 10.5 62 5.5 63 4.5 64 2.5 65 0.5 66 0.5 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.52116935483872 98.725 2 0.3780241935483871 0.75 3 0.025201612903225805 0.075 4 0.0 0.0 5 0.025201612903225805 0.125 6 0.025201612903225805 0.15 7 0.025201612903225805 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 7 0.17500000000000002 No Hit CAGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTA 6 0.15 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0125 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.037500000000000006 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1 0.0 0.0 0.0 0.0 72-73 0.1 0.0 0.0 0.0 0.0 74-75 0.1125 0.0 0.0 0.0 0.0 76-77 0.125 0.0 0.0 0.0 0.0 78-79 0.16249999999999998 0.0 0.0 0.0 0.0 80-81 0.175 0.0 0.0 0.0 0.0 82-83 0.1875 0.0 0.0 0.0 0.0 84-85 0.21250000000000002 0.0 0.0 0.0 0.0 86-87 0.275 0.0 0.0 0.0 0.0 88-89 0.375 0.0 0.0 0.0 0.0 90-91 0.5 0.0 0.0 0.0 0.0 92-93 0.6 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.9624999999999999 0.0 0.0 0.0 0.0 98-99 0.9875 0.0 0.0 0.0 0.0 100-101 1.0125 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.3 0.0 0.0 0.0 0.0 108-109 1.4625 0.0 0.0 0.0 0.0 110-111 1.6 0.0 0.0 0.0 0.0 112-113 1.7625 0.0 0.0 0.0 0.0 114-115 1.9375 0.0 0.0 0.0 0.0 116-117 2.1875 0.0 0.0 0.0 0.0 118-119 2.3625 0.0 0.0 0.0 0.0 120-121 2.45 0.0 0.0 0.0 0.0 122-123 2.6500000000000004 0.0 0.0 0.0 0.0 124-125 2.9375 0.0 0.0 0.0 0.0 126-127 3.1875 0.0 0.0 0.0 0.0 128-129 3.4875 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.925 0.0 0.0 0.0 0.0 134-135 4.1125 0.0 0.0 0.0 0.0 136-137 4.262499999999999 0.0 0.0 0.0 0.0 138-139 4.4375 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717112 spots for SRR7170496.sra Written 717112 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra Read 717107 spots for SRR7170496.sra Written 717107 spots for SRR7170496.sra SRR ids: ['SRR7170496.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_ulgoshwc SRR7170496.sra spots: 14342145 blocks: [[1, 717107], [717108, 1434214], [1434215, 2151321], [2151322, 2868428], [2868429, 3585535], [3585536, 4302642], [4302643, 5019749], [5019750, 5736856], [5736857, 6453963], [6453964, 7171070], [7171071, 7888177], [7888178, 8605284], [8605285, 9322391], [9322392, 10039498], [10039499, 10756605], [10756606, 11473712], [11473713, 12190819], [12190820, 12907926], [12907927, 13625033], [13625034, 14342145]] SRR7170496 file size 4838381 SRR7170496 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170496 SRR7170496_1.fastq SRR7170496_2.fastq Input file: SRR7170496_1.fastq Paired file: SRR7170496_2.fastq trimmed: SRR7170496-trimmed-pair1.fastq, SRR7170496-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:48:34 2025 >> started Thu Feb 13 04:54:06 2025 >> done (332.238s) 14342145 read pairs processed; of these: 12466 ( 0.09%) short read pairs filtered out after trimming by size control 11259 ( 0.08%) empty read pairs filtered out after trimming by size control 14318420 (99.83%) read pairs available; of these: 8014975 (55.98%) trimmed read pairs available after processing 6303445 (44.02%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 2 0.00% 19 4 0.00% 20 3 0.00% 21 3 0.00% 22 1 0.00% 23 5 0.00% 24 2 0.00% 25 2 0.00% 26 4 0.00% 27 6 0.00% 28 3 0.00% 29 7 0.00% 30 8 0.00% 31 11 0.00% 32 7 0.00% 33 6 0.00% 34 10 0.00% 35 6 0.00% 36 8 0.00% 37 9 0.00% 38 9 0.00% 39 9 0.00% 40 13 0.00% 41 17 0.00% 42 22 0.00% 43 17 0.00% 44 32 0.00% 45 28 0.00% 46 26 0.00% 47 39 0.00% 48 41 0.00% 49 54 0.00% 50 64 0.00% 51 81 0.00% 52 97 0.00% 53 86 0.00% 54 107 0.00% 55 100 0.00% 56 107 0.00% 57 121 0.00% 58 168 0.00% 59 190 0.00% 60 222 0.00% 61 232 0.00% 62 258 0.00% 63 336 0.00% 64 333 0.00% 65 397 0.00% 66 407 0.00% 67 455 0.00% 68 466 0.00% 69 582 0.00% 70 703 0.00% 71 748 0.01% 72 949 0.01% 73 1004 0.01% 74 1138 0.01% 75 1204 0.01% 76 1423 0.01% 77 1584 0.01% 78 1669 0.01% 79 1814 0.01% 80 2004 0.01% 81 2276 0.02% 82 2687 0.02% 83 3043 0.02% 84 3705 0.03% 85 4337 0.03% 86 4560 0.03% 87 4898 0.03% 88 5043 0.04% 89 5389 0.04% 90 5816 0.04% 91 6096 0.04% 92 6729 0.05% 93 7195 0.05% 94 7954 0.06% 95 8397 0.06% 96 8908 0.06% 97 9120 0.06% 98 9360 0.07% 99 9763 0.07% 100 10379 0.07% 101 11011 0.08% 102 11521 0.08% 103 12225 0.09% 104 12816 0.09% 105 13617 0.10% 106 14080 0.10% 107 14501 0.10% 108 15035 0.11% 109 15128 0.11% 110 15937 0.11% 111 16450 0.11% 112 16973 0.12% 113 18046 0.13% 114 18600 0.13% 115 19495 0.14% 116 20306 0.14% 117 20751 0.14% 118 21372 0.15% 119 22028 0.15% 120 22663 0.16% 121 23571 0.16% 122 24404 0.17% 123 26061 0.18% 124 27185 0.19% 125 27782 0.19% 126 29986 0.21% 127 30937 0.22% 128 32558 0.23% 129 34367 0.24% 130 35803 0.25% 131 37510 0.26% 132 40242 0.28% 133 42928 0.30% 134 45993 0.32% 135 50293 0.35% 136 54359 0.38% 137 59484 0.42% 138 64948 0.45% 139 71925 0.50% 140 80938 0.57% 141 92169 0.64% 142 105757 0.74% 143 126022 0.88% 144 152722 1.07% 145 190817 1.33% 146 247492 1.73% 147 343269 2.40% 148 532923 3.72% 149 1036286 7.24% 150 3868571 27.02% 151 6303445 44.02% 14318420 reads passed initial QC criterion=sequence-density sequence-density=0.67 sequence-density-rank=1 fanout-score=1.99 fanout-score-rank=20 prefix-density=0.65 prefix-fanout=2.0 sequence=TTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=21 fanout-score=422.62 fanout-score-rank=1 prefix-density=0.27 prefix-fanout=17.3 sequence=TGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTG criterion=sequence-density sequence-density=0.70 sequence-density-rank=1 fanout-score=2.11 fanout-score-rank=22 prefix-density=0.71 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=25 fanout-score=56.23 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.2 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGGCTGCGGCTCTGGATGCAAGTGCGG SRR7170496 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:34:54 Started mapping on | Feb 13 05:35:20 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 43.21 Number of input reads | 14318420 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13589741 Uniquely mapped reads % | 94.91% Average mapped length | 293.95 Number of splices: Total | 13469502 Number of splices: Annotated (sjdb) | 13163213 Number of splices: GT/AG | 13217474 Number of splices: GC/AG | 206677 Number of splices: AT/AC | 8206 Number of splices: Non-canonical | 37145 Mismatch rate per base, % | 0.38% Deletion rate per base | 0.03% Deletion average length | 2.73 Insertion rate per base | 0.02% Insertion average length | 2.18 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 339858 % of reads mapped to multiple loci | 2.37% Number of reads mapped to too many loci | 18366 % of reads mapped to too many loci | 0.13% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.55% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 400191 400191 400191 N_multimapping 339858 339858 339858 N_noFeature 495943 13348855 575896 N_ambiguous 266732 919 105254 UnstrandedReadsAssigned:12827066 PositiveStrandReadsAssigned:239967 NegativeStrandReadsAssigned:12908591 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170496 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170496-trimmed-pair1.fastq SRR7170496-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,318,420 reads, 12,825,570 reads pseudoaligned [quant] estimated average fragment length: 282.06 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,155 rounds 52401 SRR7170496.ke.tsv 34699 SRR7170496.se.tsv 87100 total ==> SRR7170496.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1736.94 438 17.5065 Potri.005G024800.1.v4.1 1035 753.94 101 9.30026 Potri.004G059700.1.v4.1 961 679.961 9 0.918902 Potri.007G009000.2.v4.1 1416 1134.94 0 0 Potri.003G141000.2.v4.1 2943 2661.94 522 13.6139 Potri.016G087400.1.v4.1 270 74.259 679 634.792 Potri.015G069301.1.v4.1 564 290.161 0 0 Potri.010G195200.1.v4.1 1773 1491.94 40 1.86131 Potri.012G127500.1.v4.1 977 695.956 210 20.9483 ==> SRR7170496.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1210 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 224 Potri.001G212900.v4.1 3 Potri.001G182400.v4.1 4 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 13 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 0 SRR7170496 completed mapping pipeline successfully