Starting /dee2/code/volunteer_pipeline.sh SRR7170497 current disk space = 3052252340224 free memory = 1471399032 SRR7170497 SRAfilesize 03307b0aeab5ab3b1ff8bcdbc1e807ce SRR7170497.sra SRR7170497.sra file validated SRR7170497 is paired end SRR7170497 is conventional basespace SRR7170497 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170497_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.43575 27.0 18.0 33.0 18.0 33.0 2 24.2355 25.0 18.0 30.0 18.0 33.0 3 27.74525 29.0 27.0 31.0 18.0 33.0 4 30.8765 31.0 30.0 33.0 28.0 33.0 5 32.0995 33.0 32.0 33.0 31.0 33.0 6 36.34925 37.0 36.0 38.0 34.0 38.0 7 36.902 38.0 37.0 38.0 35.0 38.0 8 37.54675 38.0 38.0 38.0 37.0 38.0 9 37.56125 38.0 38.0 38.0 37.0 38.0 10-14 37.557550000000006 38.0 38.0 38.0 37.2 38.0 15-19 37.62115000000001 38.0 38.0 38.0 38.0 38.0 20-24 37.56175 38.0 38.0 38.0 38.0 38.0 25-29 37.627300000000005 38.0 38.0 38.0 38.0 38.0 30-34 37.5825 38.0 38.0 38.0 38.0 38.0 35-39 37.5647 38.0 38.0 38.0 38.0 38.0 40-44 37.49735 38.0 38.0 38.0 37.6 38.0 45-49 37.4583 38.0 38.0 38.0 37.2 38.0 50-54 37.4298 38.0 38.0 38.0 37.0 38.0 55-59 37.33215 38.0 38.0 38.0 37.0 38.0 60-64 37.25575 38.0 38.0 38.0 36.6 38.0 65-69 37.2082 38.0 38.0 38.0 36.4 38.0 70-74 37.130399999999995 38.0 38.0 38.0 36.0 38.0 75-79 36.94675 38.0 38.0 38.0 35.8 38.0 80-84 36.997749999999996 38.0 38.0 38.0 36.0 38.0 85-89 36.74145 38.0 38.0 38.0 34.8 38.0 90-94 36.7359 38.0 38.0 38.0 35.0 38.0 95-99 36.6114 38.0 37.8 38.0 34.4 38.0 100-104 36.66 38.0 38.0 38.0 34.4 38.0 105-109 36.378550000000004 38.0 37.2 38.0 34.0 38.0 110-114 36.19985 38.0 37.2 38.0 33.6 38.0 115-119 35.78144999999999 38.0 36.8 38.0 31.8 38.0 120-124 35.8411 38.0 36.8 38.0 32.4 38.0 125-129 35.5427 38.0 36.0 38.0 30.6 38.0 130-134 31.95 34.8 28.4 38.0 22.6 38.0 135-139 34.39525 38.0 33.8 38.0 26.6 38.0 140-144 30.474899999999998 34.8 26.2 38.0 15.6 38.0 145-149 32.738600000000005 37.4 32.6 38.0 17.0 38.0 150-151 28.885624999999997 34.5 27.0 38.0 7.5 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 11 1.0 12 1.0 13 1.0 14 0.0 15 2.0 16 0.0 17 4.0 18 1.0 19 3.0 20 3.0 21 4.0 22 5.0 23 8.0 24 11.0 25 8.0 26 6.0 27 15.0 28 19.0 29 27.0 30 38.0 31 49.0 32 90.0 33 142.0 34 208.0 35 465.0 36 1515.0 37 1374.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 42.13395638629284 10.046728971962617 8.515057113187954 39.3042575285566 2 22.597597597597595 14.514514514514515 34.68468468468468 28.203203203203202 3 18.575 19.375 26.55 35.5 4 22.7 28.249999999999996 23.05 26.0 5 21.875 32.425 24.725 20.974999999999998 6 19.35 36.025 25.05 19.575 7 15.2 24.575 42.1 18.125 8 17.2 25.45 30.85 26.5 9 17.25 23.674999999999997 34.300000000000004 24.775 10-14 19.475 29.685 27.905 22.935 15-19 19.645000000000003 28.345 28.12 23.89 20-24 19.245 29.065 28.21 23.48 25-29 19.634999999999998 29.220000000000002 27.985 23.16 30-34 19.6 28.57 28.32 23.51 35-39 19.53 29.099999999999998 27.175 24.195 40-44 20.005 28.665000000000003 27.755000000000003 23.575 45-49 19.615 29.23 27.42 23.735 50-54 19.265 28.875 28.199999999999996 23.66 55-59 19.66 28.360000000000003 27.889999999999997 24.09 60-64 19.865 28.605000000000004 27.884999999999998 23.645 65-69 19.950000000000003 28.310000000000002 27.944999999999997 23.794999999999998 70-74 19.365 28.68 27.79 24.165 75-79 19.725 27.644999999999996 28.744999999999997 23.885 80-84 19.78 28.62 27.839999999999996 23.76 85-89 20.39 28.43 27.639999999999997 23.54 90-94 20.02 28.785 27.905 23.29 95-99 19.91 28.395 27.905 23.79 100-104 20.064999999999998 28.749999999999996 27.785 23.400000000000002 105-109 20.34 28.494999999999997 27.57 23.595 110-114 20.65 28.04 27.735 23.575 115-119 20.880000000000003 28.52 27.985 22.615 120-124 20.055 28.1 27.54 24.305 125-129 20.5 28.655 27.55 23.294999999999998 130-134 20.095 28.52 27.16 24.224999999999998 135-139 20.015 28.425 27.41 24.15 140-144 20.845 28.845 26.724999999999998 23.585 145-149 20.880000000000003 28.415000000000003 27.29 23.415 150-151 20.8125 27.500000000000004 28.1875 23.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.5 11 0.5 12 0.5 13 0.5 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 1.0 21 1.0 22 1.0 23 2.0 24 3.0 25 3.0 26 4.5 27 8.0 28 9.0 29 10.0 30 17.0 31 23.5 32 33.0 33 46.5 34 56.0 35 73.0 36 91.0 37 120.0 38 147.0 39 168.0 40 198.0 41 228.5 42 249.0 43 270.0 44 285.0 45 253.5 46 246.0 47 260.5 48 231.5 49 201.5 50 179.5 51 148.5 52 110.0 53 77.0 54 59.0 55 45.5 56 37.0 57 31.5 58 22.0 59 16.0 60 13.5 61 7.0 62 3.0 63 1.5 64 1.0 65 0.5 66 0.5 67 0.5 68 1.0 69 1.0 70 0.0 71 0.5 72 0.5 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 3.6999999999999997 2 0.1 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.35000000000001 #Duplication Level Percentage of deduplicated Percentage of total 1 99.39607448414695 98.75 2 0.5787619526925012 1.15 3 0.0 0.0 4 0.025163563160543533 0.1 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.36250000000000004 0.0 0.0 0.0 0.0 92-93 0.4625 0.0 0.0 0.0 0.0 94-95 0.55 0.0 0.0 0.0 0.0 96-97 0.625 0.0 0.0 0.0 0.0 98-99 0.7625 0.0 0.0 0.0 0.0 100-101 0.8625 0.0 0.0 0.0 0.0 102-103 1.025 0.0 0.0 0.0 0.0 104-105 1.1375 0.0 0.0 0.0 0.0 106-107 1.225 0.0 0.0 0.0 0.0 108-109 1.425 0.0 0.0 0.0 0.0 110-111 1.55 0.0 0.0 0.0 0.0 112-113 1.6875 0.0 0.0 0.0 0.0 114-115 1.8 0.0 0.0 0.0 0.0 116-117 1.95 0.0 0.0 0.0 0.0 118-119 2.0999999999999996 0.0 0.0 0.0 0.0 120-121 2.3625 0.0 0.0 0.0 0.0 122-123 2.625 0.0 0.0 0.0 0.0 124-125 2.775 0.0 0.0 0.0 0.0 126-127 2.95 0.0 0.0 0.0 0.0 128-129 3.0875 0.0 0.0 0.0 0.0 130-131 3.2625 0.0 0.0 0.0 0.0 132-133 3.4000000000000004 0.0 0.0 0.0 0.0 134-135 3.5875 0.0 0.0 0.0 0.0 136-137 3.7125 0.0 0.0 0.0 0.0 138-139 3.9625000000000004 0.0125 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170497 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170497_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9025 33.0 33.0 34.0 32.0 34.0 2 32.92025 34.0 33.0 34.0 32.0 34.0 3 33.031 34.0 33.0 34.0 32.0 34.0 4 33.006 34.0 33.0 34.0 32.0 34.0 5 33.038 34.0 33.0 34.0 32.0 34.0 6 37.20525 38.0 38.0 38.0 37.0 38.0 7 37.19375 38.0 38.0 38.0 37.0 38.0 8 37.15825 38.0 38.0 38.0 37.0 38.0 9 37.225 38.0 38.0 38.0 37.0 38.0 10-14 37.07365 38.0 38.0 38.0 36.4 38.0 15-19 36.0124 38.0 36.8 38.0 30.6 38.0 20-24 36.97305 38.0 38.0 38.0 36.0 38.0 25-29 36.84905 38.0 38.0 38.0 35.8 38.0 30-34 37.01695 38.0 38.0 38.0 36.2 38.0 35-39 37.03995 38.0 38.0 38.0 36.2 38.0 40-44 36.98049999999999 38.0 38.0 38.0 36.0 38.0 45-49 36.87835 38.0 38.0 38.0 35.8 38.0 50-54 36.85625 38.0 38.0 38.0 35.8 38.0 55-59 36.8683 38.0 38.0 38.0 35.8 38.0 60-64 36.80045 38.0 38.0 38.0 35.4 38.0 65-69 36.788599999999995 38.0 38.0 38.0 35.2 38.0 70-74 36.669599999999996 38.0 38.0 38.0 34.8 38.0 75-79 36.633050000000004 38.0 38.0 38.0 34.6 38.0 80-84 36.6075 38.0 38.0 38.0 34.8 38.0 85-89 36.089 38.0 37.6 38.0 32.2 38.0 90-94 33.84735 37.4 33.2 38.0 22.8 38.0 95-99 36.034000000000006 38.0 37.0 38.0 33.0 38.0 100-104 36.0082 38.0 37.0 38.0 33.0 38.0 105-109 35.851549999999996 38.0 37.0 38.0 32.6 38.0 110-114 35.6308 38.0 37.0 38.0 31.0 38.0 115-119 35.40545 38.0 36.4 38.0 30.2 38.0 120-124 34.867650000000005 38.0 35.6 38.0 27.6 38.0 125-129 34.617900000000006 38.0 34.8 38.0 26.6 38.0 130-134 34.22195 38.0 34.0 38.0 25.0 38.0 135-139 33.3274 38.0 33.0 38.0 20.4 38.0 140-144 32.2824 38.0 32.6 38.0 13.4 38.0 145-149 30.96635 37.6 30.4 38.0 8.0 38.0 150-151 25.137625 32.0 15.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 2.0 4 1.0 5 1.0 6 1.0 7 1.0 8 1.0 9 2.0 10 2.0 11 0.0 12 3.0 13 2.0 14 2.0 15 4.0 16 4.0 17 3.0 18 1.0 19 2.0 20 10.0 21 8.0 22 12.0 23 11.0 24 19.0 25 21.0 26 22.0 27 34.0 28 36.0 29 54.0 30 66.0 31 73.0 32 109.0 33 149.0 34 231.0 35 390.0 36 930.0 37 1792.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.925000000000004 20.150000000000002 13.8 29.125 2 25.4 26.325 33.025 15.25 3 20.95 28.725 30.025000000000002 20.3 4 23.45 34.449999999999996 23.1 19.0 5 23.175 37.375 24.025 15.425 6 19.35 37.625 24.975 18.05 7 19.325 21.3 39.75 19.625 8 22.15 25.174999999999997 27.650000000000002 25.025 9 22.525000000000002 25.55 30.25 21.675 10-14 23.119999999999997 28.835 27.029999999999998 21.015 15-19 22.395 28.33 28.13 21.145 20-24 22.745 28.415000000000003 28.055000000000003 20.785 25-29 22.814999999999998 28.705000000000002 27.855 20.625 30-34 22.305 29.04 27.500000000000004 21.154999999999998 35-39 22.695 29.015 27.810000000000002 20.48 40-44 22.97 28.444999999999997 28.08 20.505000000000003 45-49 22.665 28.365000000000002 28.139999999999997 20.830000000000002 50-54 22.7 28.585 28.165000000000003 20.549999999999997 55-59 23.325000000000003 27.935 27.47 21.27 60-64 23.04 28.125 28.1 20.735 65-69 23.65 27.224999999999998 28.1 21.025 70-74 23.72 27.625 27.889999999999997 20.765 75-79 23.565 27.565 28.17 20.7 80-84 23.125 28.435 27.565 20.875 85-89 22.86 28.060000000000002 27.900000000000002 21.18 90-94 23.215 28.4 27.805000000000003 20.580000000000002 95-99 23.875 27.775 27.935 20.415 100-104 23.745 28.455000000000002 27.26 20.54 105-109 22.939999999999998 28.939999999999998 27.51 20.61 110-114 23.775 28.025 28.349999999999998 19.85 115-119 23.985 27.794999999999998 27.98 20.24 120-124 23.605 28.199999999999996 28.055000000000003 20.14 125-129 23.835 27.87 27.595 20.7 130-134 24.125 27.875 27.92 20.080000000000002 135-139 23.935000000000002 28.544999999999998 27.145000000000003 20.375 140-144 23.895 27.584999999999997 28.18 20.34 145-149 24.355 28.15 27.61 19.885 150-151 24.5375 27.6375 27.725 20.1 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.0 17 0.0 18 0.0 19 0.5 20 0.5 21 0.5 22 1.5 23 2.0 24 2.5 25 5.5 26 7.5 27 7.5 28 11.5 29 15.5 30 23.5 31 28.5 32 33.5 33 38.0 34 44.5 35 60.0 36 80.0 37 99.5 38 130.5 39 177.0 40 201.5 41 223.5 42 260.0 43 292.5 44 298.5 45 276.0 46 257.5 47 231.5 48 212.5 49 202.5 50 164.0 51 140.5 52 126.5 53 95.0 54 69.5 55 47.0 56 37.0 57 32.0 58 21.0 59 13.5 60 7.0 61 6.5 62 6.5 63 2.5 64 1.5 65 1.5 66 0.5 67 0.5 68 0.5 69 0.0 70 0.5 71 0.5 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.1 #Duplication Level Percentage of deduplicated Percentage of total 1 99.2936427850656 98.4 2 0.5802219979818365 1.15 3 0.07568113017154389 0.22499999999999998 4 0.025227043390514632 0.1 5 0.025227043390514632 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source ATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATCAATCAAT 5 0.125 No Hit >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.025 0.0 0.0 0.0 0.0 58-59 0.025 0.0 0.0 0.0 0.0 60-61 0.025 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.025 0.0 0.0 0.0 0.0 72-73 0.05 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.075 0.0 0.0 0.0 0.0 78-79 0.0875 0.0 0.0 0.0 0.0 80-81 0.1125 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.16249999999999998 0.0 0.0 0.0 0.0 86-87 0.225 0.0 0.0 0.0 0.0 88-89 0.275 0.0 0.0 0.0 0.0 90-91 0.3375 0.0 0.0 0.0 0.0 92-93 0.4375 0.0 0.0 0.0 0.0 94-95 0.5125 0.0 0.0 0.0 0.0 96-97 0.55 0.0 0.0 0.0 0.0 98-99 0.6875 0.0 0.0 0.0 0.0 100-101 0.7875 0.0 0.0 0.0 0.0 102-103 0.95 0.0 0.0 0.0 0.0 104-105 1.0625 0.0 0.0 0.0 0.0 106-107 1.15 0.0 0.0 0.0 0.0 108-109 1.35 0.0 0.0 0.0 0.0 110-111 1.475 0.0 0.0 0.0 0.0 112-113 1.6375 0.0 0.0 0.0 0.0 114-115 1.75 0.0 0.0 0.0 0.0 116-117 1.9 0.0 0.0 0.0 0.0 118-119 2.05 0.0 0.0 0.0 0.0 120-121 2.35 0.0 0.0 0.0 0.0 122-123 2.6625 0.0 0.0 0.0 0.0 124-125 2.85 0.0 0.0 0.0 0.0 126-127 3.0999999999999996 0.0 0.0 0.0 0.0 128-129 3.2375 0.0 0.0 0.0 0.0 130-131 3.4 0.0 0.0 0.0 0.0 132-133 3.675 0.0 0.0 0.0 0.0 134-135 3.9125 0.0 0.0 0.0 0.0 136-137 4.0875 0.0 0.0 0.0 0.0 138-139 4.4 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTCATAC 10 0.006830828 145.0 5 GCCGTAT 10 0.006830828 145.0 145 TACTCCA 10 0.006830828 145.0 9 TCATACT 10 0.006830828 145.0 6 >>END_MODULE Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702760 spots for SRR7170497.sra Written 702760 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra Read 702752 spots for SRR7170497.sra Written 702752 spots for SRR7170497.sra SRR ids: ['SRR7170497.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_qi7n9n41 SRR7170497.sra spots: 14055048 blocks: [[1, 702752], [702753, 1405504], [1405505, 2108256], [2108257, 2811008], [2811009, 3513760], [3513761, 4216512], [4216513, 4919264], [4919265, 5622016], [5622017, 6324768], [6324769, 7027520], [7027521, 7730272], [7730273, 8433024], [8433025, 9135776], [9135777, 9838528], [9838529, 10541280], [10541281, 11244032], [11244033, 11946784], [11946785, 12649536], [12649537, 13352288], [13352289, 14055048]] SRR7170497 file size 4741094 SRR7170497 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170497 SRR7170497_1.fastq SRR7170497_2.fastq Input file: SRR7170497_1.fastq Paired file: SRR7170497_2.fastq trimmed: SRR7170497-trimmed-pair1.fastq, SRR7170497-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 02:31:03 2025 >> started Thu Feb 13 02:37:59 2025 >> done (415.638s) 14055048 read pairs processed; of these: 7836 ( 0.06%) short read pairs filtered out after trimming by size control 8902 ( 0.06%) empty read pairs filtered out after trimming by size control 14038310 (99.88%) read pairs available; of these: 8216586 (58.53%) trimmed read pairs available after processing 5821724 (41.47%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 5 0.00% 21 3 0.00% 22 3 0.00% 23 6 0.00% 24 3 0.00% 25 3 0.00% 26 3 0.00% 27 3 0.00% 28 4 0.00% 29 3 0.00% 30 5 0.00% 31 4 0.00% 32 11 0.00% 33 6 0.00% 34 9 0.00% 35 4 0.00% 36 8 0.00% 37 8 0.00% 38 6 0.00% 39 8 0.00% 40 7 0.00% 41 14 0.00% 42 15 0.00% 43 19 0.00% 44 19 0.00% 45 24 0.00% 46 42 0.00% 47 40 0.00% 48 33 0.00% 49 47 0.00% 50 56 0.00% 51 88 0.00% 52 88 0.00% 53 81 0.00% 54 89 0.00% 55 86 0.00% 56 111 0.00% 57 157 0.00% 58 154 0.00% 59 169 0.00% 60 194 0.00% 61 259 0.00% 62 299 0.00% 63 281 0.00% 64 320 0.00% 65 390 0.00% 66 414 0.00% 67 461 0.00% 68 566 0.00% 69 560 0.00% 70 679 0.00% 71 754 0.01% 72 881 0.01% 73 1027 0.01% 74 1116 0.01% 75 1310 0.01% 76 1419 0.01% 77 1651 0.01% 78 1664 0.01% 79 1906 0.01% 80 2080 0.01% 81 2381 0.02% 82 2629 0.02% 83 2928 0.02% 84 3617 0.03% 85 4261 0.03% 86 4384 0.03% 87 4692 0.03% 88 4964 0.04% 89 5212 0.04% 90 5606 0.04% 91 6088 0.04% 92 6713 0.05% 93 7220 0.05% 94 7735 0.06% 95 8379 0.06% 96 8617 0.06% 97 9039 0.06% 98 9504 0.07% 99 9737 0.07% 100 10505 0.07% 101 10902 0.08% 102 11929 0.08% 103 12208 0.09% 104 12771 0.09% 105 13588 0.10% 106 14053 0.10% 107 14683 0.10% 108 15237 0.11% 109 15339 0.11% 110 15705 0.11% 111 16490 0.12% 112 17001 0.12% 113 18108 0.13% 114 18976 0.14% 115 19519 0.14% 116 20378 0.15% 117 21336 0.15% 118 21813 0.16% 119 22476 0.16% 120 23288 0.17% 121 24525 0.17% 122 25203 0.18% 123 26580 0.19% 124 27714 0.20% 125 29239 0.21% 126 31075 0.22% 127 32760 0.23% 128 34304 0.24% 129 36250 0.26% 130 38667 0.28% 131 41103 0.29% 132 43727 0.31% 133 46894 0.33% 134 50898 0.36% 135 55389 0.39% 136 61247 0.44% 137 67012 0.48% 138 74593 0.53% 139 82971 0.59% 140 93375 0.67% 141 104937 0.75% 142 118863 0.85% 143 138705 0.99% 144 163802 1.17% 145 202124 1.44% 146 255920 1.82% 147 353869 2.52% 148 539380 3.84% 149 1047487 7.46% 150 3888283 27.70% 151 5821724 41.47% 14038310 reads passed initial QC criterion=sequence-density sequence-density=0.57 sequence-density-rank=1 fanout-score=2.12 fanout-score-rank=18 prefix-density=0.59 prefix-fanout=2.1 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.10 sequence-density-rank=23 fanout-score=36.81 fanout-score-rank=1 prefix-density=0.33 prefix-fanout=11.6 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.58 sequence-density-rank=1 fanout-score=2.08 fanout-score-rank=23 prefix-density=0.59 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.02 sequence-density-rank=26 fanout-score=52.46 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=9.0 sequence=CTGAGCTTGAGTGCATTCTTCTAAGTAAAAGAAATCCCTTAATTTCATCACACTTTCCTTCTTTTCCAACAGAAAATGTCTTGCTGTGGAGGAAACTGTGG SRR7170497 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 03:51:46 Started mapping on | Feb 13 03:52:01 Finished on | Feb 13 04:37:04 Mapping speed, Million of reads per hour | 18.70 Number of input reads | 14038310 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 13382745 Uniquely mapped reads % | 95.33% Average mapped length | 293.62 Number of splices: Total | 13361932 Number of splices: Annotated (sjdb) | 13058601 Number of splices: GT/AG | 13115024 Number of splices: GC/AG | 202163 Number of splices: AT/AC | 7954 Number of splices: Non-canonical | 36791 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.16 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 371630 % of reads mapped to multiple loci | 2.65% Number of reads mapped to too many loci | 15965 % of reads mapped to too many loci | 0.11% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 1.86% % of reads unmapped: other | 0.05% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 293191 293191 293191 N_multimapping 371630 371630 371630 N_noFeature 469911 13171954 539730 N_ambiguous 247713 781 106346 UnstrandedReadsAssigned:12665121 PositiveStrandReadsAssigned:210010 NegativeStrandReadsAssigned:12736669 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=150 echo kmer=145 SRR7170497 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170497-trimmed-pair1.fastq SRR7170497-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,038,310 reads, 12,656,233 reads pseudoaligned [quant] estimated average fragment length: 283.204 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,015 rounds 52401 SRR7170497.ke.tsv 34699 SRR7170497.se.tsv 87100 total ==> SRR7170497.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.8 505 21.626 Potri.005G024800.1.v4.1 1035 752.796 164 16.1938 Potri.004G059700.1.v4.1 961 678.864 10 1.09497 Potri.007G009000.2.v4.1 1416 1133.8 0 0 Potri.003G141000.2.v4.1 2943 2660.8 570.319 15.9327 Potri.016G087400.1.v4.1 270 75.2633 765.739 756.276 Potri.015G069301.1.v4.1 564 289.317 0 0 Potri.010G195200.1.v4.1 1773 1490.8 27 1.34626 Potri.012G127500.1.v4.1 977 694.847 244 26.1026 ==> SRR7170497.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 799 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 208 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 2 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 283 Potri.001G416900.v4.1 4 Potri.001G452600.v4.1 1 SRR7170497 completed mapping pipeline successfully