Starting /dee2/code/volunteer_pipeline.sh SRR7170498 current disk space = 3052006326272 free memory = 1580721580 SRR7170498 SRAfilesize 919b3b6ed71a820aff41051b3cb55684 SRR7170498.sra SRR7170498.sra file validated SRR7170498 is paired end SRR7170498 is conventional basespace SRR7170498 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170498_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.01825 25.0 18.0 33.0 18.0 33.0 2 29.2605 31.0 28.0 33.0 25.0 33.0 3 31.65475 33.0 31.0 33.0 28.0 33.0 4 32.36825 33.0 33.0 33.0 31.0 34.0 5 32.90725 33.0 33.0 34.0 32.0 34.0 6 36.9045 38.0 37.0 38.0 35.0 38.0 7 37.4055 38.0 38.0 38.0 37.0 38.0 8 37.50175 38.0 38.0 38.0 37.0 38.0 9 37.61175 38.0 38.0 38.0 38.0 38.0 10-14 37.56425 38.0 38.0 38.0 37.8 38.0 15-19 37.5754 38.0 38.0 38.0 38.0 38.0 20-24 37.459900000000005 38.0 38.0 38.0 37.2 38.0 25-29 37.48695 38.0 38.0 38.0 37.2 38.0 30-34 37.46005 38.0 38.0 38.0 37.2 38.0 35-39 37.44995 38.0 38.0 38.0 37.0 38.0 40-44 37.39190000000001 38.0 38.0 38.0 37.0 38.0 45-49 37.309749999999994 38.0 38.0 38.0 37.0 38.0 50-54 37.256150000000005 38.0 38.0 38.0 36.6 38.0 55-59 37.1648 38.0 38.0 38.0 36.0 38.0 60-64 37.0556 38.0 38.0 38.0 35.8 38.0 65-69 37.0178 38.0 38.0 38.0 36.0 38.0 70-74 36.9467 38.0 38.0 38.0 35.4 38.0 75-79 36.789049999999996 38.0 38.0 38.0 35.0 38.0 80-84 36.7641 38.0 38.0 38.0 35.0 38.0 85-89 36.504650000000005 38.0 38.0 38.0 34.0 38.0 90-94 36.43605 38.0 38.0 38.0 34.0 38.0 95-99 36.3395 38.0 37.4 38.0 34.0 38.0 100-104 36.34805 38.0 37.2 38.0 34.0 38.0 105-109 36.023849999999996 38.0 37.0 38.0 32.8 38.0 110-114 35.9028 38.0 37.0 38.0 31.8 38.0 115-119 35.37135 38.0 36.0 38.0 30.0 38.0 120-124 35.481199999999994 38.0 36.0 38.0 30.6 38.0 125-129 35.038850000000004 38.0 35.6 38.0 28.4 38.0 130-134 31.5046 34.8 28.0 38.0 19.4 38.0 135-139 33.6914 37.8 33.2 38.0 23.4 38.0 140-144 29.6995 33.6 25.2 37.4 14.0 38.0 145-149 31.90225 36.6 31.2 38.0 13.2 38.0 150-151 27.888624999999998 34.5 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 6 1.0 7 0.0 8 0.0 9 0.0 10 1.0 11 1.0 12 2.0 13 2.0 14 1.0 15 0.0 16 1.0 17 0.0 18 0.0 19 5.0 20 4.0 21 2.0 22 4.0 23 8.0 24 13.0 25 17.0 26 13.0 27 17.0 28 31.0 29 38.0 30 45.0 31 77.0 32 78.0 33 152.0 34 255.0 35 507.0 36 1421.0 37 1304.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 38.239916186485075 10.188580408590884 9.769512833944475 41.80199057097957 2 21.916437327995997 14.635976982737054 36.00200150112585 27.445584188141105 3 19.325 20.349999999999998 26.1 34.225 4 22.3 29.4 22.875 25.424999999999997 5 21.8 32.95 23.775 21.475 6 18.099999999999998 36.375 26.674999999999997 18.85 7 14.524999999999999 25.124999999999996 41.825 18.525 8 17.724999999999998 24.4 32.85 25.025 9 17.599999999999998 25.324999999999996 33.375 23.7 10-14 19.765 30.15 26.974999999999998 23.11 15-19 19.925 28.449999999999996 28.139999999999997 23.485 20-24 19.85 28.89 28.13 23.13 25-29 20.02 28.705000000000002 27.860000000000003 23.415 30-34 19.939999999999998 28.96 27.245 23.855 35-39 20.125 28.015 27.810000000000002 24.05 40-44 19.919999999999998 28.575 27.595 23.91 45-49 20.095 28.655 27.83 23.419999999999998 50-54 19.72 28.65 27.92 23.71 55-59 19.6 28.375 28.175 23.849999999999998 60-64 19.86 28.28 28.249999999999996 23.61 65-69 19.695 28.754999999999995 27.975 23.575 70-74 20.145 28.13 28.134999999999998 23.59 75-79 19.97 28.360000000000003 28.265 23.405 80-84 19.634999999999998 28.04 27.845 24.48 85-89 20.21 28.865000000000002 27.584999999999997 23.34 90-94 20.28 28.634999999999998 27.26 23.825 95-99 20.375 28.305000000000003 27.99 23.330000000000002 100-104 20.235 28.865000000000002 27.779999999999998 23.119999999999997 105-109 20.655 27.894999999999996 27.839999999999996 23.61 110-114 20.215 29.09 27.279999999999998 23.415 115-119 20.580000000000002 28.48 27.375 23.565 120-124 19.89 28.465 27.584999999999997 24.060000000000002 125-129 20.560000000000002 28.01 27.66 23.77 130-134 20.77 28.585 27.46 23.185 135-139 20.715 28.025 27.400000000000002 23.86 140-144 20.195 28.515 27.575 23.715 145-149 20.5 28.110000000000003 27.560000000000002 23.830000000000002 150-151 20.2125 28.012500000000003 28.425 23.35 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.5 15 0.5 16 0.0 17 0.5 18 0.5 19 0.5 20 1.0 21 1.5 22 2.0 23 2.5 24 2.0 25 4.0 26 5.0 27 7.5 28 11.0 29 12.0 30 16.0 31 25.0 32 35.0 33 40.5 34 57.0 35 70.5 36 96.5 37 115.5 38 135.5 39 172.0 40 190.5 41 213.5 42 235.0 43 257.0 44 277.0 45 267.0 46 252.0 47 245.5 48 236.0 49 224.5 50 185.5 51 139.5 52 116.0 53 100.0 54 73.0 55 49.5 56 39.0 57 26.0 58 17.5 59 12.5 60 6.0 61 4.5 62 5.5 63 4.5 64 2.5 65 2.0 66 1.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.55 2 0.075 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.52499999999999 #Duplication Level Percentage of deduplicated Percentage of total 1 99.54785229841748 99.075 2 0.42702838482793265 0.8500000000000001 3 0.025119316754584273 0.075 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content pass #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.15 0.0 0.0 0.0 0.0 84-85 0.175 0.0 0.0 0.0 0.0 86-87 0.23750000000000002 0.0 0.0 0.0 0.0 88-89 0.35 0.0 0.0 0.0 0.0 90-91 0.475 0.0 0.0 0.0 0.0 92-93 0.5875 0.0 0.0 0.0 0.0 94-95 0.65 0.0 0.0 0.0 0.0 96-97 0.7125 0.0 0.0 0.0 0.0 98-99 0.825 0.0 0.0 0.0 0.0 100-101 0.9625 0.0 0.0 0.0 0.0 102-103 1.1124999999999998 0.0 0.0 0.0 0.0 104-105 1.2375 0.0 0.0 0.0 0.0 106-107 1.3375 0.0 0.0 0.0 0.0 108-109 1.5750000000000002 0.0 0.0 0.0 0.0 110-111 1.775 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.1375 0.0 0.0 0.0 0.0 118-119 2.3125 0.0 0.0 0.0 0.0 120-121 2.6875 0.0 0.0 0.0 0.0 122-123 3.0 0.0 0.0 0.0 0.0 124-125 3.2125000000000004 0.0 0.0 0.0 0.0 126-127 3.4 0.0 0.0 0.0 0.0 128-129 3.6125 0.0 0.0 0.0 0.0 130-131 3.6875 0.0 0.0 0.0 0.0 132-133 3.8875 0.0 0.0 0.0 0.0 134-135 4.1625 0.0 0.0 0.0 0.0 136-137 4.2375 0.0 0.0 0.0 0.0 138-139 4.449999999999999 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE SRR7170498 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170498_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.9865 33.0 33.0 34.0 32.0 34.0 2 33.00425 34.0 33.0 34.0 32.0 34.0 3 33.0665 34.0 33.0 34.0 32.0 34.0 4 33.06475 34.0 33.0 34.0 32.0 34.0 5 33.0225 34.0 33.0 34.0 32.0 34.0 6 37.27875 38.0 38.0 38.0 37.0 38.0 7 37.28825 38.0 38.0 38.0 37.0 38.0 8 37.32425 38.0 38.0 38.0 37.0 38.0 9 37.33375 38.0 38.0 38.0 37.0 38.0 10-14 37.22325 38.0 38.0 38.0 37.0 38.0 15-19 35.9106 38.0 36.2 38.0 30.8 38.0 20-24 37.01275 38.0 38.0 38.0 36.2 38.0 25-29 36.94505 38.0 38.0 38.0 36.0 38.0 30-34 37.1227 38.0 38.0 38.0 36.6 38.0 35-39 37.119299999999996 38.0 38.0 38.0 36.4 38.0 40-44 37.1117 38.0 38.0 38.0 36.2 38.0 45-49 37.005050000000004 38.0 38.0 38.0 36.0 38.0 50-54 36.99075 38.0 38.0 38.0 36.0 38.0 55-59 37.0298 38.0 38.0 38.0 36.0 38.0 60-64 36.9382 38.0 38.0 38.0 36.0 38.0 65-69 36.9452 38.0 38.0 38.0 36.0 38.0 70-74 36.8264 38.0 38.0 38.0 35.8 38.0 75-79 36.792649999999995 38.0 38.0 38.0 35.0 38.0 80-84 36.7197 38.0 38.0 38.0 35.0 38.0 85-89 36.347750000000005 38.0 37.8 38.0 33.4 38.0 90-94 34.0225 37.4 33.0 38.0 23.4 38.0 95-99 36.1507 38.0 37.2 38.0 33.4 38.0 100-104 36.20795 38.0 37.4 38.0 34.0 38.0 105-109 35.99595 38.0 37.0 38.0 33.0 38.0 110-114 35.8806 38.0 37.0 38.0 31.8 38.0 115-119 35.68900000000001 38.0 36.8 38.0 31.2 38.0 120-124 35.01065 38.0 35.8 38.0 28.2 38.0 125-129 34.84635 38.0 35.8 38.0 28.0 38.0 130-134 34.4683 38.0 34.6 38.0 26.2 38.0 135-139 33.58194999999999 38.0 33.0 38.0 21.8 38.0 140-144 32.659200000000006 38.0 33.0 38.0 15.4 38.0 145-149 31.301299999999998 37.4 31.2 38.0 8.4 38.0 150-151 25.131625 32.5 16.0 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 2.0 3 1.0 4 1.0 5 1.0 6 0.0 7 0.0 8 1.0 9 0.0 10 2.0 11 1.0 12 0.0 13 2.0 14 1.0 15 2.0 16 2.0 17 1.0 18 4.0 19 6.0 20 10.0 21 12.0 22 10.0 23 9.0 24 16.0 25 16.0 26 24.0 27 26.0 28 33.0 29 49.0 30 56.0 31 69.0 32 90.0 33 147.0 34 201.0 35 419.0 36 926.0 37 1860.0 >>END_MODULE >>Per base sequence content fail #Base G A T C 1 35.925000000000004 19.125 14.05 30.9 2 25.324999999999996 25.025 33.300000000000004 16.35 3 20.349999999999998 27.55 33.025 19.075 4 23.200000000000003 33.95 23.7 19.15 5 23.3 36.0 24.775 15.925 6 19.400000000000002 35.85 25.025 19.725 7 19.125 19.400000000000002 40.75 20.724999999999998 8 20.375 24.175 29.125 26.325 9 21.975 24.875 29.45 23.7 10-14 22.825 29.099999999999998 26.87 21.205 15-19 22.384999999999998 28.37 28.470000000000002 20.775 20-24 22.745 28.48 27.935 20.84 25-29 22.56 28.315 27.965 21.16 30-34 22.735 27.865000000000002 28.46 20.94 35-39 22.605 27.694999999999997 28.050000000000004 21.65 40-44 22.79 28.415000000000003 28.26 20.535 45-49 22.57 27.884999999999998 28.84 20.705000000000002 50-54 22.36 28.15 28.694999999999997 20.794999999999998 55-59 23.365 27.61 28.310000000000002 20.715 60-64 22.675 28.025 28.21 21.09 65-69 23.29 27.694999999999997 28.439999999999998 20.575 70-74 22.935 28.395 27.595 21.075 75-79 22.720000000000002 27.650000000000002 28.235 21.395 80-84 23.165 28.215 27.834999999999997 20.785 85-89 23.305 28.24 27.465 20.990000000000002 90-94 23.419999999999998 27.339999999999996 28.235 21.005 95-99 23.995 27.944999999999997 28.025 20.035 100-104 24.03 27.66 27.99 20.32 105-109 23.82 27.965 27.35 20.865000000000002 110-114 23.400000000000002 28.125 28.000000000000004 20.474999999999998 115-119 23.674999999999997 28.26 27.315 20.75 120-124 23.93 28.28 27.855 19.935 125-129 23.74 28.235 27.73 20.294999999999998 130-134 24.779999999999998 28.035 27.24 19.945 135-139 23.75 28.050000000000004 27.83 20.369999999999997 140-144 24.15 28.115000000000002 27.439999999999998 20.294999999999998 145-149 23.89 28.705000000000002 27.68 19.725 150-151 25.0 27.4125 27.275 20.3125 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.5 15 0.5 16 0.0 17 0.0 18 0.5 19 0.5 20 0.0 21 0.0 22 1.0 23 2.0 24 2.0 25 3.0 26 4.0 27 5.0 28 9.0 29 11.0 30 14.5 31 23.5 32 30.0 33 41.5 34 58.5 35 72.5 36 80.5 37 99.0 38 133.5 39 169.5 40 207.0 41 238.0 42 258.0 43 283.0 44 284.5 45 271.0 46 263.5 47 250.0 48 232.0 49 204.5 50 173.0 51 134.0 52 98.0 53 81.5 54 77.0 55 58.0 56 36.5 57 26.5 58 21.5 59 16.0 60 8.5 61 5.0 62 5.0 63 3.0 64 1.0 65 1.0 66 0.0 67 0.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.575 #Duplication Level Percentage of deduplicated Percentage of total 1 99.62339944765253 99.2 2 0.3263871453678132 0.65 3 0.05021340697966357 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.025 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.025 0.0 0.0 0.0 0.0 68-69 0.025 0.0 0.0 0.0 0.0 70-71 0.05 0.0 0.0 0.0 0.0 72-73 0.075 0.0 0.0 0.0 0.0 74-75 0.075 0.0 0.0 0.0 0.0 76-77 0.0875 0.0 0.0 0.0 0.0 78-79 0.1 0.0 0.0 0.0 0.0 80-81 0.1 0.0 0.0 0.0 0.0 82-83 0.1375 0.0 0.0 0.0 0.0 84-85 0.15 0.0 0.0 0.0 0.0 86-87 0.2 0.0 0.0 0.0 0.0 88-89 0.30000000000000004 0.0 0.0 0.0 0.0 90-91 0.425 0.0 0.0 0.0 0.0 92-93 0.5375 0.0 0.0 0.0 0.0 94-95 0.6 0.0 0.0 0.0 0.0 96-97 0.6625 0.0 0.0 0.0 0.0 98-99 0.775 0.0 0.0 0.0 0.0 100-101 0.9125 0.0 0.0 0.0 0.0 102-103 1.0625 0.0 0.0 0.0 0.0 104-105 1.2125 0.0 0.0 0.0 0.0 106-107 1.3250000000000002 0.0 0.0 0.0 0.0 108-109 1.5625 0.0 0.0 0.0 0.0 110-111 1.75 0.0 0.0 0.0 0.0 112-113 1.9625 0.0 0.0 0.0 0.0 114-115 2.05 0.0 0.0 0.0 0.0 116-117 2.1624999999999996 0.0 0.0 0.0 0.0 118-119 2.3375 0.0 0.0 0.0 0.0 120-121 2.725 0.0 0.0 0.0 0.0 122-123 3.1125 0.0 0.0 0.0 0.0 124-125 3.375 0.0 0.0 0.0 0.0 126-127 3.625 0.0 0.0 0.0 0.0 128-129 3.8875 0.0 0.0 0.0 0.0 130-131 4.0 0.0 0.0 0.0 0.0 132-133 4.3125 0.0 0.0 0.0 0.0 134-135 4.6625 0.0 0.0 0.0 0.0 136-137 4.7875 0.0 0.0 0.0 0.0 138-139 5.025 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779611 spots for SRR7170498.sra Written 779611 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra Read 779598 spots for SRR7170498.sra Written 779598 spots for SRR7170498.sra SRR ids: ['SRR7170498.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_btayfact SRR7170498.sra spots: 15591973 blocks: [[1, 779598], [779599, 1559196], [1559197, 2338794], [2338795, 3118392], [3118393, 3897990], [3897991, 4677588], [4677589, 5457186], [5457187, 6236784], [6236785, 7016382], [7016383, 7795980], [7795981, 8575578], [8575579, 9355176], [9355177, 10134774], [10134775, 10914372], [10914373, 11693970], [11693971, 12473568], [12473569, 13253166], [13253167, 14032764], [14032765, 14812362], [14812363, 15591973]] SRR7170498 file size 5261907 SRR7170498 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170498 SRR7170498_1.fastq SRR7170498_2.fastq Input file: SRR7170498_1.fastq Paired file: SRR7170498_2.fastq trimmed: SRR7170498-trimmed-pair1.fastq, SRR7170498-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:49:05 2025 >> started Thu Feb 13 04:55:28 2025 >> done (383.532s) 15591973 read pairs processed; of these: 6588 ( 0.04%) short read pairs filtered out after trimming by size control 6693 ( 0.04%) empty read pairs filtered out after trimming by size control 15578692 (99.91%) read pairs available; of these: 9129919 (58.61%) trimmed read pairs available after processing 6448773 (41.39%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 3 0.00% 20 4 0.00% 21 0 0.00% 22 3 0.00% 23 3 0.00% 24 3 0.00% 25 4 0.00% 26 3 0.00% 27 5 0.00% 28 0 0.00% 29 2 0.00% 30 5 0.00% 31 2 0.00% 32 7 0.00% 33 4 0.00% 34 6 0.00% 35 10 0.00% 36 4 0.00% 37 13 0.00% 38 14 0.00% 39 17 0.00% 40 18 0.00% 41 12 0.00% 42 23 0.00% 43 30 0.00% 44 24 0.00% 45 31 0.00% 46 35 0.00% 47 49 0.00% 48 64 0.00% 49 71 0.00% 50 67 0.00% 51 93 0.00% 52 90 0.00% 53 106 0.00% 54 105 0.00% 55 132 0.00% 56 133 0.00% 57 160 0.00% 58 193 0.00% 59 195 0.00% 60 268 0.00% 61 303 0.00% 62 340 0.00% 63 390 0.00% 64 388 0.00% 65 459 0.00% 66 516 0.00% 67 557 0.00% 68 615 0.00% 69 718 0.00% 70 814 0.01% 71 925 0.01% 72 1052 0.01% 73 1229 0.01% 74 1408 0.01% 75 1529 0.01% 76 1634 0.01% 77 1836 0.01% 78 1977 0.01% 79 2215 0.01% 80 2502 0.02% 81 2788 0.02% 82 3129 0.02% 83 3546 0.02% 84 4325 0.03% 85 4561 0.03% 86 4994 0.03% 87 5249 0.03% 88 5591 0.04% 89 6137 0.04% 90 6428 0.04% 91 6979 0.04% 92 7401 0.05% 93 8179 0.05% 94 8727 0.06% 95 9426 0.06% 96 9766 0.06% 97 10221 0.07% 98 10754 0.07% 99 11030 0.07% 100 12043 0.08% 101 12378 0.08% 102 12944 0.08% 103 13738 0.09% 104 14527 0.09% 105 15502 0.10% 106 15843 0.10% 107 16444 0.11% 108 17124 0.11% 109 17356 0.11% 110 18079 0.12% 111 18707 0.12% 112 19094 0.12% 113 20058 0.13% 114 20899 0.13% 115 22044 0.14% 116 22731 0.15% 117 23569 0.15% 118 24188 0.16% 119 24470 0.16% 120 25836 0.17% 121 26697 0.17% 122 27888 0.18% 123 28799 0.18% 124 30598 0.20% 125 31567 0.20% 126 33793 0.22% 127 34768 0.22% 128 37088 0.24% 129 39447 0.25% 130 41013 0.26% 131 43453 0.28% 132 46311 0.30% 133 49845 0.32% 134 53775 0.35% 135 59107 0.38% 136 64613 0.41% 137 70785 0.45% 138 78561 0.50% 139 87617 0.56% 140 98101 0.63% 141 111375 0.71% 142 127005 0.82% 143 148601 0.95% 144 178295 1.14% 145 220288 1.41% 146 281818 1.81% 147 393131 2.52% 148 608074 3.90% 149 1185618 7.61% 150 4351664 27.93% 151 6448773 41.39% 15578692 reads passed initial QC criterion=sequence-density sequence-density=0.51 sequence-density-rank=1 fanout-score=2.26 fanout-score-rank=14 prefix-density=0.54 prefix-fanout=2.2 sequence=TGAGATGCCTCAGTGCATCCAAACATGGGTAG criterion=fanout-score sequence-density=0.12 sequence-density-rank=23 fanout-score=34.87 fanout-score-rank=1 prefix-density=0.36 prefix-fanout=11.5 sequence=CCATTCTTGAGTTCCTTCACCTTCAACTC criterion=sequence-density sequence-density=0.54 sequence-density-rank=1 fanout-score=2.15 fanout-score-rank=19 prefix-density=0.55 prefix-fanout=2.1 sequence=TGTAAGAGATGGCTTCCTC criterion=fanout-score sequence-density=0.01 sequence-density-rank=27 fanout-score=12.37 fanout-score-rank=1 prefix-density=0.07 prefix-fanout=1.0 sequence=GCTACACAGAGAACACATTCATAC SRR7170498 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:46:21 Started mapping on | Feb 13 05:46:32 Finished on | Feb 13 05:55:14 Mapping speed, Million of reads per hour | 107.44 Number of input reads | 15578692 Average input read length | 294 UNIQUE READS: Uniquely mapped reads number | 14749929 Uniquely mapped reads % | 94.68% Average mapped length | 293.70 Number of splices: Total | 14631651 Number of splices: Annotated (sjdb) | 14303188 Number of splices: GT/AG | 14356867 Number of splices: GC/AG | 225498 Number of splices: AT/AC | 8569 Number of splices: Non-canonical | 40717 Mismatch rate per base, % | 0.36% Deletion rate per base | 0.03% Deletion average length | 2.70 Insertion rate per base | 0.02% Insertion average length | 2.21 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 409713 % of reads mapped to multiple loci | 2.63% Number of reads mapped to too many loci | 12821 % of reads mapped to too many loci | 0.08% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 2.57% % of reads unmapped: other | 0.04% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 427507 427507 427507 N_multimapping 409713 409713 409713 N_noFeature 508559 14521921 587638 N_ambiguous 263811 925 114357 UnstrandedReadsAssigned:13977559 PositiveStrandReadsAssigned:227083 NegativeStrandReadsAssigned:14047934 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170498 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170498-trimmed-pair1.fastq SRR7170498-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 15,578,692 reads, 13,979,043 reads pseudoaligned [quant] estimated average fragment length: 283.787 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,037 rounds 52401 SRR7170498.ke.tsv 34699 SRR7170498.se.tsv 87100 total ==> SRR7170498.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1735.21 451 18.031 Potri.005G024800.1.v4.1 1035 752.213 122 11.2516 Potri.004G059700.1.v4.1 961 678.234 20 2.04572 Potri.007G009000.2.v4.1 1416 1133.21 0 0 Potri.003G141000.2.v4.1 2943 2660.21 761.772 19.8657 Potri.016G087400.1.v4.1 270 76.561 1036 938.747 Potri.015G069301.1.v4.1 564 288.673 0 0 Potri.010G195200.1.v4.1 1773 1490.21 90 4.18977 Potri.012G127500.1.v4.1 977 694.213 84 8.39426 ==> SRR7170498.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 1062 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 11 Potri.001G182400.v4.1 1 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 31 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 5 SRR7170498 completed mapping pipeline successfully