Starting /dee2/code/volunteer_pipeline.sh SRR7170499 current disk space = 3052003688448 free memory = 1576695732 SRR7170499 SRAfilesize 7167a0dcbad3325f1fd093b7b533e28c SRR7170499.sra SRR7170499.sra file validated SRR7170499 is paired end SRR7170499 is conventional basespace SRR7170499 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170499_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 43 >>END_MODULE >>Per base sequence quality fail #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 25.5905 27.0 18.0 33.0 18.0 33.0 2 29.13825 31.0 27.0 33.0 25.0 33.0 3 30.62775 31.0 29.0 33.0 27.0 33.0 4 30.7705 31.0 30.0 33.0 28.0 33.0 5 32.3 33.0 32.0 33.0 32.0 33.0 6 36.689 38.0 37.0 38.0 34.0 38.0 7 37.1655 38.0 38.0 38.0 36.0 38.0 8 37.548 38.0 38.0 38.0 37.0 38.0 9 37.534 38.0 38.0 38.0 37.0 38.0 10-14 37.6145 38.0 38.0 38.0 37.8 38.0 15-19 37.622 38.0 38.0 38.0 38.0 38.0 20-24 37.1999 38.0 38.0 38.0 36.2 38.0 25-29 36.44160000000001 38.0 37.6 38.0 31.6 38.0 30-34 37.46955 38.0 38.0 38.0 37.4 38.0 35-39 37.5561 38.0 38.0 38.0 37.8 38.0 40-44 36.9405 38.0 37.8 38.0 35.4 38.0 45-49 35.025850000000005 38.0 34.4 38.0 25.4 38.0 50-54 37.236599999999996 38.0 37.8 38.0 36.4 38.0 55-59 37.30485 38.0 38.0 38.0 36.8 38.0 60-64 37.242399999999996 38.0 38.0 38.0 36.2 38.0 65-69 37.1785 38.0 38.0 38.0 36.0 38.0 70-74 37.12564999999999 38.0 38.0 38.0 36.0 38.0 75-79 37.0559 38.0 38.0 38.0 36.0 38.0 80-84 36.9782 38.0 38.0 38.0 35.4 38.0 85-89 36.738 38.0 38.0 38.0 35.0 38.0 90-94 36.59085 38.0 38.0 38.0 34.2 38.0 95-99 36.680550000000004 38.0 38.0 38.0 34.4 38.0 100-104 36.592 38.0 38.0 38.0 34.0 38.0 105-109 36.464749999999995 38.0 37.6 38.0 34.0 38.0 110-114 36.072700000000005 38.0 37.0 38.0 33.2 38.0 115-119 35.70955 38.0 36.4 38.0 31.0 38.0 120-124 35.53835 38.0 36.0 38.0 30.2 38.0 125-129 35.45955 38.0 36.0 38.0 31.0 38.0 130-134 35.1217 38.0 35.6 38.0 29.2 38.0 135-139 34.4873 38.0 33.8 38.0 27.4 38.0 140-144 29.567700000000002 33.6 23.6 37.2 16.6 38.0 145-149 26.36515 32.8 15.4 37.6 4.2 38.0 150-151 17.018 12.5 2.0 32.0 2.0 37.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 5 1.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 1.0 12 0.0 13 0.0 14 0.0 15 2.0 16 1.0 17 2.0 18 0.0 19 4.0 20 3.0 21 1.0 22 5.0 23 5.0 24 10.0 25 8.0 26 19.0 27 22.0 28 13.0 29 35.0 30 58.0 31 66.0 32 107.0 33 190.0 34 359.0 35 758.0 36 1569.0 37 761.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.906273812547624 11.049022098044196 9.398018796037592 42.64668529337058 2 20.70605908863295 15.773660490736106 32.72408612919379 30.796194291437157 3 19.75 20.175 26.5 33.575 4 22.175 26.974999999999998 22.525000000000002 28.325 5 22.3 33.025 23.05 21.625 6 19.1 35.725 24.95 20.225 7 13.075000000000001 27.175 41.449999999999996 18.3 8 17.925 27.175 29.875 25.025 9 16.6 24.45 34.949999999999996 24.0 10-14 19.220000000000002 30.79 27.229999999999997 22.759999999999998 15-19 18.83 29.409999999999997 27.800000000000004 23.96 20-24 19.45 29.735 27.71 23.105 25-29 19.155 30.29 26.900000000000002 23.655 30-34 19.53 29.73 27.115000000000002 23.625 35-39 19.705000000000002 29.425 27.465 23.405 40-44 19.71 29.815 27.395000000000003 23.080000000000002 45-49 19.555 28.96 27.405 24.08 50-54 19.775000000000002 29.160000000000004 27.48 23.585 55-59 19.825 29.099999999999998 27.46 23.615 60-64 19.445 28.52 27.755000000000003 24.279999999999998 65-69 19.715 28.99 27.57 23.724999999999998 70-74 19.421942194219422 28.66786678667867 28.102810281028102 23.807380738073807 75-79 20.13 28.46 28.110000000000003 23.3 80-84 20.07 28.035 28.09 23.805 85-89 19.63 28.794999999999998 27.589999999999996 23.985 90-94 20.633094964244634 28.389258388758314 27.044056608491275 23.933590038505777 95-99 20.07600380019001 28.276413820691033 27.731386569328464 23.916195809790487 100-104 20.544999999999998 28.315 26.755000000000003 24.385 105-109 20.255000000000003 28.725 27.58 23.44 110-114 20.8 28.439999999999998 27.310000000000002 23.45 115-119 20.06 28.185 27.575 24.18 120-124 20.4 28.660000000000004 26.575 24.365000000000002 125-129 20.544999999999998 28.645 27.235 23.575 130-134 20.335 28.435 26.979999999999997 24.25 135-139 20.65 27.750000000000004 27.245 24.355 140-144 20.294999999999998 28.110000000000003 27.375 24.22 145-149 20.385 28.325 26.71 24.58 150-151 19.725 28.8625 26.987499999999997 24.425 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.5 9 0.5 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 1.0 19 1.0 20 0.5 21 0.5 22 1.0 23 3.0 24 2.0 25 3.0 26 9.0 27 12.5 28 13.0 29 17.0 30 26.5 31 29.5 32 35.5 33 57.5 34 84.5 35 95.5 36 100.5 37 123.5 38 136.0 39 147.0 40 186.0 41 213.5 42 223.5 43 246.0 44 267.0 45 248.5 46 241.0 47 236.5 48 199.5 49 185.5 50 173.5 51 145.0 52 118.0 53 99.5 54 83.0 55 64.5 56 49.5 57 39.0 58 26.0 59 16.0 60 10.5 61 7.0 62 8.5 63 5.0 64 1.0 65 1.0 66 1.5 67 1.0 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 1.575 2 0.15 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.01 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.015 95-99 0.005 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.8 #Duplication Level Percentage of deduplicated Percentage of total 1 99.03846153846155 97.85000000000001 2 0.784412955465587 1.55 3 0.12651821862348178 0.375 4 0.025303643724696356 0.1 5 0.025303643724696356 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source CCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCA 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3 0.0 0.0 0.0 0.0 88-89 0.44999999999999996 0.0 0.0 0.0 0.0 90-91 0.55 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.75 0.0 0.0 0.0 0.0 96-97 0.8875 0.0 0.0 0.0 0.0 98-99 1.0875 0.0 0.0 0.0 0.0 100-101 1.3 0.0 0.0 0.0 0.0 102-103 1.4375 0.0 0.0 0.0 0.0 104-105 1.575 0.0 0.0 0.0 0.0 106-107 1.825 0.0 0.0 0.0 0.0 108-109 2.0625 0.0 0.0 0.0 0.0 110-111 2.3 0.0 0.0 0.0 0.0 112-113 2.5 0.0 0.0 0.0 0.0 114-115 2.7125 0.0 0.0 0.0 0.0 116-117 2.95 0.0 0.0 0.0 0.0 118-119 3.3 0.0 0.0 0.0 0.0 120-121 3.55 0.0 0.0 0.0 0.0 122-123 3.8375000000000004 0.0 0.0 0.0 0.0 124-125 4.25 0.0 0.0 0.0 0.0 126-127 4.475 0.0 0.0 0.0 0.0 128-129 4.6875 0.0 0.0 0.0 0.0 130-131 4.975 0.0 0.0 0.0 0.0 132-133 5.2875 0.0 0.0 0.0 0.0 134-135 5.725 0.0 0.0 0.0 0.0 136-137 5.925000000000001 0.0 0.0 0.0 0.0 138-139 6.1125 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position GAAAACA 10 0.0068343505 144.975 6 AAAACAT 10 0.0068343505 144.975 7 >>END_MODULE SRR7170499 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170499_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 33.08075 33.0 33.0 34.0 32.0 34.0 2 33.06525 34.0 33.0 34.0 33.0 34.0 3 33.1195 34.0 33.0 34.0 33.0 34.0 4 33.05325 34.0 33.0 34.0 33.0 34.0 5 33.10475 34.0 33.0 34.0 33.0 34.0 6 37.17825 38.0 38.0 38.0 37.0 38.0 7 37.25825 38.0 38.0 38.0 37.0 38.0 8 37.17325 38.0 38.0 38.0 37.0 38.0 9 37.2765 38.0 38.0 38.0 37.0 38.0 10-14 36.567 38.0 37.2 38.0 32.8 38.0 15-19 36.826100000000004 38.0 37.8 38.0 35.2 38.0 20-24 36.85955 38.0 38.0 38.0 36.2 38.0 25-29 36.92435 38.0 38.0 38.0 36.2 38.0 30-34 37.10795 38.0 38.0 38.0 37.0 38.0 35-39 37.063 38.0 38.0 38.0 36.8 38.0 40-44 37.09135 38.0 38.0 38.0 36.8 38.0 45-49 35.91405 38.0 35.8 38.0 31.0 38.0 50-54 36.197 38.0 37.4 38.0 32.2 38.0 55-59 37.07125 38.0 38.0 38.0 36.8 38.0 60-64 36.9688 38.0 38.0 38.0 35.8 38.0 65-69 36.89444999999999 38.0 38.0 38.0 36.0 38.0 70-74 36.8343 38.0 38.0 38.0 35.8 38.0 75-79 36.81575 38.0 38.0 38.0 36.0 38.0 80-84 36.70485 38.0 38.0 38.0 35.6 38.0 85-89 36.630250000000004 38.0 38.0 38.0 35.0 38.0 90-94 36.63844999999999 38.0 38.0 38.0 35.0 38.0 95-99 36.45425 38.0 38.0 38.0 34.0 38.0 100-104 36.1493 38.0 37.8 38.0 33.8 38.0 105-109 36.12495 38.0 37.6 38.0 33.6 38.0 110-114 36.141400000000004 38.0 38.0 38.0 33.8 38.0 115-119 35.7882 38.0 37.0 38.0 32.2 38.0 120-124 35.482949999999995 38.0 36.6 38.0 30.2 38.0 125-129 34.98780000000001 38.0 36.0 38.0 28.0 38.0 130-134 34.837900000000005 38.0 35.0 38.0 28.6 38.0 135-139 34.04475 38.0 33.8 38.0 24.4 38.0 140-144 33.428549999999994 38.0 33.0 38.0 20.8 38.0 145-149 32.56975 38.0 33.0 38.0 12.0 38.0 150-151 26.909625 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 9.0 3 1.0 4 0.0 5 2.0 6 1.0 7 1.0 8 0.0 9 1.0 10 1.0 11 2.0 12 0.0 13 6.0 14 2.0 15 1.0 16 1.0 17 3.0 18 5.0 19 3.0 20 3.0 21 4.0 22 11.0 23 12.0 24 14.0 25 15.0 26 25.0 27 24.0 28 21.0 29 31.0 30 43.0 31 72.0 32 88.0 33 102.0 34 176.0 35 304.0 36 824.0 37 2192.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 36.4 19.15 17.175 27.275 2 27.075 24.95 30.475 17.5 3 19.900000000000002 28.775000000000002 31.65 19.675 4 23.875 33.925 23.5 18.7 5 26.424999999999997 34.975 21.375 17.224999999999998 6 20.525 38.35 22.8 18.325 7 19.900000000000002 21.475 38.574999999999996 20.05 8 22.400000000000002 25.924999999999997 27.250000000000004 24.425 9 22.125 25.650000000000002 29.049999999999997 23.175 10-14 23.775 28.48 26.240000000000002 21.505 15-19 23.57 27.99 27.445000000000004 20.995 20-24 23.56 28.384999999999998 27.455000000000002 20.599999999999998 25-29 23.425 28.035 27.655 20.885 30-34 23.1 27.689999999999998 27.655 21.555 35-39 23.380000000000003 28.310000000000002 27.46 20.849999999999998 40-44 23.215 27.935 27.675 21.175 45-49 23.355 28.110000000000003 27.73 20.805 50-54 23.32 28.27 27.115000000000002 21.295 55-59 22.715 27.72 28.044999999999998 21.52 60-64 23.794999999999998 28.095 27.48 20.630000000000003 65-69 23.93 27.215 27.305 21.55 70-74 23.669999999999998 28.165000000000003 27.04 21.125 75-79 23.849999999999998 27.11 27.855 21.185000000000002 80-84 24.0 28.155 26.474999999999998 21.37 85-89 23.945 28.07 27.165 20.82 90-94 23.82 27.73 27.265 21.185000000000002 95-99 23.96 27.88 27.43 20.73 100-104 24.490000000000002 27.05 27.655 20.805 105-109 24.404999999999998 27.87 27.644999999999996 20.080000000000002 110-114 24.240000000000002 28.310000000000002 27.01 20.44 115-119 24.735 27.715 27.79 19.759999999999998 120-124 24.925 27.67 27.08 20.325 125-129 24.935 28.175 27.105 19.785 130-134 24.735 28.21 27.05 20.005 135-139 25.014999999999997 26.88 27.994999999999997 20.11 140-144 24.905 27.91 27.265 19.919999999999998 145-149 25.46 27.26 27.650000000000002 19.63 150-151 25.825 26.525 27.150000000000002 20.5 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.5 8 0.5 9 0.0 10 0.0 11 0.0 12 0.0 13 0.0 14 0.0 15 0.0 16 0.5 17 0.5 18 0.0 19 0.0 20 0.0 21 0.5 22 1.0 23 0.5 24 1.0 25 2.5 26 3.5 27 5.0 28 6.5 29 8.5 30 13.5 31 20.0 32 27.5 33 31.0 34 34.5 35 56.5 36 71.5 37 87.5 38 128.0 39 154.5 40 178.0 41 211.0 42 235.5 43 268.5 44 278.5 45 270.5 46 266.0 47 261.5 48 239.0 49 205.5 50 192.5 51 160.5 52 116.5 53 102.5 54 99.5 55 73.5 56 46.5 57 37.0 58 33.0 59 24.0 60 15.0 61 10.5 62 7.5 63 4.5 64 3.5 65 2.0 66 0.5 67 0.5 68 0.0 69 0.0 70 0.0 71 0.0 72 0.0 73 0.0 74 0.5 75 0.5 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.0 35-39 0.0 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.0 80-84 0.0 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.9 #Duplication Level Percentage of deduplicated Percentage of total 1 99.29221435793731 98.2 2 0.5308392315470172 1.05 3 0.10111223458038424 0.3 4 0.02527805864509606 0.1 5 0.02527805864509606 0.125 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.02527805864509606 0.22499999999999998 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAA 9 0.22499999999999998 No Hit AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 5 0.125 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0 0.0 0.0 0.0 0.0 64-65 0.0 0.0 0.0 0.0 0.0 66-67 0.0 0.0 0.0 0.0 0.0 68-69 0.0 0.0 0.0 0.0 0.0 70-71 0.0 0.0 0.0 0.0 0.0 72-73 0.0 0.0 0.0 0.0 0.0 74-75 0.0 0.0 0.0 0.0 0.0 76-77 0.05 0.0 0.0 0.0 0.0 78-79 0.075 0.0 0.0 0.0 0.0 80-81 0.16249999999999998 0.0 0.0 0.0 0.0 82-83 0.21250000000000002 0.0 0.0 0.0 0.0 84-85 0.2625 0.0 0.0 0.0 0.0 86-87 0.3125 0.0 0.0 0.0 0.0 88-89 0.475 0.0 0.0 0.0 0.0 90-91 0.575 0.0 0.0 0.0 0.0 92-93 0.6625 0.0 0.0 0.0 0.0 94-95 0.8 0.0 0.0 0.0 0.0 96-97 0.9125 0.0 0.0 0.0 0.0 98-99 1.1124999999999998 0.0 0.0 0.0 0.0 100-101 1.325 0.0 0.0 0.0 0.0 102-103 1.4625 0.0 0.0 0.0 0.0 104-105 1.5875 0.0 0.0 0.0 0.0 106-107 1.85 0.0 0.0 0.0 0.0 108-109 2.1375 0.0 0.0 0.0 0.0 110-111 2.3875 0.0 0.0 0.0 0.0 112-113 2.5999999999999996 0.0 0.0 0.0 0.0 114-115 2.8125 0.0 0.0 0.0 0.0 116-117 3.075 0.0 0.0 0.0 0.0 118-119 3.425 0.0 0.0 0.0 0.0 120-121 3.7 0.0 0.0 0.0 0.0 122-123 3.9875 0.0 0.0 0.0 0.0 124-125 4.4 0.0 0.0 0.0 0.0 126-127 4.625 0.0 0.0 0.0 0.0 128-129 4.8375 0.0 0.0 0.0 0.0 130-131 5.125 0.0 0.0 0.0 0.0 132-133 5.5 0.0 0.0 0.0 0.0 134-135 6.0125 0.0 0.0 0.0 0.0 136-137 6.3125 0.0 0.0 0.0 0.0 138-139 6.5625 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position TTTGGGT 10 0.006830828 145.0 9 TCATCCA 10 0.006830828 145.0 4 >>END_MODULE Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608382 spots for SRR7170499.sra Written 608382 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra Read 608367 spots for SRR7170499.sra Written 608367 spots for SRR7170499.sra SRR ids: ['SRR7170499.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_xwuwc6_k SRR7170499.sra spots: 12167355 blocks: [[1, 608367], [608368, 1216734], [1216735, 1825101], [1825102, 2433468], [2433469, 3041835], [3041836, 3650202], [3650203, 4258569], [4258570, 4866936], [4866937, 5475303], [5475304, 6083670], [6083671, 6692037], [6692038, 7300404], [7300405, 7908771], [7908772, 8517138], [8517139, 9125505], [9125506, 9733872], [9733873, 10342239], [10342240, 10950606], [10950607, 11558973], [11558974, 12167355]] SRR7170499 file size 4101416 SRR7170499 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170499 SRR7170499_1.fastq SRR7170499_2.fastq Input file: SRR7170499_1.fastq Paired file: SRR7170499_2.fastq trimmed: SRR7170499-trimmed-pair1.fastq, SRR7170499-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:31:14 2025 >> started Thu Feb 13 04:36:17 2025 >> done (302.894s) 12167355 read pairs processed; of these: 13331 ( 0.11%) short read pairs filtered out after trimming by size control 19742 ( 0.16%) empty read pairs filtered out after trimming by size control 12134282 (99.73%) read pairs available; of these: 6809622 (56.12%) trimmed read pairs available after processing 5324660 (43.88%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 2 0.00% 20 1 0.00% 21 2 0.00% 22 5 0.00% 23 3 0.00% 24 5 0.00% 25 1 0.00% 26 3 0.00% 27 7 0.00% 28 5 0.00% 29 5 0.00% 30 4 0.00% 31 7 0.00% 32 5 0.00% 33 8 0.00% 34 6 0.00% 35 10 0.00% 36 10 0.00% 37 13 0.00% 38 18 0.00% 39 18 0.00% 40 18 0.00% 41 13 0.00% 42 30 0.00% 43 20 0.00% 44 26 0.00% 45 42 0.00% 46 38 0.00% 47 61 0.00% 48 67 0.00% 49 69 0.00% 50 94 0.00% 51 99 0.00% 52 106 0.00% 53 99 0.00% 54 125 0.00% 55 140 0.00% 56 146 0.00% 57 150 0.00% 58 218 0.00% 59 256 0.00% 60 315 0.00% 61 400 0.00% 62 399 0.00% 63 441 0.00% 64 504 0.00% 65 536 0.00% 66 574 0.00% 67 663 0.01% 68 724 0.01% 69 821 0.01% 70 985 0.01% 71 1201 0.01% 72 1333 0.01% 73 1519 0.01% 74 1751 0.01% 75 1828 0.02% 76 2302 0.02% 77 2392 0.02% 78 2364 0.02% 79 2595 0.02% 80 2818 0.02% 81 3344 0.03% 82 3741 0.03% 83 4188 0.03% 84 5187 0.04% 85 5902 0.05% 86 6251 0.05% 87 6294 0.05% 88 6695 0.06% 89 7137 0.06% 90 7564 0.06% 91 8084 0.07% 92 8384 0.07% 93 9216 0.08% 94 10056 0.08% 95 10774 0.09% 96 11031 0.09% 97 11427 0.09% 98 11618 0.10% 99 11861 0.10% 100 12491 0.10% 101 12854 0.11% 102 14224 0.12% 103 14596 0.12% 104 15015 0.12% 105 16080 0.13% 106 16361 0.13% 107 16798 0.14% 108 16976 0.14% 109 17185 0.14% 110 17739 0.15% 111 18372 0.15% 112 19206 0.16% 113 19844 0.16% 114 20613 0.17% 115 21417 0.18% 116 21902 0.18% 117 22625 0.19% 118 22801 0.19% 119 22918 0.19% 120 23672 0.20% 121 24269 0.20% 122 24660 0.20% 123 25805 0.21% 124 26851 0.22% 125 27623 0.23% 126 29001 0.24% 127 30071 0.25% 128 31228 0.26% 129 32224 0.27% 130 32986 0.27% 131 34372 0.28% 132 36210 0.30% 133 38961 0.32% 134 40820 0.34% 135 43801 0.36% 136 46838 0.39% 137 50810 0.42% 138 54289 0.45% 139 59436 0.49% 140 65603 0.54% 141 73175 0.60% 142 83983 0.69% 143 97209 0.80% 144 117911 0.97% 145 144962 1.19% 146 188065 1.55% 147 261808 2.16% 148 411769 3.39% 149 818834 6.75% 150 3295184 27.16% 151 5324660 43.88% 12134282 reads passed initial QC criterion=sequence-density sequence-density=0.62 sequence-density-rank=1 fanout-score=1.95 fanout-score-rank=31 prefix-density=0.61 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.01 sequence-density-rank=30 fanout-score=64.53 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=7.9 sequence=GATCTTCAAAAAACCAATAAAAAAAGGAAAAGCAACGATCTTTTTGCCAGAGCCCAGGTACAATTTGAAC criterion=sequence-density sequence-density=1.57 sequence-density-rank=1 fanout-score=2.02 fanout-score-rank=26 prefix-density=1.55 prefix-fanout=2.0 sequence=CTGCGACTGCGCTGACAAGACCCAGTGTGTCAAGAAGGGAAGCAGCTACACTGCTGGCATCGTCGAGACTGAGAAGAACTATGTCTCCTCCGTAGTCATGGAGGTGCCAGCAGCTGAGAACGATGGCAAGTGCAACTGCGGTACTGGCTGCACTTGCACTACCTGCACATGCGGTCATTAAGCAAGCACATCAACTATCATGTTTGATGTGGGATTGGGAGTGGATTAATAATGTAATTTCTGATAAATAATCTGTGTTCTTCTGTACTTGTGGGTGTGGAGTGAACAAACAAAAGTGTCCGTGAGTGTCTTTATCTTTGTGTCTTCTTCATT criterion=fanout-score sequence-density=0.02 sequence-density-rank=30 fanout-score=15.92 fanout-score-rank=1 prefix-density=0.10 prefix-fanout=3.9 sequence=GCAAAACCACATATAGAGGGTGTAATAGCTAAGTAGCCTGTAAGAGATGGCTTCCTCTGTGATTTCATCGGCGGCCGTTGCCACAGTTAACCGCACCCCTGCACAGGCCAACATGGTTGCACCATTCAACGGCCTCAAGTCTACCTCAGCTTTCCCGGTCACCAGAAAGGC SRR7170499 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:18:17 Started mapping on | Feb 13 05:18:19 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 19.73 Number of input reads | 12134282 Average input read length | 293 UNIQUE READS: Uniquely mapped reads number | 11263998 Uniquely mapped reads % | 92.83% Average mapped length | 292.67 Number of splices: Total | 10746140 Number of splices: Annotated (sjdb) | 10509951 Number of splices: GT/AG | 10546665 Number of splices: GC/AG | 159139 Number of splices: AT/AC | 8286 Number of splices: Non-canonical | 32050 Mismatch rate per base, % | 0.37% Deletion rate per base | 0.03% Deletion average length | 2.62 Insertion rate per base | 0.02% Insertion average length | 2.14 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 304808 % of reads mapped to multiple loci | 2.51% Number of reads mapped to too many loci | 38463 % of reads mapped to too many loci | 0.32% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 4.26% % of reads unmapped: other | 0.09% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 576595 576595 576595 N_multimapping 304808 304808 304808 N_noFeature 288999 10994278 346714 N_ambiguous 310251 798 97913 UnstrandedReadsAssigned:10664748 PositiveStrandReadsAssigned:268922 NegativeStrandReadsAssigned:10819371 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=149 echo kmer=145 SRR7170499 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170499-trimmed-pair1.fastq SRR7170499-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 12,134,282 reads, 10,745,096 reads pseudoaligned [quant] estimated average fragment length: 258.579 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,089 rounds 52401 SRR7170499.ke.tsv 34699 SRR7170499.se.tsv 87100 total ==> SRR7170499.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1760.42 391 14.2582 Potri.005G024800.1.v4.1 1035 777.421 349 28.8187 Potri.004G059700.1.v4.1 961 703.426 6 0.547567 Potri.007G009000.2.v4.1 1416 1158.42 0 0 Potri.003G141000.2.v4.1 2943 2685.42 526 12.5741 Potri.016G087400.1.v4.1 270 79.2678 914.37 740.507 Potri.015G069301.1.v4.1 564 310.381 0 0 Potri.010G195200.1.v4.1 1773 1515.42 145 6.14242 Potri.012G127500.1.v4.1 977 719.426 97 8.65546 ==> SRR7170499.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 321 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 287 Potri.001G212900.v4.1 40 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 88 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 6 SRR7170499 completed mapping pipeline successfully