Starting /dee2/code/volunteer_pipeline.sh SRR7170500 current disk space = 3052012130304 free memory = 1571965668 SRR7170500 SRAfilesize 70345136bb8f401145b547867c0b55de SRR7170500.sra SRR7170500.sra file validated SRR7170500 is paired end SRR7170500 is conventional basespace SRR7170500 read1 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170500_1.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 24.967 25.0 18.0 33.0 18.0 33.0 2 27.00325 28.0 25.0 31.0 18.0 33.0 3 29.77025 31.0 28.0 33.0 25.0 33.0 4 31.6705 33.0 31.0 33.0 29.0 33.0 5 32.58075 33.0 33.0 33.0 32.0 34.0 6 36.30425 38.0 36.0 38.0 33.0 38.0 7 36.754 38.0 37.0 38.0 34.0 38.0 8 37.08225 38.0 38.0 38.0 35.0 38.0 9 37.33775 38.0 38.0 38.0 36.0 38.0 10-14 37.4583 38.0 38.0 38.0 37.0 38.0 15-19 37.4874 38.0 38.0 38.0 37.4 38.0 20-24 37.5646 38.0 38.0 38.0 37.8 38.0 25-29 37.5479 38.0 38.0 38.0 38.0 38.0 30-34 37.517 38.0 38.0 38.0 37.8 38.0 35-39 37.4949 38.0 38.0 38.0 37.4 38.0 40-44 37.450050000000005 38.0 38.0 38.0 37.0 38.0 45-49 37.432500000000005 38.0 38.0 38.0 37.0 38.0 50-54 37.25955 38.0 38.0 38.0 37.0 38.0 55-59 37.201449999999994 38.0 38.0 38.0 36.0 38.0 60-64 37.1237 38.0 38.0 38.0 36.0 38.0 65-69 37.08435000000001 38.0 38.0 38.0 36.0 38.0 70-74 36.9704 38.0 38.0 38.0 35.4 38.0 75-79 36.8859 38.0 38.0 38.0 35.2 38.0 80-84 36.79905 38.0 38.0 38.0 35.2 38.0 85-89 36.6918 38.0 38.0 38.0 34.8 38.0 90-94 36.65995 38.0 38.0 38.0 34.4 38.0 95-99 36.4678 38.0 38.0 38.0 34.0 38.0 100-104 36.1743 38.0 37.0 38.0 33.4 38.0 105-109 36.03555 38.0 37.0 38.0 33.0 38.0 110-114 35.9125 38.0 37.0 38.0 32.6 38.0 115-119 35.66815 38.0 36.4 38.0 31.0 38.0 120-124 35.352 38.0 36.0 38.0 30.0 38.0 125-129 35.0441 38.0 35.4 38.0 28.2 38.0 130-134 34.70115 38.0 34.6 38.0 27.4 38.0 135-139 34.1653 38.0 33.2 38.0 24.6 38.0 140-144 33.362649999999995 38.0 33.0 38.0 21.2 38.0 145-149 32.142450000000004 38.0 32.6 38.0 11.6 38.0 150-151 26.295125 33.0 16.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 1.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 1.0 11 0.0 12 2.0 13 1.0 14 0.0 15 0.0 16 2.0 17 1.0 18 2.0 19 7.0 20 4.0 21 2.0 22 2.0 23 7.0 24 8.0 25 8.0 26 13.0 27 15.0 28 32.0 29 26.0 30 53.0 31 54.0 32 81.0 33 124.0 34 223.0 35 472.0 36 1160.0 37 1699.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.19697759249609 11.281917665450756 9.067222511724857 41.4538822303283 2 20.7 14.099999999999998 32.95 32.25 3 18.35 19.45 28.849999999999998 33.35 4 22.15 29.95 22.775000000000002 25.124999999999996 5 24.525 32.824999999999996 22.625 20.025000000000002 6 18.4 36.625 24.675 20.3 7 14.325 25.174999999999997 42.3 18.2 8 17.424999999999997 26.474999999999998 30.425 25.674999999999997 9 17.525 25.2 34.175 23.1 10-14 19.220000000000002 30.785 26.810000000000002 23.185 15-19 19.57 29.56 27.165 23.705000000000002 20-24 20.06 28.815 27.935 23.189999999999998 25-29 19.695 28.965000000000003 27.875 23.465 30-34 19.550977548877444 29.12645632281614 27.906395319765988 23.416170808540425 35-39 20.061003050152507 29.296464823241163 27.30636531826591 23.336166808340415 40-44 20.205000000000002 29.39 27.189999999999998 23.215 45-49 20.255000000000003 29.134999999999998 27.26 23.35 50-54 19.99 29.18 27.48 23.35 55-59 19.74 28.754999999999995 27.634999999999998 23.87 60-64 20.335 29.005 27.47 23.189999999999998 65-69 19.78 28.915000000000003 27.205000000000002 24.099999999999998 70-74 20.32 28.675 27.400000000000002 23.605 75-79 19.98899779955991 28.42068413682737 27.215443088617725 24.374874974995 80-84 19.997999699954995 29.349402410361552 27.434115117267588 23.218482772415864 85-89 20.485 28.27 27.534999999999997 23.71 90-94 19.805 28.93 27.405 23.86 95-99 20.235 28.215 27.48 24.07 100-104 20.4 28.799999999999997 27.08 23.72 105-109 20.47 28.155 27.41 23.965 110-114 20.23 28.585 28.015 23.169999999999998 115-119 20.75 28.205000000000002 27.229999999999997 23.815 120-124 20.91 27.625 27.425 24.04 125-129 20.330000000000002 28.410000000000004 27.089999999999996 24.169999999999998 130-134 20.29 28.335 27.365000000000002 24.01 135-139 21.08 28.155 26.534999999999997 24.23 140-144 21.38 28.110000000000003 27.065 23.445 145-149 20.630000000000003 28.375 27.01 23.985 150-151 20.5125 28.512500000000003 27.437499999999996 23.5375 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 0.0 1 0.0 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10 0.0 11 0.5 12 0.5 13 0.0 14 0.0 15 0.5 16 0.5 17 0.0 18 0.0 19 1.5 20 1.5 21 0.5 22 0.5 23 2.5 24 4.5 25 4.0 26 3.5 27 7.0 28 11.0 29 15.0 30 23.0 31 30.0 32 36.5 33 54.5 34 67.0 35 82.0 36 109.5 37 119.0 38 126.0 39 146.5 40 178.5 41 199.5 42 212.5 43 236.0 44 265.0 45 268.5 46 267.5 47 271.5 48 238.5 49 204.0 50 176.0 51 138.0 52 110.5 53 99.0 54 82.5 55 63.5 56 45.5 57 30.5 58 20.0 59 19.0 60 15.0 61 4.5 62 2.5 63 1.0 64 1.0 65 0.5 66 0.5 67 0.5 68 0.0 69 0.5 70 0.5 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 4.05 2 0.0 3 0.0 4 0.0 5 0.0 6 0.0 7 0.0 8 0.0 9 0.0 10-14 0.0 15-19 0.0 20-24 0.0 25-29 0.0 30-34 0.005 35-39 0.005 40-44 0.0 45-49 0.0 50-54 0.0 55-59 0.0 60-64 0.0 65-69 0.0 70-74 0.0 75-79 0.02 80-84 0.015 85-89 0.0 90-94 0.0 95-99 0.0 100-104 0.0 105-109 0.0 110-114 0.0 115-119 0.0 120-124 0.0 125-129 0.0 130-134 0.0 135-139 0.0 140-144 0.0 145-149 0.0 150-151 0.0 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 99.2 #Duplication Level Percentage of deduplicated Percentage of total 1 99.24395161290323 98.45 2 0.7056451612903225 1.4000000000000001 3 0.05040322580645161 0.15 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.0 0.0 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences pass >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.1375 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.1124999999999998 0.0 0.0 0.0 0.0 102-103 1.225 0.0 0.0 0.0 0.0 104-105 1.3875 0.0 0.0 0.0 0.0 106-107 1.525 0.0 0.0 0.0 0.0 108-109 1.7625 0.0 0.0 0.0 0.0 110-111 2.125 0.0 0.0 0.0 0.0 112-113 2.45 0.0 0.0 0.0 0.0 114-115 2.5875 0.0 0.0 0.0 0.0 116-117 2.825 0.0 0.0 0.0 0.0 118-119 3.05 0.0 0.0 0.0 0.0 120-121 3.325 0.0 0.0 0.0 0.0 122-123 3.7625 0.0 0.0 0.0 0.0 124-125 4.1 0.0 0.0 0.0 0.0 126-127 4.425 0.0 0.0 0.0 0.0 128-129 4.7375 0.0 0.0 0.0 0.0 130-131 5.050000000000001 0.0 0.0 0.0 0.0 132-133 5.3125 0.0 0.0 0.0 0.0 134-135 5.5625 0.0 0.0 0.0 0.0 136-137 5.762499999999999 0.0 0.0 0.0 0.0 138-139 6.112500000000001 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content warn #Sequence Count PValue Obs/Exp Max Max Obs/Exp Position CCTTGAT 10 0.006832588 144.9875 7 TCAGAGT 10 0.006832588 144.9875 7 >>END_MODULE SRR7170500 read2 length is 151 nt ##FastQC 0.11.5 >>Basic Statistics pass #Measure Value Filename SRR7170500_2.fastq File type Conventional base calls Encoding Sanger / Illumina 1.9 Total Sequences 4000 Sequences flagged as poor quality 0 Sequence length 151 %GC 44 >>END_MODULE >>Per base sequence quality pass #Base Mean Median Lower Quartile Upper Quartile 10th Percentile 90th Percentile 1 32.81125 33.0 33.0 34.0 32.0 34.0 2 32.9615 34.0 33.0 34.0 32.0 34.0 3 33.01725 34.0 33.0 34.0 33.0 34.0 4 32.9735 34.0 33.0 34.0 33.0 34.0 5 33.003 34.0 33.0 34.0 33.0 34.0 6 37.29225 38.0 38.0 38.0 37.0 38.0 7 37.294 38.0 38.0 38.0 37.0 38.0 8 37.26775 38.0 38.0 38.0 37.0 38.0 9 37.2345 38.0 38.0 38.0 37.0 38.0 10-14 37.27005 38.0 38.0 38.0 37.0 38.0 15-19 37.2094 38.0 38.0 38.0 37.0 38.0 20-24 37.23595 38.0 38.0 38.0 37.0 38.0 25-29 37.147200000000005 38.0 38.0 38.0 37.0 38.0 30-34 37.10315 38.0 38.0 38.0 37.0 38.0 35-39 37.09805000000001 38.0 38.0 38.0 37.0 38.0 40-44 37.09765 38.0 38.0 38.0 37.0 38.0 45-49 37.07455 38.0 38.0 38.0 37.0 38.0 50-54 37.04965 38.0 38.0 38.0 37.0 38.0 55-59 37.014900000000004 38.0 38.0 38.0 36.8 38.0 60-64 36.91565000000001 38.0 38.0 38.0 36.2 38.0 65-69 36.92405 38.0 38.0 38.0 36.0 38.0 70-74 36.876099999999994 38.0 38.0 38.0 36.0 38.0 75-79 36.821299999999994 38.0 38.0 38.0 36.0 38.0 80-84 36.73035 38.0 38.0 38.0 36.0 38.0 85-89 36.6452 38.0 38.0 38.0 35.6 38.0 90-94 36.51845 38.0 38.0 38.0 35.0 38.0 95-99 36.47795 38.0 38.0 38.0 34.6 38.0 100-104 36.27625 38.0 38.0 38.0 34.0 38.0 105-109 36.14235 38.0 37.8 38.0 33.8 38.0 110-114 36.013600000000004 38.0 37.4 38.0 33.4 38.0 115-119 35.81485 38.0 37.0 38.0 32.8 38.0 120-124 35.50305 38.0 36.6 38.0 31.2 38.0 125-129 35.1832 38.0 36.0 38.0 31.0 38.0 130-134 34.5095 38.0 35.4 38.0 26.6 38.0 135-139 33.786049999999996 38.0 33.4 38.0 22.4 38.0 140-144 33.172000000000004 38.0 33.0 38.0 18.6 38.0 145-149 32.1861 38.0 33.0 38.0 10.6 38.0 150-151 26.341124999999998 33.0 17.5 37.0 2.0 38.0 >>END_MODULE >>Per sequence quality scores pass #Quality Count 2 11.0 3 2.0 4 6.0 5 2.0 6 5.0 7 2.0 8 0.0 9 2.0 10 1.0 11 1.0 12 1.0 13 3.0 14 1.0 15 2.0 16 0.0 17 3.0 18 7.0 19 3.0 20 9.0 21 2.0 22 11.0 23 9.0 24 12.0 25 9.0 26 12.0 27 21.0 28 37.0 29 24.0 30 41.0 31 40.0 32 69.0 33 94.0 34 157.0 35 291.0 36 723.0 37 2387.0 >>END_MODULE >>Per base sequence content warn #Base G A T C 1 38.10478816746052 20.556530458761593 14.740536475307096 26.598144898470792 2 26.322386563048383 25.444973677613437 31.23589872148408 16.9967410378541 3 21.133116069190272 26.97417899222863 32.43920782150915 19.453497117071947 4 23.834586466165415 34.11027568922306 23.43358395989975 18.62155388471178 5 24.266733517172224 36.09927300075207 22.73752820255703 16.896465279518676 6 19.679919979995 38.38459614903726 22.95573893473368 18.97974493623406 7 20.455113778444613 21.05526381595399 38.5346336584146 19.954988747186796 8 21.73043260815204 25.431357839459867 26.93173293323331 25.906476619154787 9 22.230557639409852 25.131282820705174 30.75768942235559 21.880470117529384 10-14 23.330832708177045 28.707176794198553 26.591647911977994 21.370342585646412 15-19 23.12080872785507 28.015213692323094 27.78500650585527 21.07897107396657 20-24 23.201402805611224 29.138276553106213 27.339679358717433 20.32064128256513 25-29 23.582777805623778 28.1489649641622 27.196631747782067 21.07162548243196 30-34 23.57984457257458 27.97192278766608 28.06217097016796 20.386061669591378 35-39 23.30559454581913 28.042911570082214 27.436334469621016 21.21515941447764 40-44 23.517320900386025 28.4052739760365 27.29733794555572 20.780067178021756 45-49 23.494036283451937 26.997093314623633 28.41535531722963 21.093515084694797 50-54 22.9616637434227 28.128288649461286 27.65722876472062 21.252818842395392 55-59 23.629622206633933 27.50275578715302 27.798376590840768 21.069245415372283 60-64 23.530590770155836 27.68452172170166 28.04529738938718 20.739590118755324 65-69 23.89069942341439 27.761343695161695 27.78641263474555 20.561544246678366 70-74 23.549761845073952 28.242667335171724 27.214840812233643 20.99273000752068 75-79 23.284031085485086 27.540737026823763 28.112308849335673 21.06292303835548 80-84 23.228879418400602 28.117322637252446 27.300075206818754 21.3537227375282 85-89 24.181499122587113 27.310102782652297 27.66608172474304 20.84231637001755 90-94 23.88067184758085 27.490599147656052 27.69616445224367 20.932564552519427 95-99 23.384306843820507 27.826522938079716 27.846578089746803 20.94259212835297 100-104 24.14640260716972 27.686136876410128 27.535723238906996 20.631737277513164 105-109 23.77036851341188 27.671095512659814 27.981950363499625 20.57658561042868 110-114 24.34194033592379 27.991977939333168 27.2048132364001 20.46126848834294 115-119 23.810478816746052 28.292805214339435 27.264978691401353 20.631737277513164 120-124 24.012234255916567 27.908142799839553 27.51704773365423 20.56257521058965 125-129 24.720453291881864 27.703956275384844 27.718999147570578 19.856591285162715 130-134 24.51609668037308 27.62009828502658 27.715374586300275 20.14843044830007 135-139 23.994584294453915 27.805636345401663 28.16166883963494 20.038110520509477 140-144 24.821983752883362 28.20178517701334 27.39945842944539 19.576772640657907 145-149 24.798195036349963 28.28277763850589 27.194785660566556 19.724241664577587 150-151 25.269491100526448 28.478315367259967 26.82376535472549 19.42842817748809 >>END_MODULE >>Per sequence GC content pass #GC Content Count 0 1.0 1 0.5 2 0.5 3 1.0 4 0.5 5 1.0 6 1.0 7 1.5 8 1.5 9 0.0 10 0.0 11 0.0 12 0.5 13 0.5 14 0.0 15 0.5 16 1.0 17 1.0 18 0.5 19 1.0 20 1.0 21 0.0 22 1.5 23 2.0 24 1.0 25 1.0 26 1.0 27 8.5 28 12.0 29 10.0 30 12.0 31 13.5 32 21.0 33 31.0 34 41.5 35 57.5 36 75.5 37 102.0 38 135.5 39 159.5 40 189.0 41 219.5 42 249.5 43 274.5 44 278.5 45 270.0 46 255.5 47 242.0 48 248.0 49 223.5 50 170.0 51 130.0 52 110.0 53 108.5 54 85.5 55 57.0 56 53.0 57 44.5 58 30.5 59 22.5 60 14.0 61 11.5 62 5.5 63 3.0 64 2.5 65 1.0 66 0.0 67 0.0 68 0.5 69 0.5 70 0.0 71 0.0 72 0.0 73 0.0 74 0.0 75 0.0 76 0.0 77 0.0 78 0.0 79 0.0 80 0.0 81 0.0 82 0.0 83 0.0 84 0.0 85 0.0 86 0.0 87 0.0 88 0.0 89 0.0 90 0.0 91 0.0 92 0.0 93 0.0 94 0.0 95 0.0 96 0.0 97 0.0 98 0.0 99 0.0 100 0.0 >>END_MODULE >>Per base N content pass #Base N-Count 1 0.27499999999999997 2 0.27499999999999997 3 0.27499999999999997 4 0.25 5 0.27499999999999997 6 0.025 7 0.025 8 0.025 9 0.025 10-14 0.025 15-19 0.09 20-24 0.2 25-29 0.245 30-34 0.27499999999999997 35-39 0.26 40-44 0.265 45-49 0.22999999999999998 50-54 0.22499999999999998 55-59 0.21 60-64 0.215 65-69 0.27499999999999997 70-74 0.27499999999999997 75-79 0.27499999999999997 80-84 0.27499999999999997 85-89 0.27499999999999997 90-94 0.27499999999999997 95-99 0.27499999999999997 100-104 0.27499999999999997 105-109 0.27499999999999997 110-114 0.27499999999999997 115-119 0.27499999999999997 120-124 0.27999999999999997 125-129 0.28500000000000003 130-134 0.29 135-139 0.29 140-144 0.29 145-149 0.27499999999999997 150-151 0.27499999999999997 >>END_MODULE >>Sequence Length Distribution pass #Length Count 151 4000.0 >>END_MODULE >>Sequence Duplication Levels pass #Total Deduplicated Percentage 98.925 #Duplication Level Percentage of deduplicated Percentage of total 1 99.19130654536265 98.125 2 0.6317917614354309 1.25 3 0.1516300227445034 0.44999999999999996 4 0.0 0.0 5 0.0 0.0 6 0.0 0.0 7 0.025271670457417232 0.17500000000000002 8 0.0 0.0 9 0.0 0.0 >10 0.0 0.0 >50 0.0 0.0 >100 0.0 0.0 >500 0.0 0.0 >1k 0.0 0.0 >5k 0.0 0.0 >10k+ 0.0 0.0 >>END_MODULE >>Overrepresented sequences warn #Sequence Count Percentage Possible Source AGAACACATTCATACTCCAAGTCTTTTAGTTCATCCATTTAAGCTTAATC 7 0.17500000000000002 No Hit >>END_MODULE >>Adapter Content warn #Position Illumina Universal Adapter Illumina Small RNA 3' Adapter Illumina Small RNA 5' Adapter Nextera Transposase Sequence SOLID Small RNA Adapter 1 0.0 0.0 0.0 0.0 0.0 2 0.0 0.0 0.0 0.0 0.0 3 0.0 0.0 0.0 0.0 0.0 4 0.0 0.0 0.0 0.0 0.0 5 0.0 0.0 0.0 0.0 0.0 6 0.0 0.0 0.0 0.0 0.0 7 0.0 0.0 0.0 0.0 0.0 8 0.0 0.0 0.0 0.0 0.0 9 0.0 0.0 0.0 0.0 0.0 10-11 0.0 0.0 0.0 0.0 0.0 12-13 0.0 0.0 0.0 0.0 0.0 14-15 0.0 0.0 0.0 0.0 0.0 16-17 0.0 0.0 0.0 0.0 0.0 18-19 0.0 0.0 0.0 0.0 0.0 20-21 0.0 0.0 0.0 0.0 0.0 22-23 0.0 0.0 0.0 0.0 0.0 24-25 0.0 0.0 0.0 0.0 0.0 26-27 0.0 0.0 0.0 0.0 0.0 28-29 0.0 0.0 0.0 0.0 0.0 30-31 0.0 0.0 0.0 0.0 0.0 32-33 0.0 0.0 0.0 0.0 0.0 34-35 0.0 0.0 0.0 0.0 0.0 36-37 0.0 0.0 0.0 0.0 0.0 38-39 0.0 0.0 0.0 0.0 0.0 40-41 0.0 0.0 0.0 0.0 0.0 42-43 0.0 0.0 0.0 0.0 0.0 44-45 0.0 0.0 0.0 0.0 0.0 46-47 0.0 0.0 0.0 0.0 0.0 48-49 0.0 0.0 0.0 0.0 0.0 50-51 0.0 0.0 0.0 0.0 0.0 52-53 0.0 0.0 0.0 0.0 0.0 54-55 0.0 0.0 0.0 0.0 0.0 56-57 0.0 0.0 0.0 0.0 0.0 58-59 0.0 0.0 0.0 0.0 0.0 60-61 0.0 0.0 0.0 0.0 0.0 62-63 0.0125 0.0 0.0 0.0 0.0 64-65 0.025 0.0 0.0 0.0 0.0 66-67 0.05 0.0 0.0 0.0 0.0 68-69 0.0875 0.0 0.0 0.0 0.0 70-71 0.15 0.0 0.0 0.0 0.0 72-73 0.175 0.0 0.0 0.0 0.0 74-75 0.225 0.0 0.0 0.0 0.0 76-77 0.2875 0.0 0.0 0.0 0.0 78-79 0.3 0.0 0.0 0.0 0.0 80-81 0.3125 0.0 0.0 0.0 0.0 82-83 0.3625 0.0 0.0 0.0 0.0 84-85 0.375 0.0 0.0 0.0 0.0 86-87 0.4375 0.0 0.0 0.0 0.0 88-89 0.4625 0.0 0.0 0.0 0.0 90-91 0.4875 0.0 0.0 0.0 0.0 92-93 0.6375 0.0 0.0 0.0 0.0 94-95 0.7 0.0 0.0 0.0 0.0 96-97 0.7875 0.0 0.0 0.0 0.0 98-99 0.8875 0.0 0.0 0.0 0.0 100-101 1.0750000000000002 0.0 0.0 0.0 0.0 102-103 1.1749999999999998 0.0 0.0 0.0 0.0 104-105 1.3375 0.0 0.0 0.0 0.0 106-107 1.475 0.0 0.0 0.0 0.0 108-109 1.7125 0.0 0.0 0.0 0.0 110-111 2.075 0.0 0.0 0.0 0.0 112-113 2.4000000000000004 0.0 0.0 0.0 0.0 114-115 2.5375 0.0 0.0 0.0 0.0 116-117 2.7625 0.0 0.0 0.0 0.0 118-119 3.0 0.0 0.0 0.0 0.0 120-121 3.275 0.0 0.0 0.0 0.0 122-123 3.7125 0.0 0.0 0.0 0.0 124-125 4.025 0.0 0.0 0.0 0.0 126-127 4.325 0.0 0.0 0.0 0.0 128-129 4.6375 0.0 0.0 0.0 0.0 130-131 4.9625 0.0 0.0 0.0 0.0 132-133 5.225 0.0 0.0 0.0 0.0 134-135 5.4625 0.0 0.0 0.0 0.0 136-137 5.65 0.0 0.0 0.0 0.0 138-139 5.975 0.0 0.0 0.0 0.0 >>END_MODULE >>Kmer Content pass >>END_MODULE Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735075 spots for SRR7170500.sra Written 735075 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra Read 735057 spots for SRR7170500.sra Written 735057 spots for SRR7170500.sra SRR ids: ['SRR7170500.sra'] extra args: ['--split-files', '--defline-qual', '+'] tempdir: /tmp/pfd_u6l5e43m SRR7170500.sra spots: 14701158 blocks: [[1, 735057], [735058, 1470114], [1470115, 2205171], [2205172, 2940228], [2940229, 3675285], [3675286, 4410342], [4410343, 5145399], [5145400, 5880456], [5880457, 6615513], [6615514, 7350570], [7350571, 8085627], [8085628, 8820684], [8820685, 9555741], [9555742, 10290798], [10290799, 11025855], [11025856, 11760912], [11760913, 12495969], [12495970, 13231026], [13231027, 13966083], [13966084, 14701158]] SRR7170500 file size 4960039 SRR7170500 completed basic pipeline successfully skewer v0.2.2 [April 4, 2016] COMMAND LINE: skewer -f sanger -l 18 -q 10 -k inf -t 20 -o SRR7170500 SRR7170500_1.fastq SRR7170500_2.fastq Input file: SRR7170500_1.fastq Paired file: SRR7170500_2.fastq trimmed: SRR7170500-trimmed-pair1.fastq, SRR7170500-trimmed-pair2.fastq Parameters used: -- 3' end adapter sequence (-x): AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -- paired 3' end adapter sequence (-y): AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTA -- maximum error ratio allowed (-r): 0.100 -- maximum indel error ratio allowed (-d): 0.030 -- end quality threshold (-q): 10 -- minimum read length allowed after trimming (-l): 18 -- file format (-f): Sanger/Illumina 1.8+ FASTQ -- number of concurrent threads (-t): 20 Thu Feb 13 04:45:04 2025 >> started Thu Feb 13 04:52:07 2025 >> done (422.401s) 14701158 read pairs processed; of these: 20482 ( 0.14%) short read pairs filtered out after trimming by size control 32238 ( 0.22%) empty read pairs filtered out after trimming by size control 14648438 (99.64%) read pairs available; of these: 9332622 (63.71%) trimmed read pairs available after processing 5315816 (36.29%) untrimmed read pairs available after processing Length distribution of reads after trimming: length count percentage 18 1 0.00% 19 4 0.00% 20 2 0.00% 21 1 0.00% 22 1 0.00% 23 3 0.00% 24 4 0.00% 25 1 0.00% 26 6 0.00% 27 4 0.00% 28 4 0.00% 29 7 0.00% 30 5 0.00% 31 6 0.00% 32 8 0.00% 33 16 0.00% 34 20 0.00% 35 17 0.00% 36 13 0.00% 37 22 0.00% 38 18 0.00% 39 25 0.00% 40 42 0.00% 41 38 0.00% 42 50 0.00% 43 45 0.00% 44 50 0.00% 45 45 0.00% 46 75 0.00% 47 109 0.00% 48 114 0.00% 49 138 0.00% 50 140 0.00% 51 190 0.00% 52 210 0.00% 53 203 0.00% 54 242 0.00% 55 253 0.00% 56 298 0.00% 57 312 0.00% 58 397 0.00% 59 452 0.00% 60 520 0.00% 61 584 0.00% 62 643 0.00% 63 768 0.01% 64 796 0.01% 65 844 0.01% 66 930 0.01% 67 1024 0.01% 68 1176 0.01% 69 1388 0.01% 70 1561 0.01% 71 1694 0.01% 72 1883 0.01% 73 2264 0.02% 74 2477 0.02% 75 2677 0.02% 76 2872 0.02% 77 3217 0.02% 78 3486 0.02% 79 3891 0.03% 80 4233 0.03% 81 4844 0.03% 82 5553 0.04% 83 6423 0.04% 84 7733 0.05% 85 8123 0.06% 86 8140 0.06% 87 8610 0.06% 88 9024 0.06% 89 9028 0.06% 90 9671 0.07% 91 10555 0.07% 92 11201 0.08% 93 12117 0.08% 94 12559 0.09% 95 13606 0.09% 96 14422 0.10% 97 14776 0.10% 98 14852 0.10% 99 15329 0.10% 100 16303 0.11% 101 16772 0.11% 102 17742 0.12% 103 18446 0.13% 104 19301 0.13% 105 20150 0.14% 106 20836 0.14% 107 21183 0.14% 108 21289 0.15% 109 22176 0.15% 110 22363 0.15% 111 22687 0.15% 112 23218 0.16% 113 24010 0.16% 114 25202 0.17% 115 26117 0.18% 116 26974 0.18% 117 27490 0.19% 118 27902 0.19% 119 28431 0.19% 120 29208 0.20% 121 29568 0.20% 122 31186 0.21% 123 32184 0.22% 124 33485 0.23% 125 34771 0.24% 126 36332 0.25% 127 38034 0.26% 128 39130 0.27% 129 41406 0.28% 130 43188 0.29% 131 45344 0.31% 132 48612 0.33% 133 51705 0.35% 134 55498 0.38% 135 59253 0.40% 136 63878 0.44% 137 69726 0.48% 138 76243 0.52% 139 84385 0.58% 140 94354 0.64% 141 109835 0.75% 142 125958 0.86% 143 147111 1.00% 144 180069 1.23% 145 226247 1.54% 146 301170 2.06% 147 431189 2.94% 148 671763 4.59% 149 1281965 8.75% 150 4132148 28.21% 151 5315816 36.29% 14648438 reads passed initial QC criterion=sequence-density sequence-density=0.66 sequence-density-rank=1 fanout-score=1.94 fanout-score-rank=31 prefix-density=0.64 prefix-fanout=1.9 sequence=GTTAGGGTAAGCTTTCTTCGCCTCCTCGAGCTCAATCAGCACCTGAGATGCCTCAGTGCATCCAAACATGGGTAGTTTCCACATAGTCCAGTAGCGTCCATCATAGTACCCTGG criterion=fanout-score sequence-density=0.02 sequence-density-rank=32 fanout-score=23.36 fanout-score-rank=1 prefix-density=0.11 prefix-fanout=4.7 sequence=AATGAAGAAGACACAAAGATAAAGACACTCACGGACACTTTTGTTTGTTCACTCCACACCCACAAGTACAGAAGAACACAGATTATTTATCAGAAATTACATTATTAATCCACTCCCAATCCCACATCAAACATGATAGTTGATGTGCTTGCTTAATGACCGCATGTGCAGGTAGTGCAAGTGCAGCCAGTACCGCAGTTGCACTTGCCATCGTTCTCAGCTGCTGGCACCTCCATGACTACGGAGGAGACATAGTTCTTCTCAGTCTCGACGATGCCAGCAGTGTAGCTGCTTCCCTTCTTGACACACTGGGTCTTGTCAGCGCAGTCGCAGGTGTCGCAGGTGCTAGACATGATGATTGATTGATTAAGCTTAAATGGATGAACTAAAAGACTTGGAGTATGAATGTGTTCTCTG criterion=sequence-density sequence-density=0.60 sequence-density-rank=1 fanout-score=1.97 fanout-score-rank=33 prefix-density=0.60 prefix-fanout=2.0 sequence=TACCTTCTTCGCAACAAGTGGGTTCCTTGCTTGGAATTCGAGTTGGAGAAAGGTTGGGTCTACCGCGAGCACCACCAGTCCCCAGGGTACTATGATGGACGCTACTGGACTATGTGGAA criterion=fanout-score sequence-density=0.20 sequence-density-rank=17 fanout-score=14.87 fanout-score-rank=1 prefix-density=0.61 prefix-fanout=4.8 sequence=AGCAATGGCAGCA SRR7170500 testing PE reads STAR mapping to Ensembl genome Started job on | Feb 13 05:18:15 Started mapping on | Feb 13 05:18:20 Finished on | Feb 13 05:55:13 Mapping speed, Million of reads per hour | 23.83 Number of input reads | 14648438 Average input read length | 292 UNIQUE READS: Uniquely mapped reads number | 13733957 Uniquely mapped reads % | 93.76% Average mapped length | 291.52 Number of splices: Total | 12903706 Number of splices: Annotated (sjdb) | 12630759 Number of splices: GT/AG | 12660407 Number of splices: GC/AG | 200590 Number of splices: AT/AC | 8038 Number of splices: Non-canonical | 34671 Mismatch rate per base, % | 0.45% Deletion rate per base | 0.03% Deletion average length | 2.54 Insertion rate per base | 0.02% Insertion average length | 2.15 MULTI-MAPPING READS: Number of reads mapped to multiple loci | 366303 % of reads mapped to multiple loci | 2.50% Number of reads mapped to too many loci | 25504 % of reads mapped to too many loci | 0.17% UNMAPPED READS: % of reads unmapped: too many mismatches | 0.00% % of reads unmapped: too short | 3.50% % of reads unmapped: other | 0.07% CHIMERIC READS: Number of chimeric reads | 0 % of chimeric reads | 0.00% N_unmapped 559467 559467 559467 N_multimapping 366303 366303 366303 N_noFeature 431249 13510207 494713 N_ambiguous 264744 832 104132 UnstrandedReadsAssigned:13037964 PositiveStrandReadsAssigned:222918 NegativeStrandReadsAssigned:13135112 Dataset is classified negative stranded MeadianReadLen=151 20thPercentileLength=146 echo kmer=141 SRR7170500 Starting Kallisto paired end mapping to ensembl reference transcriptome [quant] fragment length distribution will be estimated from the data [index] k-mer length: 31 [index] number of targets: 52,400 [index] number of k-mers: 62,057,036 [index] number of equivalence classes: 130,681 [quant] running in paired-end mode [quant] will process pair 1: SRR7170500-trimmed-pair1.fastq SRR7170500-trimmed-pair2.fastq [quant] finding pseudoalignments for the reads ... done [quant] processed 14,648,438 reads, 13,110,887 reads pseudoaligned [quant] estimated average fragment length: 260.606 [ em] quantifying the abundances ... done [ em] the Expectation-Maximization algorithm ran for 1,099 rounds 52401 SRR7170500.ke.tsv 34699 SRR7170500.se.tsv 87100 total ==> SRR7170500.ke.tsv <== target_id length eff_length est_counts tpm Potri.005G200100.1.v4.1 2018 1758.39 692 27.3305 Potri.005G024800.1.v4.1 1035 775.394 228 20.4207 Potri.004G059700.1.v4.1 961 701.4 4 0.396052 Potri.007G009000.2.v4.1 1416 1156.39 0 0 Potri.003G141000.2.v4.1 2943 2683.39 500 12.9403 Potri.016G087400.1.v4.1 270 81.2795 915 781.804 Potri.015G069301.1.v4.1 564 308.655 0 0 Potri.010G195200.1.v4.1 1773 1513.39 60 2.75332 Potri.012G127500.1.v4.1 977 717.394 93 9.00292 ==> SRR7170500.se.tsv <== Potri.001G166300.v4.1 0 Potri.001G448400.v4.1 580 Potri.001G233950.v4.1 0 Potri.001G122700.v4.1 324 Potri.001G212900.v4.1 50 Potri.001G182400.v4.1 0 Potri.001G256600.v4.1 0 Potri.001G040500.v4.1 9 Potri.001G416900.v4.1 0 Potri.001G452600.v4.1 1 SRR7170500 completed mapping pipeline successfully